Download The Human Genome Project

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

DNA paternity testing wikipedia , lookup

Mutagen wikipedia , lookup

Mutation wikipedia , lookup

DNA virus wikipedia , lookup

Metagenomics wikipedia , lookup

Replisome wikipedia , lookup

DNA polymerase wikipedia , lookup

SNP genotyping wikipedia , lookup

DNA profiling wikipedia , lookup

Transposable element wikipedia , lookup

Comparative genomic hybridization wikipedia , lookup

Zinc finger nuclease wikipedia , lookup

Primary transcript wikipedia , lookup

Bisulfite sequencing wikipedia , lookup

Gene therapy wikipedia , lookup

Mitochondrial DNA wikipedia , lookup

Nucleosome wikipedia , lookup

Minimal genome wikipedia , lookup

Oncogenomics wikipedia , lookup

Point mutation wikipedia , lookup

DNA damage theory of aging wikipedia , lookup

DNA vaccination wikipedia , lookup

Nutriepigenomics wikipedia , lookup

No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup

Nucleic acid analogue wikipedia , lookup

Cancer epigenetics wikipedia , lookup

Gene wikipedia , lookup

Genealogical DNA test wikipedia , lookup

Genome (book) wikipedia , lookup

United Kingdom National DNA Database wikipedia , lookup

Human Genome Project wikipedia , lookup

Molecular cloning wikipedia , lookup

Nucleic acid double helix wikipedia , lookup

Cell-free fetal DNA wikipedia , lookup

Genetic engineering wikipedia , lookup

Human genome wikipedia , lookup

DNA supercoil wikipedia , lookup

Epigenomics wikipedia , lookup

Microsatellite wikipedia , lookup

Genomic library wikipedia , lookup

Cre-Lox recombination wikipedia , lookup

Gel electrophoresis of nucleic acids wikipedia , lookup

Genome evolution wikipedia , lookup

Genomics wikipedia , lookup

Deoxyribozyme wikipedia , lookup

Extrachromosomal DNA wikipedia , lookup

Site-specific recombinase technology wikipedia , lookup

Therapeutic gene modulation wikipedia , lookup

Vectors in gene therapy wikipedia , lookup

Non-coding DNA wikipedia , lookup

Designer baby wikipedia , lookup

Microevolution wikipedia , lookup

Genome editing wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Helitron (biology) wikipedia , lookup

History of genetic engineering wikipedia , lookup

Transcript
http://www.youtube.com/wa
tch?v=XuUpnAz5y1g&featur
e=related
Mastery Quiz 3.01-B



Title
Date
U4-17
DNA Technology
Gel Electrophoresis
DNA Fingerprinting
Working with and fingerprinting DNA.
How is DNA used to identify people or organisms?
How do we make a DNA Fingerprint?

The simplified steps. Write all of this down.
1.
2.
3.
4.
5.
Collect DNA evidence.
Extract DNA from subject or evidence.
Cut the DNA with enzymes.
Separate the DNA sections with gel
electrophoresis.
Compare the gels (DNA fingerprints).
DNA extraction


What has DNA?
Living things or even recently living things.
Cutting the DNA


Restriction enzymes will cut the DNA at
special spots in the DNA.
Hundreds of restriction enzymes each cut
DNA at a different spot.
1.
2.
3.
TTGCTTCTGCTAACATCGATCTTCAGCTAC
AACGAAGACGATTGTAGCTAGAAGTCGATG
One restriction
enzyme cuts DNA
like this.
CTTC
GAAG
Separate the DNA pieces.

We have many different
sized pieces in one test
tube.
Add some dye.
Put the DNA into the well
of a gel plate.
Put the gel plate in an
electrophoresis chamber.
Turn it on.

But how does it work?




Gel Electrophoresis


As electricity flows through the gel it pulls the
DNA with it.
The bigger the DNA piece the slower it
moves.
Big pieces
Small pieces
Gel Electrophoresis
Compare the DNA of different gels.
Evidence
Suspect 1
Suspect 2
Compare the DNA of different gels.
Baby
Mother
Father
Compare the DNA of different gels.
Baby
Mother
Father
Compare the DNA of different gels.
Baby
Mother
Father
Uses for DNA Fingerprinting.
Write all of this down.
1. Genetic Counselors
•
Detecting Genetic Disorders
Paternity Testing
2.
•
Who’s the baby daddy?
Crime Scenes
3.
•
Who done it?
Evolutionary Relationships
4.
•
Who are our closest evolutionary relatives?
Who should have your DNA?
o
o
o
o
The government has a database of real
fingerprints.
Should the government have a data base of
DNA fingerprints?
What is the difference?
Should they collect DNA from everyone?
Would you want to know?
•
•
•
If there was a way to find out if you were
more likely to get cancer than someone else,
would you want to know?
What tests would you need to perform?
What information would you need to gather?
The Human Genome Project
A written version of a human genome
letters.
Write all of this down.
1990 - 2000
Discovered over 3 billion base pairs.
At 12 font single spaced over 3 boxes of
copy paper.
The Human Genome Project







Scientists made a map of the entire human
genome, every A, T, G, and C
>98% of human genome does not code for
proteins
Is there one map for every human?
Now there is a database of genes.
We still don’t know what all the genes do.
What do genes do?
Code for proteins.
The Human Genome Project


Does Bob have a genetic disorder that runs
in his family?
Now we can just look at his genes to see.
The Human Genome Project


Breast Cancer has been linked to certain
genes.
Women can now get a screening for this
gene to see if they are susceptible to getting
breast cancer.
Gene Therapy
W
Write all of this down.
Fixing or adding genes to all cells in the
body with viruses.
Viruses - A tool for gene therapy.


Non living things with
genes inside.
They inject DNA into
a cell.
What is Gene Therapy?






If a gene is defective or missing then a problem
results.
If the gene is identified then it can possibly be
fixed. (the reason for the human genome
project)
Viruses with the missing gene inside can be
injected into the person with the missing gene.
The Viruses infect cells and inject the gene.
Now the person has good copies of the gene.
This can cure a disease.
Viruses - A tool for gene therapy.


Could we change a
person’s genes this
way?
Would you?
Human Genome Project Ethics Essay
4 paragraphs – over one and a half pages long, hand written.
OR
4 paragraphs – one full page typed.
Par. 1 - What is the human genome project? How has this
project/discovery enabled this ethical debate to be an
issue? How do we now have the power to do what is
stated below?
Par. 2 - What positive outcomes could result of going through
with the issue?
Par. 3 - What negative outcomes could result of going
through with the issue?
Par. 4 - What is your stand or opinion on the issue and why?
Would you do it?
Ethical Questions
If you could customize your child e.g. boy or girl, eye
color, height, intelligence, physical strength, would
you? Super Race? X-Men?
If you knew your child had a genetic disorder that would
result in a very short life or a poor quality of life, would
you still have the child? Abortion or Adoption?
Should other people like the police have access to your
genetic information? Should insurance companies or
employers have access to your genetic information?
Should your doctors have a copy of your genome?
Should we use gene therapy to cure diseases? “I am
Legend”