* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download When to use reverse genetics?
Epigenetics of neurodegenerative diseases wikipedia , lookup
Biology and consumer behaviour wikipedia , lookup
Genomic library wikipedia , lookup
Population genetics wikipedia , lookup
Saethre–Chotzen syndrome wikipedia , lookup
Genomic imprinting wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Frameshift mutation wikipedia , lookup
Public health genomics wikipedia , lookup
Pathogenomics wikipedia , lookup
Genetically modified crops wikipedia , lookup
Human genome wikipedia , lookup
Gene therapy wikipedia , lookup
Gene nomenclature wikipedia , lookup
Gene desert wikipedia , lookup
Gene expression programming wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Primary transcript wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Oncogenomics wikipedia , lookup
Minimal genome wikipedia , lookup
Non-coding DNA wikipedia , lookup
Medical genetics wikipedia , lookup
Epigenetics of human development wikipedia , lookup
RNA interference wikipedia , lookup
Transposable element wikipedia , lookup
RNA silencing wikipedia , lookup
Gene expression profiling wikipedia , lookup
Genome (book) wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Genetic engineering wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Point mutation wikipedia , lookup
Genome evolution wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Designer baby wikipedia , lookup
Helitron (biology) wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Microevolution wikipedia , lookup
Methods for Reverse genetics References: 1. Alonso JM, Ecker JR. Moving forward in reverse: genetic technologies to enable genomewide phenomic screens in Arabidopsis. Nat Rev Genet. 2006 Jul;7(7):524-36. 2. Waterhouse and Helliwell. Exploring plant genomes by RNA-induced gene silencing. Nat Rev Genet. 2003 4(1): 29-38 3. Krysan, Young, and Sussman. T-DNA as an insertional mutagen in Arabidopsis. Plant Cell 1999 11(12): 2283-90 4. Li et al. 2001. A fast neutron deletion mutagenesis-based reverse genetics system for plants. Plant Journal 27(3): 235-42 5. Till et al. 2003. Large-scale discovery of induced point mutations with high-throughput TILLING. Genome Research 13(3): 524-30 6. Heidi Scholze and Jens Boch, 2011. TAL effectors are remote controls for gene activation. Current Opinion in Microbiology. Volume 14, Issue 1, February 2011, 47–53 7. Shan et al. 2013. Targeted genome modification of crop plants using a CRISPR-Cas system. Nat Biotechnol. 31(8):686-8. 8. Doudna and Charpentier E. 2014. The new frontier of genome engineering with CRISPRCas9. Science. 346(6213):1258096-1. Genetic analysis It’s all about mutants and their phenotypes! Forward genetics • From mutant phenotype to gene, from gene to protein function Reverse genetics • From gene to mutant phenotype, to function Reverse genetics What kinds of manipulation do we usually do to our favorite gene (FG) ? Knockout analysis: 1. Find/Generate a knockout mutant in FG 2. Analyze the mutant to see if there is any defects 3. Connect the defects with biological processes Reverse genetics Overexpression analysis/ectopic expression 1. Overexpress FG (endogenous promoter) Ectopic expression (CaMV 35S promoter) 2. Analyze the overexpresser to see if there are any defects/phenotypes 3. Connect the defects with biological processes Over-expression of a gene of interest does not necessarily lead to a gain-of-function effect. Why? Story on DAYSLEEPER Background: DAYSLEEPER was found to bind to the promoter region of Ku70, which encodes a protein involved in DNA repair. DAYSLEEPER 25 bp Kubox motif DAYSLEEPER encodes a hAT-like transposase hAT-like transposon elements ● In Arabidopsis, there are 246 hAT-like elements. ● Active hAT transposons: 8bp duplication of the insertion site and short terminal inverted repeats (TIR). ● Fossil elements lack the duplication of the insertion site and TIR, and often are transcriptionally silent. ● Daysleeper is a fossil element, but is expressed. Q: DNA repair -----????