Download Document

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Neocentromere wikipedia , lookup

Non-coding RNA wikipedia , lookup

Comparative genomic hybridization wikipedia , lookup

Polyploid wikipedia , lookup

SNP genotyping wikipedia , lookup

Mitochondrial DNA wikipedia , lookup

Genome evolution wikipedia , lookup

History of RNA biology wikipedia , lookup

X-inactivation wikipedia , lookup

RNA-Seq wikipedia , lookup

Frameshift mutation wikipedia , lookup

Expanded genetic code wikipedia , lookup

Human genome wikipedia , lookup

Epigenetics of human development wikipedia , lookup

Bisulfite sequencing wikipedia , lookup

Mutagen wikipedia , lookup

DNA polymerase wikipedia , lookup

Genomic library wikipedia , lookup

Cancer epigenetics wikipedia , lookup

Mutation wikipedia , lookup

No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup

Site-specific recombinase technology wikipedia , lookup

Nutriepigenomics wikipedia , lookup

Genome (book) wikipedia , lookup

DNA damage theory of aging wikipedia , lookup

United Kingdom National DNA Database wikipedia , lookup

Gel electrophoresis of nucleic acids wikipedia , lookup

Nucleosome wikipedia , lookup

DNA vaccination wikipedia , lookup

Genealogical DNA test wikipedia , lookup

Genetic engineering wikipedia , lookup

Epigenomics wikipedia , lookup

Genome editing wikipedia , lookup

Molecular cloning wikipedia , lookup

Microsatellite wikipedia , lookup

Designer baby wikipedia , lookup

Replisome wikipedia , lookup

Genomics wikipedia , lookup

Chromosome wikipedia , lookup

Cell-free fetal DNA wikipedia , lookup

Genetic code wikipedia , lookup

Cre-Lox recombination wikipedia , lookup

Gene wikipedia , lookup

Vectors in gene therapy wikipedia , lookup

Nucleic acid double helix wikipedia , lookup

Non-coding DNA wikipedia , lookup

DNA supercoil wikipedia , lookup

Primary transcript wikipedia , lookup

Extrachromosomal DNA wikipedia , lookup

Therapeutic gene modulation wikipedia , lookup

Point mutation wikipedia , lookup

Helitron (biology) wikipedia , lookup

Nucleic acid analogue wikipedia , lookup

Microevolution wikipedia , lookup

Deoxyribozyme wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

History of genetic engineering wikipedia , lookup

Transcript
Chapter 12
Genetic facts in 1900:
• Both female and male organisms have
identical chromosomes except for one pair.
• Genes are located on chromosomes
• All organisms have two types of
chromosomes:
• Sex chromosomes
• Autosomes
Male vs Female
• MALE
• Usually the Y
• FEMALE
• Usually the X
chromosome.
• Y is usually smaller
• Male genotype = XY
chromosome.
• Larger than the Y
• Female genotype XX
Except Birds
Male = XX
Female = XY
Frederick Griffith
• British bacteriologist
• 1928 = designed and performed experiment
on rats and bacteria that causes pneumonia.
• 2 strains of the bacteria
• Type S = causes severe pneumonia
• Type R = relatively harmless
Griffith’s Rats
1. First he injected living Type S bacteria into
rats:
• Second he injected dead Type S into the rats.
• Next he injected living type R bacteria
• Finally he injected a mixture of living Type
R and dead Type S :
Results of experiments:
• Because the dead rat tissue showed living
Type S bacteria, something “brought the
Type S back to life”
• Actually one bacterial type incorporated the
DNA, or instructions, from the dead
bacteria into its own DNA
• Known as transformation. Confirmed by
Avery, MacLeod, and McCarty in 1944
Oswald Avery
• Canadian
biologist (18771955)
• Discovered
DNA in 1944
with a team of
scientists.
Hershey and Chase
• 1952
• Attempted to solve
the debate on
whether DNA or
proteins are
responsible for
providing the
genetic material.
• They used a
bacteriophage (a
virus which
attacks bacteria)
to prove that
DNA was
definitely the
genetic material.
Phoebus A. Levene
• Russian born; immigrated to America,
•
1.
2.
3.
moves to Europe.
1920’s discovered nucleotides
(building blocks of DNA)
Sugar
Phosphate group
Nitrogenous base
Composition of DNA
Components and structure of
DNA
• A very long molecule. 4 nitrogenous bases:
Chargaff’s rules
• The relative amounts of adenine and
