* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download No Slide Title
Quantitative trait locus wikipedia , lookup
Genomic imprinting wikipedia , lookup
Epigenetics in learning and memory wikipedia , lookup
X-inactivation wikipedia , lookup
Metagenomics wikipedia , lookup
Primary transcript wikipedia , lookup
Copy-number variation wikipedia , lookup
DNA vaccination wikipedia , lookup
Human genome wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
DNA supercoil wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Public health genomics wikipedia , lookup
Saethre–Chotzen syndrome wikipedia , lookup
SNP genotyping wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Transposable element wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Epigenetics of diabetes Type 2 wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Epigenomics wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Gene nomenclature wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Non-coding DNA wikipedia , lookup
Gene therapy wikipedia , lookup
Gene expression profiling wikipedia , lookup
Point mutation wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Gene desert wikipedia , lookup
Gene expression programming wikipedia , lookup
Molecular cloning wikipedia , lookup
Genome evolution wikipedia , lookup
Genetic engineering wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Genome (book) wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Genomic library wikipedia , lookup
Genome editing wikipedia , lookup
Microsatellite wikipedia , lookup
History of genetic engineering wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Helitron (biology) wikipedia , lookup
Microevolution wikipedia , lookup
Isolation of genes controlling traits of interest The biggest limitation to recombinant DNA approaches to plant and animal improvement is that we have not identified the genes we need to manipulate. I Methods that require no knowledge of the gene product •Positional (map based) cloning •Insertional inactivation •Complementation (transformation of whole library) II Methods that use information on the gene product •Homology based •Based on expression pattern Requirements for Positional Cloning •DNA markers (RFLPs, PCR markers etc.) that are genetically tightly linked to the gene. • Large family segregating for the gene and the DNA markers. •Easiest for trait controlled by single gene, preferably an easy to classify phenotype. Review of genetic linkage Linkage between genes can be defined by three examples 1. Independent assortment (unlinked) AaBb X aabb Parental genotypes 0.25 AB 0.25 Ab 0.25 aB 0.25 ab X All ab 0.25 AaBb 0.25 Aabb 0.25 aaBb 0.25 aabb X All ab 0.50 AB/ab 0.50 ab/ab } New combinations 2. Complete linkage AB/ab X ab/ab Parental genotypes 0.50 AB 0.50 ab No new combinations 3. Incomplete linkage AB/ab X ab/ab Parental genotypes 0.4 AB 0.1 Ab 0.1 aB 0.4 ab } 0.4 ab 0.1 ab RX 0.1 ab 0.4 ab } R 0.4 AB/ab 0.1 Ab/ab 0.1 aB/ab 0.4 ab/ab } New genetic recombinations Review of genetic linkage Linkage occurs when two genes are near each other on the same chromosome. Their ‘linkage distance’ can be determined by seeing how frequently they segregate together. Consider two linked genes in a heterozygous individual: A B a b The gametes from this individual will be AB or ab unless a crossover occurred between them during meiosis. A B a X b Crossovers produce Ab and aB gametes. The % of these recombinant gametes is essentially the linkage distance. For example, 40 AB, 40 ab, 10 aB and 10 Ab progeny gametes would be 20 % recombination or roughly 20 map units. Crosses for estimating map distances The main thing that complicates linkage analysis, is that the progeny from many types of crosses, can not be definitely classified as being from recombinant gametes! Especially, in when gametes from both parents are segregating. Analysis is simple when crossing haploids, Parents Transient diploid AB x ab AB ab Progeny AB ab Ab aB or when only the gametes of one diploid parent are segregating; Parents AB ab Progeny X ab ab AB ab ab ab Ab ab aB ab In more complicated crosses, or if analyzing many genes, you might use a computer program to calculate linkage. Visualization of Restriction Fragment Length Polymorphism (RFLP) Probe Same chromosome segment A B in 4 different genotypes DNA is cut with EcoRI and Run on Gel A B C D C D E E E E E E E E E E A B C D _ DNA in gel is made singlestranded, Transferred to a membrane, and probed with s.s 32P-labeled probe. Membrane (blot) is exposed to X-ray film to see polymorphic bands + E RFLPs, continued……. RFLPs were the first type of DNA ‘marker’. ‘Loci’ (places on chromosomes) are sometimes called markers because they may not represent actual genes, but represent a locus, just like a gene does. R M1 R is your favorite gene. Like all genes it maps to a specific chromosomal position. Marker 1 is an RFLP marker. The probe used to identify the bands on the gel-blot is a DNA sequence (maybe a gene) that occurs at this position and no where else. Marker 1 is linked to R. Calculate