----- Transposon How do you find out the function of DAYSLEEPER? Q: What would a mutant of a fossil transposable element look like? DAYSLEEPER knockout mutant T-DNA Q: How would you prove that the mutant phenotype is caused by the mutation in DAYSLEEPER? -co-segregation -transgene complementation -obtaining second allele DAYSLEEPER over-expressers Slower growth, delayed flowering, altered leaves, etc. DAYSLEEPER is essential for plant development. Fossil elements are not always fossils, they have the potential to evolve functions essential for plant growth and development. Bundock P, Hooykaas P. An Arabidopsis hAT-like transposase is essential for plant development. Nature. 2005 Jul 14;436(7048):282-4. Why do we need reverse genetics? (When to use reverse genetics?) Why cannot forward genetics find mutants in all the genes? Somerville C and Somerville, S. 1999. Plant Functional Genomics. Science 285(5426): 380-383. Why cannot forward genetics find mutants carrying mutations in all genes? 1. Redundancy 2. Lethal mutations 3. Subtle or not obvious phenotypes 4. Mutant missed from forward genetic screens Why do we need reverse genetics? (When to use reverse genetics?) 1. Figure out function of YFG 2. Redundant genes 3. Essential genes 4. Assist forward genetics: second allele Why do we still do forward genetics? - Process more specific, it is less predictable in reverse genetics - No previous knowledge needed for forward genetics - Suppressor or enhancer screens that may lead to new biology With complete genome sequence information, we can pick and study our favorite genes by reverse genetics. How do we knockout genes in plants? Homologous recombination Not for plants! Reverse genetics: Gene Knockout Strategies 1. RNAi-based silencing 2. T-DNA or transposon based insertional mutagenesis 3. Deleteagene 4. TILLING 5. TAL effector-mediated DNA modifications 6. CRISPR-CAS9-based gene editing RNAi based methods History: Early 1990’s, phenomena first found by plant scientists: cosuppression 1998, in C.elegans, formally discover dsRNA as signal for RNA interference (Fire and Mello) 1999, small RNA species derived from mRNA detected (Baulcomb) 2001, discovery of dsRNA processing enzyme Dicer 2006, A. Fire and C. Mello won Nobel prize in medicine because of their discovery of dsRNA as mediator of RNAi RNAi: an ancient immune response against invasion of viruses and other genetic materials RISC: RNA-induced silencing complex dsRNA-directed gene silencing mechanisms. Short dsRNA molecules can either be expressed by endogenous genes, invading viruses or by experimental means and are funnelled into one of two different silencing mechanisms. siRNAs that are perfectly complementary to their cognate mRNA species induce their endonucleolytic cleavage and degradation. Amplification of the RNAi signal by RDRP-dependent mechanisms, RNA-induced epigenetic control of gene expression as well as RNAi transfer between cells have been observed in some but not all species. Hairpin RNA-induced gene silencing A typical T-DNA plasmid for the expression of hairpin RNAs (hpRNAs). A generic silencing precursor construct (pHANNIBAL) that enables hpRNA vectors to be easily constructed has different multiple cloning sites either side of the intron to enable the rapid insertion of target sequences in forward and reverse orientations. 