thymine are the same in DNA
• The relative amounts of cytosine and
guanine are the same.
• Named after Erwin Chargaff
Rosalind Franklin
• Used X-Ray
diffraction to get
information about the
structure of DNA:
Structure of DNA
• Discovered in 1953
by two scientists:
• James Watson
(USA)
• Francis Crick
(GBR)
• Known as the
double-helix model.
The double-helix
• A twisted ladder with two long chains of
alternating phosphates and sugars. The
nitrogenous bases act as the “rungs” joining
the two strands.
How long is the DNA molecule?
Chromosomes & DNA
replication
• The nucleus of one human cell contains
approximately 1 meter of DNA.
• Histones = DNA tightly wrapped around a
protein
• Nucleosome:
Chromosome structure:
DNA replication
• Must occur
before a cell
divides.
• Each new cell
needs a copy of
the information
in order to grow.
DNA replication. Why needed?
• Before DNA strand
can be replicated or
copied it must be
“unzipped”
• DNA polymerase
(enzyme that unzips)
• Starts at many
different points. Why?
Completing the replication
• After the DNA
molecule comes
apart, bases of
free nucleotides
in the nucleus
join their
complimentary
bases.
RNA
• Very similar to DNA.
• Exceptions:
1) Ribose is the 5-carbon sugar
2) Uracil replaces thymine
3) Single-stranded
mRNA (messenger)
• Copies genetic
code of DNA by
matching bases.
• Occurs in the
nucleus.
• DNA changing to
RNA
TRANSCRIPTION
• DNA is copied into mRNA with
the aid of RNA polymerase.
• The RNA polymerase will bind to
promoters that act as signals in the
DNA sequence to make RNA.
Transcription continued:
Exons and Introns
• EXONS
• A segment of DNA in
• INTRONS
• A segment of DNA
eukaryotic organisms
that codes for a
specific amino acid
that does NOT code
for an amino acid.
Confusing genetic terms:
• Polypeptide = a chain of amino acids.
• Protein = a complex structure composed of
polypeptides
• Amino acids = smallest structural unit of a
polypeptide.
• Gene = a distinct unit of material found on a
chromosome
Reading the genetic code
• The genetic code is responsible for
building all the proteins in the body
using 20 different amino acids.
• How many 3 letter words can you
make from the letters A,T,G and C?
• Answer: 64
Codons
• A three letter “word” that specifies
an amino acid.
Genetic code:
tRNA (transfer)
• approx. 80 nucleotides
•
•
•
•
in length.
Cross-like shape
At one end an amino
acid is attached
At the other end there
is an anticodon
Acts like a truck
Polypeptide assembly
• Translation = reading
or “translating” the
RNA code to form a
chain of amino acids.
• Known as protein
synthesis
• Occurs in the
cytoplasm. (p.304)
Mutations
• The source of variation in a genetic
sequence.
• Can be either gene or chromosomal
mutations.
• Point mutations = a change in a single
nucleotide in a sequence of DNA.
Frameshift Mutation
• Inserting an extra nucleotide which, in turn,
shifts the entire sequence one way or the
other.
Chromosomal mutations
• Involves a change in the number or
structure of the chromosomes.
• Deletion : when a piece of a chromosome
breaks off and is lost.
• Duplication : when a segment of a
chromosome is repeated
• Inversion : when a segment of a
chromosome is reversed.
More chromosomal mutations
• Translocation :
when part of a
chromosome
breaks off and is
attached to a nonhomologous
chromosome.
Control of gene expression
• Genes are often like light switches
that can be turned off and on.
• Operon = occur in prokaryotes.
(bacteria) different genes that work
together to activate gene functions
Eukaryotic gene expression
• Controlled by
complex
sequences of
DNA.
• Example:
“TATA box”
Factors:
• Overall gene control is more difficult
for eukaryotes because functional
genes may be on different
chromosomes.
• Environmental such as chemicals and
temperature.
Hox and Oncogenes
• Hox genes
• Genes that
actively control
embryonic
development.
• Oncogenes
• Genes known to
cause cancer.
• Usually these are
switched “off”, but
can be switched
“on” by a number
of factors.
Assignment:
• Pages 315-116
• 1-10, 13, 15, 19, 20, 23
• Transcribe this DNA sequence into RNA,
then translate the RNA into an amino acid
chain: TAGCCGACAGGCCTCTTTACT
• 1-12 page 317