a map distance between a dominant disease resistance gene ‘R’ and a marker gene M Cross: R M X R M r m r m R M r m r m r m X 30 Progeny: R,M/r,m r,m/r,m R,M/r,m R,M/r,m r,M/r,m r,m/r,m R,m/r,m R,M/r,m r,m/r,m r,m/r,m What is your estimate of map distance? R,M/r,m R,M/r,m r,M/r,m r,m/r,m r,m/r,m r,m/r,m R,M/r,m r,m/r,m R,M/r,m R,M/r,m r,m/r,m R,M/r,m R,M/r,m R,M/r,m R,m/r,m R,M/r,m r,m/r,m R,M/r,m r,m/r,m R,m/r,m The same cross with Phenotypes given, instead of Genotypes. Parents S R F1 Progeny: F1 X susceptible parent M m S R R Phenotype S R S R S S R S S R S R S R R S R R S R R Molecular markers (M or m) (R = Resistant, S = Susceptible) What is your estimate of map distance? Positional cloning, continued……. If your marker is close enough to R, you might be able find a large clone (e.g. BAC) that contains both the gene and your marker sequences. R M1 Arabidopsis has an average of about 26,000 Kb on each chromosome (N=5), or about 13,000 Kb/chromosome arm. This is the equivalent of 108 BAC clones averaging 120 Kb each, laid end to end. Other plants and mammals generally have much larger chromosomes. Your marker has to be very close to your gene to be on the same clone! Positional cloning, continued……. If you are fortunate enough the marker is within range of a single BAC clone of your gene….Now how do you proceed? R M1 BACs R M1 R M1 1. Sequence the BAC 2. Use complementation to prove you have the gene 3. Mutagenize then compare mutants to normal gene …However, in most cases researchers are not that lucky. Positional cloning, continued……. If your marker is not within range of a single BAC clone of your gene, you may be able to arrange a series of overlapping BAC clones that will span the distance. R M1 R M1 BAC Contig A series of overlapping clones, contiguous with a segment of chromosome, is called a contig. Genetic recombinants are used to orient clones/contigs Example: Chromosome segment in parents for mapping population. Parent 1 Parent 2 M1 R M2 m1 r m2 Chromosome segments in sample of nonrecombinant progeny: 1 2 M1 R M2 m1 r m2 Selected progeny derived from crossovers between markers 1 and 2: 51 151 261 321 411 m1 R M2 m1 r M2 m1 R M2 M1 r m2 m1 r M2 Contig of cloned fragments, isolated using M1 and M2: M1 M3 M2 Genetic recombinants are used to orient clones/contigs, continued... Selected progeny derived from crossovers between markers 1 and 2: 51 151 261 321 411 m1 R M2 m1 r M2 m1 R M2 M1 r m2 m1 r M2 M3 Standard RFLP analysis using the recombinants Probe/ Allele M1 m1 P1 P2 (R) (r) 1 2 (R) (r) 51 151 261 321 411 (R) (r) (R) (r) (r) * m2 M2 M3 m3 Conclusion, M3 is closer * * * * Genome size effects feasibility of positional cloning Genome size Yeast Neurospora Drosophila Arabidopsis Rice Sorghum Tomato950 Human Maize Barley Physical (Mb) 15 50 150 130 430 750 1500 3400 2500 5000 Kb/cM* 3 30 300 130 330 400 Recombinational (cM) 5000 1000-1500 500 1000 2100 1800 650 3000 1800 1500 1000 1400 3000 *Kb/cM can be a very rough guide to how physically far a linked marker is from a gene If you printed the human genome in a 12 character/inch font, how far would it go? Arabidopsis Human Wheat How do you find your gene after you have it narrowed down to a specific cloned interval? •Complementation? (transform your clones into ‘mutant’ line to ‘complement’ the phenotype) •Sequencing the whole clone(s)? How do you verify that it is the gene you are looking for? •Complementation by transformation? •Analysis of multiple mutants? DNA FINGERPRINTING RFLP- Restriction Fragment Length Polymorphism PCR based fingerprinting AFLP- Amplified Fragment Length Polymorphism SSR- Simple-Sequence-Repeats (microsatellites) STR-short tandem repeats RAPD- random amplified polymorphic DNA SNP- single nucleotide polymorphisms } PCR: Amplifying DNA with a heat-stable polymerase Reaction mix: Template DNA, 4 nucleotides, primers, buffer, polymerase Step 1) Melt template DNA (~96o C) Step 2) Let primers anneal to template DNA by dropping temperature. 5’ 3’ 3’ 5’ Step 3) Extend new strands at ~68oC 5’ 3’ 5’ 3’ 5’ 3’ 3’ 5’ PCR: Amplifying DNA continued Step 4) Repeat melting, annealing and extension steps 5’ 3’ 3’ 5’ 5’ 3’ 3’ 5’ Step 4 - 30) Re-repeat melting, annealing and extension steps DNA between the primers is amplified many times. DNA polymerase reaction Denature Strand primers dNTPs polymerase synthesis DNA Polymerases: several different enzymes from different sources and with different properties (Taq polymerases, DNA polymerase I, Klenow) (optimum temp, heat stability, exonuclease activity) PCR- polymerase chain reaction Taq polymerase Thermus aquaticus Enzyme active at high temp (68º to 74º C) Heat stable Cycles molecules 1 2 2 4 3 8 30 1 X 109 DNA FINGERPRINTING RFLP- Restriction Fragment Length Polymorphism PCR based fingerprinting AFLP- Amplified Fragment Length Polymorphism SSR- Simple-Sequence-Repeats (microsatellites) STR-short tandem repeats RAPD- random amplified polymorphic DNA SNP- single nucleotide polymorphisms } How can polymorphism be observed using PCR? |||||||||||| Line A |||||||||||| Fragment