35S, CaMV 35S promoter; Term, transcription termination sequence. Silencing of the phytoene desaturase gene in Arabidopsis by hairpin RNA PDS PDS Figure 5 | Degrees of silencing produced by hairpin-RNA-encoding transgenes. The stable transformation of Arabidopsis plants with the same hairpin RNA (hpRNA) construct that is targeted against phytoene desaturase gives rise to lines that show a heritable photobleaching phenotype in: a | all tissues; b | sectors of tissue; or c | the cotyledons, but not the rest of the plant. Images courtesy of C.A.H. and P.M.W., CSIRO, Australia. Reproduced with permission from Ref. 63 © (2002) CSIRO Publishing. Virus-induced gene silencing (VIGS) The tobacco rattle virus (TRV) virus-induced gene-silencing (VIGS) system. Two T-DNA plasmids that encode the TRV genome (one encoding TRV RNA1 and the other encoding TRV RNA2, which carries the inserted target sequence) are propagated separately in Agrobacterium and used to co-infect plant tissue. 35S, CaMV 35S promoter; CP, coat protein; M1,2,3, movement proteins 1, 2, 3; RdRP, RNA-dependent RNA polymerase; Term, transcription termination sequence. Silencing of the phytoene desaturase gene in tobacco by TEV-based VIGS PDS Liu, et al. 2002. Plant Journal, 30: 415–429. transient- vs. stable-integrated gene-silencing Advantages Viral-induced Gene silencing (VIGS) Hairpin transgenes ● Rapid ● easy to use ● applicable to mature plants ● useful for species hard to generate transgenic plants ● Not restricted by host range ● controllable tissue specificity ● range of degrees of silencing Disadvantages ● Host range limitations ● restricted regions of silencing ● viral symptoms superimposed on silencing phenotype ● Require Transformation Reverse genetics: Gene Knockout Strategies 1. RNAi-based 2. T-DNA or transposon based insertional mutagenesis 3. Deleteagene 4. TILLING 5. TAL effector-mediated DNA modifications (TALENS) 6. CRISPR-CAS9-based gene editing Agrobacterium Ti plasmid-based transformation T-DNA Gene A How do we test whether a plant has a T-DNA in Gene A? How do you find a T-DNA insertion mutant in a population of 60,480 transgenic plants? Pool 9 into one Pool 25 into one Pool 9 into one LB 5’ RB 3’ Arabidopsis 2010 Project A research program proposed in 2000 to determine the function of every gene in Arabidopsis by 2010 Somerville C and Somerville, S. 1999. Plant Functional Genomics. Science 285(5426): 380-383. Indexed T-DNA knockout lines - Built using end-rescue and sequencing of individual T-DNA line in the population. T-DNA Gene A Ends of ~ 300,000 T-DNA lines have been sequenced. - Major sources: SALK Institute (SALK lines, USA) Syngenta Inc. (SAIL lines, USA) Wisc lines (UW, Madison lines, USA) FLAG lines (French) GABI lines (German) SK lines (Canadian) Indexed T-DNA knockout lines Search engine T-DNA Express http://signal.salk.edu/cgi-bin/tdnaexpress Forward genetics in a reverse way Alonso JM, Ecker JR. Moving forward in reverse: genetic technologies to enable genome-wide phenomic screens in Arabidopsis. Nat Rev Genet. 2006 Jul;7(7):524-36. In Arabidopsis, about 300,000 T-DNA lines have been sequenced. T-DNA insertions are still not found in some genes. Why? Bigger genes have better chance being knocked out by T-DNA. Reverse genetics: Gene Knockout Strategies 1. RNAi-based 2. T-DNA or transposon based insertional mutagenesis 3. Deleteagene: useful for small genes and tandem repeats DeleteageneTM Fast Neutron Deletion Mutagenesis-based Reverse Genetics Approach for Plants Fast neutron bombardment -random deletions screen libraries of mutants find target gene deletions to OR 5 kb GA1 Locus WT 6.4 kb ga1-3 1.4 kb Can we detect the presence of ga1-3 in a population of 1,000 plants by one PCR reaction? Deletion screen reconstruction GA1 Locus Wild type (6.4 kb) WT 6.4 kb ga1-3 band (1.4 Kb) ga1-3 1.4 kb 5 kb Deletion Deletion library construction Treat wild type seeds with fast neutron Plant M1 seeds and grow up population Collect M2 seeds from individual plants Plant some seeds