* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download The Good, the bad and the ugly of Genetic Engineering
Mitochondrial DNA wikipedia , lookup
DNA polymerase wikipedia , lookup
Minimal genome wikipedia , lookup
Transposable element wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Epigenetics in learning and memory wikipedia , lookup
Gene expression profiling wikipedia , lookup
Gene nomenclature wikipedia , lookup
Human genome wikipedia , lookup
Primary transcript wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Genealogical DNA test wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Gene therapy wikipedia , lookup
Genome (book) wikipedia , lookup
DNA supercoil wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
DNA vaccination wikipedia , lookup
Genome evolution wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Epigenetics of diabetes Type 2 wikipedia , lookup
Epigenomics wikipedia , lookup
Point mutation wikipedia , lookup
Non-coding DNA wikipedia , lookup
Genomic library wikipedia , lookup
Molecular cloning wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Genome editing wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Genetic engineering wikipedia , lookup
Helitron (biology) wikipedia , lookup
Designer baby wikipedia , lookup
Microevolution wikipedia , lookup
The Good, the bad and the ugly of Genetic Engineering • Genetic engineering is the human manipulation of the DNA code of an organism in order to: –Make transgenic organisms –Clone an organism –Perform Gene therapy Transgenic Organisms • Organisms which express a gene from another organism • Insert gene of interest into another organism, receiving organism now makes the protein from that gene Practical applications • Plants with “insecticide” genes • Cows with extra copies of growth hormones • Insulin making bacteria And most importantly…… (haha) Practical applications? • Cool Glow-in-the-dark Mice!! Going back to the insulin made by bacteria • Diabetes: dysfunctional Insulin gene; no or low amounts of insulin protein made – we can force bacteria to make insulin for us • Bacteria have circular pieces of DNA called Plasmids • They can replicate, transcribe and translate any genes on the plasmid • In plasmids there are also specific sequences called restriction sites restriction site • Restriction enzymes recognize the sites and cut the DNA at that site • Each restriction enzyme recognizes and cuts a different sequence Examples: Rest. Enzyme Rest. Site EcoRI GAATTC Hind III AAGCTT BamH1 GGATCC Restriction enzymes recognize the sites and cut one strand of the DNA at that site G AATTCGACTAGCGAT GTGGATCGATCTTAA GCTGATCGCTA CACCTAGCTA • How many pieces do you get? G GAATTC AATTC GACTAGCGAT GACTAGCGAT GTGGATCGATCTTAAGCTGATCGCTA GTGGATCGATCTTAA GCTGATCGCTA CACCTAGCTA CACCTAGCTA • Single stranded ends are “sticky” –Want to bind to complimentary bases G GTGGATCGATCTTAA CACCTAGCTA AATTCGACTAGCGAT GCTGATCGCTA • We can take advantage of this and insert any gene we want into the breaks • Example: The Insulin gene insulin • What enzyme can we use to “seal the gaps” between plasmid DNA and insulin DNA? insulin Put plasmid back into bacteria (a process called transformation) Bacteria will transcribe and translate our insulin gene even though the insulin protein doesn’t do anything for a bacterial cell. Then we can take out the insulin protein and use it to treat diabetics. Same basic procedure, many different transgenics! • Giving cows extra copies of the growth hormone gene • Giving plants the gene that insects have to ward off other enemy insects • Giving mice the gene that jelly fish use to fluoresce Cloning • Creating an organism that is genetically identical to its parent. Cloning • Mammals usually fuse info from two parents (sexual reproduction) • Cloning takes all the chromosomes from 1 parent. Sheep 1 Take 1 body cell (udder) Sheep 2 Take 1 egg cell Extract Nucleus Remove nucleus Inject nucleus into Egg Zap to stimulate cell division Implant embryo into surrogate sheep (sheep 3) Wait for Dolly to be born Which sheep is Dolly identical to?? Why? Which sheep have to be female? Snuppy Human Genome project What it did do: Tell us each an every nucleotide of the human genome (all 3.2 billion) What it did not do: Tell us what it all means!!! Human Genome project Now we have to break it down and determine: - which pieces are genes - which pieces are junk - what info the genes hold. DNA finger printing • Used to compare two people’s DNA • Used in paternity cases • Used for crime scene analysis DNA finger printing DNA finger printing • Based on the idea that EVERYONE’s DNA is unique, like a fingerprint • BUT related individuals will have more similarities How to do a DNA fingerprint • Get a sample of DNA and digest it with restriction enzymes How to do a DNA fingerprint • If everyone’s DNA is unique, the enzyme will cut each persons DNA differently • Example: • TCATGAATTCATTGCCGAATTCCGTGAATCCAGAATTCGGACTA • TCATGAAGTCATTGCCGAATTCCGTGAATCCAGACTTCGGACTA How to do a DNA fingerprint • Run cut up DNA on through electrophoresis • Click here for animation How to do a DNA fingerprint • Small pieces travel fast and move further down the gel slab. • Large pieces move slower and stay closer to the injection point. Gene Therapy • Taking genetic testing one step further • Gene therapy tries to FIX the genetic problem How do we fix a gene? Take a virus that naturally infects the type of cells that are deffective. How do we fix a gene? Remove all the virus’s DNA. Replace it with correct copy of deffective gene Possibilities? 1. Cystic fibrosis 2. Hemophilia 3. Cancer