Download Ch. 19 – Eukaryotic Genomes

Ch. 19 – Eukaryotic Genomes
2 challenges of eukaryotic genome expression
–
Volume of genome



–
50,000 – 100,000 genes
20 x prokaryote
Organized around proteins
Cell specialization


Lots of DNA do not = RNA/ protein
Gene disruption/placement can lead to cancers
Structure of Chromatin
o
“ chromatin structure is based on successive levels
of DNA packing”
o
Prokaryotic DNA – associated with proteins and
looped in orderly manner
Eukaryotic DNA – see diagram on next slide and pg. 345
DNA double helix – sequence of nucleotides with
o
covalent bonds
histone proteins – 50/50 with DNA mass,
+ arginine & lysine
Nucleosomes – “beads”
chromatin - fibers
looped domains – compaction of chromatin in mitotic
cells
chromosomes
Genome Organization on the DNA



Genes are a small portion of the genome (97% does
NOT code for a protein!!)
Regulatory sequences
Lots not understood
–
–
Introns
Repetitive DNA, some of which is ‘satellite’

Tandem and interspersed
YOU NEVER HEARD THIS IN BIOLOGY 
Vocabulary


Introns – interrupt coding stretches of DNA and are excised
from the final mRNA, are not expressed as protein, but are
within protein coding zones
Tandemly Repetitive DNA – present in many, many copies, not
within genes. In mammals 10-15% of the DNA is tandemly
repetitive DNA
– GTTACGTTACGTTACGTTACGTTAC
– 10 base pairs
– Repeated up to 100,000 times
– Different density in a centrifuge (banding)
– DNA fingerprinting
– Genetic disorders
– Mostly found at telomeres and centromeres – suggesting a
structural role
more

Interspersed repetitive DNA
–
–
–

Not harmful
Does code…???
Lots is found at transposons
Multigene families
–
–
–
–
–
–
Genes present in more than one copy per haploid set
Identical or very close nucleotide sequences
Likely evolved from one ancestral gene
Clustered or dispersed
100-1000 copies of rRNA gene
Nonidentical sequences can be clustered because all parts
are need for a particular protein (a and b hemoglobin)
Errors ????


Gene families all arose from the same
ancestor either by duplication, chromosome
errors, transposons or recombination ---- is it
a mistake or not a mistake….
Also regions called pseudogenes that are
very similar in sequence to functional genes
but lack regulatory genes or have regions of
noncoding DNA
Genetic Disorders

Huntington’s Disease
–

Fragile x syndrome
–
–
–
–
–
–

CAG is translated into string of glutamines
Form of mental retardation that is most commonly linked to genetic inheritance
1:1500 males, 1:2500 females
X chromosome ‘looks different’
More common when fragile x is inherited from mother
Normal allele - 5’ region of nontranslating exon GGG 30x
Syndrome allele – GGG is repeated 100’s – 1000’s x and hang off the end of the X
chromosome.
Triplet repeat disorders
–
–
–
Affect the nervous system
Length of sequence impacts both age of onset and severity
Accumulate over generations
Genes can be amplified, rearranged or
lost – altering a CELL’S genome

Amplification
–
–

Rearrangement
–
–
–
–

Extra copies of genes (like those for RNA) can be beneficial
in the embryo
Conversely it is also observed in cancer cells
Transposons: regions of DNA that can move from one
location to another…position effects this impact.
10% of human genome, 50% in some plants
Retrotransposons : move with help of RNA/reverse
transcriptionase
Cell differentiation….production of immunoglobulins
Loss
Control of Gene Expression


Best example – see arrangement/rearrangement of
sequences to create antibodies
3-5% of genome expressed at any given moment,
especially in differentiated/specialized cells of
multicellular organisms
–
Chromatin modifications – make DNA available for transcription


–
DNA methylation – genomic imprinting
Histone acetylation
Transcription initiation – interactions with other genes (enzymes)

Transcription factors, activators, enhancers, coordinate control ….
Lots of big words






Transcription initiation complex – resembles a prok promoter by
being upstream
Control elements – segments of noncoding DNA that regulate
transcription by binding transcription factors
Enhancers – help bend DNA for transcription factors, can be far
from gene, even downstream
Activators – help to position the initiation complex
Silencers – act like prok repressors, probably modify chromatin
Coordinately controlled genes – collections of genes, that are
related, are usually all expressed or all repressed, and are all
transcribed together, even if they are not near on the
chromosome.
Alternative splicing





Regulation of gene expression after transcription
Different mRNA can be produced depending on
which introns are removed
mRNA degradation after translation regulates
amount of a protein produced
Leader strands on mRNA means it may not all fit into
ribosomes for immediate translation
Proteins associated with ribosomes may provide a
means of control in developing embryos where
‘everything’ is ‘on’ at once
proteases



Some proteins, like cyclins, need to be
degraded after they are used…..
Giant proteins called proteases act like
‘shredders’ for this information.
Mutations in this mechanism may leave
some cells ‘permanently ON’ and create
cancerous situations.
Cancer and Molecular Biology

Mutagens
–
Chemical carcinogens, physical mutagens

Estimate that viruses are involved in about 15% of cancers
15% of colon and 10% of breast cancer have inherited factors
Have discovered markers for BRCA I and BRCA II

Oncogenes


–

Proto-oncogenes
–

Genes that may cause cancer (trigger cell division)
Code for proteins that regulate normal cell division
Tumor suppressor genes
–
Genes whose job it is to control unwanted cell division