* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download The Human Genome Project
DNA paternity testing wikipedia , lookup
Metagenomics wikipedia , lookup
DNA polymerase wikipedia , lookup
SNP genotyping wikipedia , lookup
DNA profiling wikipedia , lookup
Transposable element wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Primary transcript wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Gene therapy wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
Minimal genome wikipedia , lookup
Oncogenomics wikipedia , lookup
Point mutation wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
DNA vaccination wikipedia , lookup
Nutriepigenomics wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Genome (book) wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Human Genome Project wikipedia , lookup
Molecular cloning wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Genetic engineering wikipedia , lookup
Human genome wikipedia , lookup
DNA supercoil wikipedia , lookup
Epigenomics wikipedia , lookup
Microsatellite wikipedia , lookup
Genomic library wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Genome evolution wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Non-coding DNA wikipedia , lookup
Designer baby wikipedia , lookup
Microevolution wikipedia , lookup
Genome editing wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
http://www.youtube.com/wa tch?v=XuUpnAz5y1g&featur e=related Mastery Quiz 3.01-B Title Date U4-17 DNA Technology Gel Electrophoresis DNA Fingerprinting Working with and fingerprinting DNA. How is DNA used to identify people or organisms? How do we make a DNA Fingerprint? The simplified steps. Write all of this down. 1. 2. 3. 4. 5. Collect DNA evidence. Extract DNA from subject or evidence. Cut the DNA with enzymes. Separate the DNA sections with gel electrophoresis. Compare the gels (DNA fingerprints). DNA extraction What has DNA? Living things or even recently living things. Cutting the DNA Restriction enzymes will cut the DNA at special spots in the DNA. Hundreds of restriction enzymes each cut DNA at a different spot. 1. 2. 3. TTGCTTCTGCTAACATCGATCTTCAGCTAC AACGAAGACGATTGTAGCTAGAAGTCGATG One restriction enzyme cuts DNA like this. CTTC GAAG Separate the DNA pieces. We have many different sized pieces in one test tube. Add some dye. Put the DNA into the well of a gel plate. Put the gel plate in an electrophoresis chamber. Turn it on. But how does it work? Gel Electrophoresis As electricity flows through the gel it pulls the DNA with it. The bigger the DNA piece the slower it moves. Big pieces Small pieces Gel Electrophoresis Compare the DNA of different gels. Evidence Suspect 1 Suspect 2 Compare the DNA of different gels. Baby Mother Father Compare the DNA of different gels. Baby Mother Father Compare the DNA of different gels. Baby Mother Father Uses for DNA Fingerprinting. Write all of this down. 1. Genetic Counselors • Detecting Genetic Disorders Paternity Testing 2. • Who’s the baby daddy? Crime Scenes 3. • Who done it? Evolutionary Relationships 4. • Who are our closest evolutionary relatives? Who should have your DNA? o o o o The government has a database of real fingerprints. Should the government have a data base of DNA fingerprints? What is the difference? Should they collect DNA from everyone? Would you want to know? • • • If there was a way to find out if you were more likely to get cancer than someone else, would you want to know? What tests would you need to perform? What information would you need to gather? The Human Genome Project A written version of a human genome letters. Write all of this down. 1990 - 2000 Discovered over 3 billion base pairs. At 12 font single spaced over 3 boxes of copy paper. The Human Genome Project Scientists made a map of the entire human genome, every A, T, G, and C >98% of human genome does not code for proteins Is there one map for every human? Now there is a database of genes. We still don’t know what all the genes do. What do genes do? Code for proteins. The Human Genome Project Does Bob have a genetic disorder that runs in his family? Now we can just look at his genes to see. The Human Genome Project Breast Cancer has been linked to certain genes. Women can now get a screening for this gene to see if they are susceptible to getting breast cancer. Gene Therapy W Write all of this down. Fixing or adding genes to all cells in the body with viruses. Viruses - A tool for gene therapy. Non living things with genes inside. They inject DNA into a cell. What is Gene Therapy? If a gene is defective or missing then a problem results. If the gene is identified then it can possibly be fixed. (the reason for the human genome project) Viruses with the missing gene inside can be injected into the person with the missing gene. The Viruses infect cells and inject the gene. Now the person has good copies of the gene. This can cure a disease. Viruses - A tool for gene therapy. Could we change a person’s genes this way? Would you? Human Genome Project Ethics Essay 4 paragraphs – over one and a half pages long, hand written. OR 4 paragraphs – one full page typed. Par. 1 - What is the human genome project? How has this project/discovery enabled this ethical debate to be an issue? How do we now have the power to do what is stated below? Par. 2 - What positive outcomes could result of going through with the issue? Par. 3 - What negative outcomes could result of going through with the issue? Par. 4 - What is your stand or opinion on the issue and why? Would you do it? Ethical Questions If you could customize your child e.g. boy or girl, eye color, height, intelligence, physical strength, would you? Super Race? X-Men? If you knew your child had a genetic disorder that would result in a very short life or a poor quality of life, would you still have the child? Abortion or Adoption? Should other people like the police have access to your genetic information? Should insurance companies or employers have access to your genetic information? Should your doctors have a copy of your genome? Should we use gene therapy to cure diseases? “I am Legend”