size determined by distance between primer sites |||||||||||| Line B Deletion changing fragment size |||||||||||| | || || || Line C |||||||||||| Alteration in primer site A PCR amplify DNA from each line using the two specific primers, then run the products on a gel. B C AFLP analysis gives lots of bands on a single gel. (Amplified Fragment Length Polymorphism) 1) Cut DNA with EcoRI (6 bp recognition) and MseI (4 bp). E M 2) Ligate adaptors on to ends M E 3) PCR amplify with primers from adaptors. Too many fragments will amplify to resolve on a gel at this stage. M E 4) Perform additional PCR cycles with primers that have additional selective bases to reduce the number of fragments that amplify. The EcoRI primer that is 32P labeled. P E M 5) Run the reactions on a long polyacrylamide gel, and expose the gel to X ray film. Only the fragments with an EcoRI end will expose the film. AFLP analysis of two nearlyidentical rice lines with and without a disease resistance gene. Enlargement Gel by Brad Porter & Frank White Simple-Sequence-Repeats show frequent size polymorphism Individual A |||||||||||| ATATATATATATATATATATAT TATATATATATATATATATATA Individual B |||||||||||| ATATATATATATATATATATATATAT TATATATATATATATATATATATATA Individual C |||||||||||| |||||||||||| ATATATATATATATATATATATATATATATATATA TATATATATATATATATATATATATATATATATAT |||||||||||| |||||||||||| •If the primers sequences only occur once in the genome, these mark single loci. •Because of their frequent size polymorphism, and multiple alleles, these are very useful markers. Can be used in forensic science. •They are also called STR or ‘microsatellite’ markers. Simple Sequence Repeat (SSR)- a small segment of DNA, usually 2 to 5 bp in length that repeats itself a number of times. Useful SSRs usually repeat the core motif 9-30 times. Single Nucleotide Polymorphisms (SNPs): a single base variation between two otherwise identical DNA sequences. Random Amplification of Polymorphic DNA RAPD reactions are PCR reactions, but they amplify segments of DNA which are essentially unknown to the scientist (random) Standard PCR: RAPD detection cont.’ A B Cloning by Insertion Mutagenesis General strategy: 1) Construct a large population (1000’s) that has lots of insertion mutations from an active transposon or from transgene insertion 2) Find a individual that has the expected phenotype of a mutant of YFG 3) Use the cloned transgene/transposon as a probe to clone the mutated gene out of a library of clones made from the mutant 4) Use the cloned mutant gene to isolate the wild-type gene from a library of a non-mutant individual Example, a resistance gene cloning project Resistance gene Transposon Resistant Parent Find susceptible mutant Make and screen library Cloning by Insertion mutagenesis, Requirements: •Easy to score, reliable phenotype, preferably meiotically stable. •Efficient insertion mutagenesis agent, like; Highly active, cloned T.E. system (native or introduced) OR Highly efficient transformation system, preferably a species with a high gene density (e.g. fungi, Arabidopsis, rice). Low gene density, e.g. maize, wheat High gene density, e.g. Arabidopsis Cloning by Complementation Strain 1: Carries gene Make library of big clones Genomic fragments Strain 2: Doesn’t carry gene, or carries mutant form. Gene Vector •Transform strain 2 with whole strain 1 library. •Isolate transformed individuals, each carrying a different cosmid. •Test each individual for phenotype expected for the gene. •Individual expressing phenotype should have the gene on its cosmid. Problems: Need very efficient transformation Genomes size is a limitation O.K. for bacteria, 5000 kb genome = ~150 Cosmids Yeast, 15,000 kb = ~450 Cosmids Cloning by Homology Methods: 1) Probe library with heterologous gene (e.g. from another species). • Usually have to alter hybridization conditions (reduce stringency). • Homology is related to genetic distance and gene conservation. • Within taxonomic family usually works. • If stringency conditions are too low, hybridization could be bogus. Perfect homology ACTCTAGTACTGATCGTCTGATCTA ||||||||||||||||||||||||| TGAGATCATGACTAGCAGACTAGAT Less homologous ACTCTAGTACTGATCGTCTGATCTA |||| ||| |||| |||||| ||| TGAGCTCAAGACTGACAGACTCGAT 2) Identify the most highly conserved sequences in the gene by comparing versions of the gene from other species. Then design PCR primers and try to amplify the gene from your species. Cloning strategies based on gene expression patterns. •The content of cDNA libraries vary with tissue, developmental stage or environmental conditions. •Some genes may be very abundant in some libraries, e.g. seed storage proteins in endosperm libraries. •Others libraries may have gene in lower abundance, but they are specific to that library. Its possible to find the specific genes by ‘subtracting’ the sequences present in other tissues. E.g. A library from pathogen-infected tissue with the sequences from uninfected tissue subtracted out. •Expression patterns of a gene may make it a ‘candidate’ for genes controlling a phenotype.