Download DNA, RNA and Proteins

Ms. Hughes




Mendel showed that traits are passed from
parent to offspring.
Instructions for how genes are inherited.
Genes are made up of segments of DNA:
Deoxyribonucleic acid.
DNA is the primary material that causes
recognizable, inheritable characteristics in
related groups of organisms.

DNA is composed of four nucleotide
subunits:
◦ Each nucleotide has the same five carbon sugar
molecule and phosphate group but different
nitrogenous bases:




Adenine
Guanine
Cytosine
Thymine




Winding stair case – 1
Parts of the nucleotide subunits – 2
1’s find another 1 and compare notes!
2’s find another 2 and compare notes!




If you are a 1 find a 2
If you are a 2 find a 1
Share your information but DO NOT COPY!!!
You must explain it to your partner!!!



Pyrimidines: Thymine and Cytosine
Purines: Adenine and Guanine
DNA is in the shape of a spiral stair case/
double helix of two complementary strands
of nucleotides.

A always binds with T
G always binds with C

So A=T and G=C



Purine always binds to pyrimidine
Watson, Franklin and Crick discovered 3D
model .

A=T
G=C

Base pair rule



Read and summarize watson and cricks
model of DNA.
K,W,L
◦ Knew
◦ Would like to learn more about
◦ Learned

Draw, label and explain a strand of DNA
including the nucleotide subunits, base
pairing and complimentarity of the strands.


DNA replication: the process of making a
copy of DNA.
In DNA replication, the DNA molecule
unwinds, and the two sides split. Then new
nucleotides are added to each side until two
identical sequences result. DNA replication
occurs before a cell divides so that each cell
has a complete copy of DNA. The basic steps
of DNA are:


DNA replication McGraw Hill
http://highered.mcgrawhill.com/olcweb/cgi/pluginpop.cgi?it=swf::53
5::535::/sites/dl/free/0072437316/120076/
micro04.swf::DNA%20Replication%20Fork


The double helix unwinds.
Complementary strands of DNA separate
from each other and form Y shapes areas are
called replication forks.


At the replication fork, new nucleotides are
added to each side and new base pairs are
formed according to the base pairing rules.
The original two strands serve as a template
for two new strands.

DNA replication produces two identical DNA
molecules

During the replication of DNA, many proteins
form a machinelike complex of moving parts.


DNA helicases unwind the DNA double helix
during DNA replication.
This process causes the helix to unwind and
forms a replication fork.



Proteins called DNA polymerases catalyze the
formation of the DNA molecule.
The polymerases add nucleotides that pair
with each base to form two new double
helixes.
DNA polymerases also have a “proofreading”
function. During DNA replication, errors
sometimes occur, and the wrong nucleotide
is added to the new strand. DNA polymerase
cannot add another nucleotide unless the
previous nucleotide is correctly paired.

In prokaryotic cells, replication starts at a
single site. In eukaryotic cells, replication
starts at many sites along the chromosome.

Prokaryotic cells usually have a single DNA
molecule, or chromosomes. Prokaryotic
chromosomes are a closed loop, may contain
protein, and are attached to the inner cell
membrane.


While prokaryotes have a single chromosome,
eukaryotic cells often have several
chromosomes.
By starting DNA replication at many sites
along the chromosome, eukaryotic cells can
replicate their DNA faster than prokaryotes
can, two distinct replication forks form at
each start site, and replication occurs in
oppisite directions.

Eukaryotic
vs.
Prokaryotic

Create a comic strip explaining DNA
replication of a eukaryotic organism using all
proteins and correct terminology.



Proteins perform most of the functions of
cells. DNA provides the original “recipe”.
RNA: ribonucleic acid allows genetic
information to be taken from DNA and
proteins be made.
Gene expression: the manifestation of genes
into specific traits.


The first stage of gene expression.
RNA is making proteins from the information
found in DNA.


Second stage of gene expression.
Information form RNA is used to make
specific proteins.


In cells three types of RNA complement DNA
and translate the genetic code into proteins.
RNA vs. DNA
◦ Both have four bases and carry genetic information.
◦ RNA is composed of one strand of nucleotides and
DNA is composed of two strands of nucleotides.
◦ RNA substitutes Uracil for Thymine.





1 – messenger RNA
2 – transfer RNA
3 – ribosomal RNA
1 share with other 1’s
Then 1, 2, 3



Messenger RNA: carries instructions for a
gene to the site of translation.
Transfer RNA: reads the messenger mRNA
sequence.
Ribosomal RNA: found in ribosomes,
transports proteins from the ER as they are
produced.





During transcription , the information in a
specific region of DNA is transcribed, or copied
into RNA.
Step 1: RNA polymerase binds to the promoter ( a
specific DNA sequence/start location).
Step 2: RNA polymerase unwinds the dbl helix to
expose both paired nucleotide bases.
Step 3: RNA polymerase links and binds
complementary base units to each strand of DNA.
The result once the stop codon is reached is one
strand of mRNA is produced.



Both use DNA as a template.
Transcription – mRNA is made, using portions
of each strand of DNA
Translation – DNA is made, using both entire
strands of DNA.

Transcribe and then translate this sequence:

ATCGGCGGGATTTATTCCCG

Transcribe and then translate this sequence:

ATCGGCGGGATTTATTCCCG

Create a comic strip for the steps of
transcription and translation of a eukaryotic
organism.



Each 3 nucleotide sequence is called a codon.
Each codon unit codes for a specific amino
acid.
Turn to page 307 and look at the amino acids
that are possible there are 20.

Translation occurs in a sequence of steps,
involves three kinds of RNA and results in a
complete polypeptide.


The relationship of gene expression is
complex.
Despite the neatness of the genetic code,
every gene cannot be simply linked to a
single outcome.

Transcribe and then translate this sequence:

ATCGGCGGGATTTATTCCCG

Now use the codon chart to determine which
amino acids this codes for.