* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Ch. 19 – Eukaryotic Genomes
Mitochondrial DNA wikipedia , lookup
Epigenetics wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Ridge (biology) wikipedia , lookup
Biology and consumer behaviour wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Long non-coding RNA wikipedia , lookup
Transposable element wikipedia , lookup
Epigenetics of neurodegenerative diseases wikipedia , lookup
Molecular cloning wikipedia , lookup
Genetic engineering wikipedia , lookup
Genomic imprinting wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
DNA supercoil wikipedia , lookup
DNA vaccination wikipedia , lookup
Epigenetics in learning and memory wikipedia , lookup
Oncogenomics wikipedia , lookup
Genomic library wikipedia , lookup
Gene expression profiling wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Human genome wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Genome (book) wikipedia , lookup
Epigenomics wikipedia , lookup
Minimal genome wikipedia , lookup
Point mutation wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Designer baby wikipedia , lookup
Genome evolution wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Microevolution wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Genome editing wikipedia , lookup
Helitron (biology) wikipedia , lookup
Non-coding DNA wikipedia , lookup
History of genetic engineering wikipedia , lookup
Primary transcript wikipedia , lookup
Ch. 19 – Eukaryotic Genomes 2 challenges of eukaryotic genome expression – Volume of genome – 50,000 – 100,000 genes 20 x prokaryote Organized around proteins Cell specialization Lots of DNA do not = RNA/ protein Gene disruption/placement can lead to cancers Structure of Chromatin o “ chromatin structure is based on successive levels of DNA packing” o Prokaryotic DNA – associated with proteins and looped in orderly manner Eukaryotic DNA – see diagram on next slide and pg. 345 DNA double helix – sequence of nucleotides with o covalent bonds histone proteins – 50/50 with DNA mass, + arginine & lysine Nucleosomes – “beads” chromatin - fibers looped domains – compaction of chromatin in mitotic cells chromosomes Genome Organization on the DNA Genes are a small portion of the genome (97% does NOT code for a protein!!) Regulatory sequences Lots not understood – – Introns Repetitive DNA, some of which is ‘satellite’ Tandem and interspersed YOU NEVER HEARD THIS IN BIOLOGY Vocabulary Introns – interrupt coding stretches of DNA and are excised from the final mRNA, are not expressed as protein, but are within protein coding zones Tandemly Repetitive DNA – present in many, many copies, not within genes. In mammals 10-15% of the DNA is tandemly repetitive DNA – GTTACGTTACGTTACGTTACGTTAC – 10 base pairs – Repeated up to 100,000 times – Different density in a centrifuge (banding) – DNA fingerprinting – Genetic disorders – Mostly found at telomeres and centromeres – suggesting a structural role more Interspersed repetitive DNA – – – Not harmful Does code…??? Lots is found at transposons Multigene families – – – – – – Genes present in more than one copy per haploid set Identical or very close nucleotide sequences Likely evolved from one ancestral gene Clustered or dispersed 100-1000 copies of rRNA gene Nonidentical sequences can be clustered because all parts are need for a particular protein (a and b hemoglobin) Errors ???? Gene families all arose from the same ancestor either by duplication, chromosome errors, transposons or recombination ---- is it a mistake or not a mistake…. Also regions called pseudogenes that are very similar in sequence to functional genes but lack regulatory genes or have regions of noncoding DNA Genetic Disorders Huntington’s Disease – Fragile x syndrome – – – – – – CAG is translated into string of glutamines Form of mental retardation that is most commonly linked to genetic inheritance 1:1500 males, 1:2500 females X chromosome ‘looks different’ More common when fragile x is inherited from mother Normal allele - 5’ region of nontranslating exon GGG 30x Syndrome allele – GGG is repeated 100’s – 1000’s x and hang off the end of the X chromosome. Triplet repeat disorders – – – Affect the nervous system Length of sequence impacts both age of onset and severity Accumulate over generations Genes can be amplified, rearranged or lost – altering a CELL’S genome Amplification – – Rearrangement – – – – Extra copies of genes (like those for RNA) can be beneficial in the embryo Conversely it is also observed in cancer cells Transposons: regions of DNA that can move from one location to another…position effects this impact. 10% of human genome, 50% in some plants Retrotransposons : move with help of RNA/reverse transcriptionase Cell differentiation….production of immunoglobulins Loss Control of Gene Expression Best example – see arrangement/rearrangement of sequences to create antibodies 3-5% of genome expressed at any given moment, especially in differentiated/specialized cells of multicellular organisms – Chromatin modifications – make DNA available for transcription – DNA methylation – genomic imprinting Histone acetylation Transcription initiation – interactions with other genes (enzymes) Transcription factors, activators, enhancers, coordinate control …. Lots of big words Transcription initiation complex – resembles a prok promoter by being upstream Control elements – segments of noncoding DNA that regulate transcription by binding transcription factors Enhancers – help bend DNA for transcription factors, can be far from gene, even downstream Activators – help to position the initiation complex Silencers – act like prok repressors, probably modify chromatin Coordinately controlled genes – collections of genes, that are related, are usually all expressed or all repressed, and are all transcribed together, even if they are not near on the chromosome. Alternative splicing Regulation of gene expression after transcription Different mRNA can be produced depending on which introns are removed mRNA degradation after translation regulates amount of a protein produced Leader strands on mRNA means it may not all fit into ribosomes for immediate translation Proteins associated with ribosomes may provide a means of control in developing embryos where ‘everything’ is ‘on’ at once proteases Some proteins, like cyclins, need to be degraded after they are used….. Giant proteins called proteases act like ‘shredders’ for this information. Mutations in this mechanism may leave some cells ‘permanently ON’ and create cancerous situations. Cancer and Molecular Biology Mutagens – Chemical carcinogens, physical mutagens Estimate that viruses are involved in about 15% of cancers 15% of colon and 10% of breast cancer have inherited factors Have discovered markers for BRCA I and BRCA II Oncogenes – Proto-oncogenes – Genes that may cause cancer (trigger cell division) Code for proteins that regulate normal cell division Tumor suppressor genes – Genes whose job it is to control unwanted cell division