from each line Collect tissue and extract DNA DeleteageneTM Fast Neutron Deletion Mutagenesis-based Reverse Genetics Approach for Plants Arabidopsis mutant screen 20 mega pools (2592 lines per pool) WT Deletion 9 super pools (288 lines per pool) WT Deletion 8 pools (36 lines per pool) WT Deletion 2 sub pools (18 lines per pool) WT Deletion Individual lines WT Deletion ARABIDOPSIS MYB19 SUPERPOOL ANALYSIS MEGAPOOL ANALYSIS WT WT Mutant POOL ANALYSIS PLANT ANALYSIS 1.7 kb Deletion Mutant WT WT Mutant Mutant ARABIDOPSIS MYB19 AtMyb19 Deletion Analysis WT 39371 gcattcttta attcaattg - - - aacaacaaca tgatcatgaa 41090 Mut 39371 gcattctt/ /a tgatcatgaa 41090 WT 3.0 kb mutant 1.3 kb DELETION vs. OTHERS Deletional Knockout Insertional Knockout RNAi Knockout Applicability in Crop Species Wide Limited Limited Cost & Time Inexpensive & Fast Slow & Expensive Slow & Expensive Gene Specificity Gene-/Tandem Gene-Specific GeneSpecific Family Tissue Specificity None Limited Possible Penetrance High High Unreliable In Arabidopsis, Deleteagene is especially useful for knocking out small genes and tandem repeats. TILLING: Targeting Induced Local Lesions In Genomes Detection of point mutations in target genes within mutagenized or natural populations of plants by heteroduplex analysis Developed by: Steve Henikoff., Fred Hutchinson Cancer Inst. Luca Comai, University. of Washington Arabidopsis EMS Mutagenesis • Mutation frequency can be as high as • • • 500 mutations/genome or 1 mutation/1000 bp/ 300 plants 5% truncations, 50% missense, 45% silent How do we determine whether there is a mutation in our gene of interest in a plant? How do we determine whether there is a mutation in our gene of interest in 3,000 plants? CEL I is a single-stranded DNA endonuclease with a high specificity for mismatches 3’ 5’ 5’ 3’ CEL1 Cleavage 3’ 5’ 5’ 3’ 3’ 5’ 5’ 3’ Denature 3’ 5’ 5’ 3’ 5’ 5’ Arabidopsis EMS Mutagenesis Greene, et al., 2003, Genetics 164: 731-740 PCR Amplification of Target Gene from Pooled Genomic DNA 3’ 5’ 5’ 3’ 5’ 3’ 3’ 5’ PCR 3’ 5’ 5’ 3’ 5’ 3’ heat (denature) re-nature 3’ 5’ 3’ 5’ 5’ 3’ 5’ 3’ 3’ 5’ 3’ 5’ 5’ 3’ CEL1 Cleavage 3’ 5’ 5’ 3’ 3’ 5’ 5’ 3’ Denature 3’ 5’ 5’ 3’ 5’ 5’ Resolve on Li-Cor Gel LI-COR Scanning Results: 1.0kb 0.8kb 0.2 kb IR DYE 700 IR DYE 800 A TILLING gel image www.licor.com Colbert et al.2001, Plant Physiol. 126:480-84 Advantages of TILLING as an Approach for Reverse Genetics • Mutagenized plants have a large number of randomly distributed mutations per plant genome. • No transgenic manipulations required. • Both nonsense (knockout) and mis-sense mutations can be recovered. • Plants heterozygous for a mutation can be detected (lethality not a problem). Question If you are given $5,000,000 of funding today to provide mutants with point mutations to the Arabidopsis research community, how would you do it? Reverse genetics: Gene Knockout Strategies 1. RNAi-based 2. T-DNA or transposon based insertional mutagenesis 3. Deleteagene 4. TILLING 5. TAL effector-mediated DNA modifications (TALENS) 6. CRISPR-CAS9-based gene editing TAL effectors are remote controls for gene activation Heidi Scholze and Jens Boch Current Opinion in Microbiology Volume 14, Issue 1, February 2011, Pages 47–53 Dr. Ulla Bonas Institute of Biology, Dept. of Genetics Martin- Luther- University Halle- Wittenberg Xanthomonas campestris pv. vesicatoria (Xcv) Bacterial spot of tomato and pepper Pepper Resistance gene BS3 confers strong resistance against Xcv Image: http://www.monsanto.com Xcv Type III secretion system (T3SS) secretes effectors to disturb host immunity The transcription factor activity of AvrBs3 elicits different responses in resistant and susceptible plants.AvrBs3 is delivered into host cells via the Xanthomonas type III secretion system (T3SS). In susceptible pepper plants (left, green background), AvrBs3 binds the upa box and activates transcription of upa20, which encodes a basic helix–loop–helix transcription factor. Upa20 then activates transcription of genes like upa7, which together give rise to cellular hypertrophy. In resistant pepper plants (right, yellow background) AvrBs3 binds the Bs3 upa box and activates Bs3 transcription. Bs3 initiates a cell death response either through recognition by a guard protein or by modification of an unidentified interacting protein. UPA20: cell size regulator; Hypertrophy: increase in cell size AvrBs3: a Transcription activator-like effector (TALE) Can we apply what we have learned from AvrBS3 to design DNA-binding proteins for a target DNA sequence? DNA LTPEQVVAIASNIGGKQALETVQRLLPVLCQAHG A LTPEQVVAIASNGGGKQALETVQRLLPVLCQAHG T LTPEQVVAIASHDGGKQALETVQRLLPVLCQAHG C LTPEQVVAIASNKGGKQALETVQRLLPVLCQAHG G LTPEQVVAIASNNGGKQALETVQRLLPVLCQAHG A/G TAL Nucleases (TALENs): artificial restriction enzymes Cleave DNA only as dimers TAL nucleases (TALNs) promote genome editing. (a) TALNs are fusions between TAL effectors and the FokI endonuclease domain. A tailored TAL repeat domain controls DNA-binding specificity. (b) Two TALNs bind neighboring DNA boxes and FokI dimerization induces DNA cleavage in the spacer region between the boxes. DNA double-strand breaks can promote nonhomologous end-joining (NHEJ) or homologous DNA recombination (HDR) enabling targeted genome modifications like deletions or insertions. TAL Nucleases (TALENs)-based genome editing Advantages and disadvantages of using TALENs for Reverse Genetics Advantages: • Targeted editing of a gene of interest • Potentially applicable to many different species. Disadvantage: • Constructs encoding TALENs are complex and hard to make. Genome Editing Using the CRISPR-Cas9 System CRISPR: clustered regularly interspaced short palindromic repeats Cas: CRISPR-associated (cas) genes Bacterial Immune System Cas9 (CRISPR associated protein 9) Cas9 encodes a DNA endonuclease that associates with crRNA (also called guide RNA). Cas9 unwinds foreign DNA to check if it is complementary to the 20 base pair spacer region of the guide RNA. Cas9 cleaves the invading DNA if the DNA substrate is complementary to guide RNA. Can we apply the CRISPR-Cas9 system to modify target genes in plants? How? CRISPR-Cas9: a RNA-guided platform to cut at specified locations in the genome 1. Design Short guide RNAs with homology to target loci 2. Guide RNA + Cas9 are expressed in the cell 3. The Cas9 cleavage site is repaired by either NHEJ or HDR in tandem with a donor 4. High efficiencies of knockout or knock-in Guide RNA: crRNA + tracrRNA (trans-activating RNA ) PAM: protospacer adjacent motif, NGG gRNA target sequence PAM AGCTGGGATCAACTATAGCG NGG 9 out of 96 T1 transgenic plants contain mutations in the rice phytoene desaturase gene Cleavage site (1) Wild type rice plant (2) Monoallelic mutant (3) Biallelic mutant (4) Biallelic mutant BbsI BbsI LB RB pAtU6 Target seq sgRNA scaffold pAtUBQ Cas9 tAtUBQ Hygr What are the advantages of the CRISPR-Cas9 system? 1. Targeted editing of a gene of interest 2. Applicable to crop plants 3. Easy to carry out 4. Target multiple homologous genes A graduate student found two Arabidopsis genes (PTN1 and PTN2), which encode two related proteinases with 70% sequence identity at amino acid level. She wants to test whether these they are involved in chloroplast development. What would you suggest her to do? There is no mutant phenotype in the knockout mutants of ptn1 or ptn2. The two genes are next to each other on the chromosome. What would you suggest her to do next? Using Deleteagene, a mutant with both genes deleted was identified, but only heterozygous mutant plants can be identified. What would you suggest her to do next?