* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Studying the Embryo Lethality of AT5G03220
Transposable element wikipedia , lookup
Epigenetics of neurodegenerative diseases wikipedia , lookup
Copy-number variation wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Genome evolution wikipedia , lookup
Non-coding DNA wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Genome (book) wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Genetically modified crops wikipedia , lookup
Epigenetics in learning and memory wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Epigenomics wikipedia , lookup
Messenger RNA wikipedia , lookup
Neuronal ceroid lipofuscinosis wikipedia , lookup
Saethre–Chotzen syndrome wikipedia , lookup
Dominance (genetics) wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Gene desert wikipedia , lookup
Gene therapy of the human retina wikipedia , lookup
Epitranscriptome wikipedia , lookup
Genetic engineering wikipedia , lookup
Gene expression profiling wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Gene expression programming wikipedia , lookup
Gene therapy wikipedia , lookup
Point mutation wikipedia , lookup
Primary transcript wikipedia , lookup
Gene nomenclature wikipedia , lookup
Epigenetics of diabetes Type 2 wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Genome editing wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
History of genetic engineering wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Microevolution wikipedia , lookup
Put Your Dukes Up AT5G03220! Studying Embryo Lethality of Knockout T-DNA Mutagenesis on Arabidopsis Thaliana Genes By Aditi S. Hendi What was studied of AT5G03220? Physical Characteristics and Descriptive Analysis of Gene Determination of T-DNA Insertion Candidates for Knocking Out the Gene Activity at Various Stages in Plant Development of Gene Genotyping Plants Affected or Exposed to T-DNA Effect of Results of Genotyping What is AT5G03220? Located on Arabidopsis Chromosome 5 Reverse Complementary Oriented Has 6 exons, 5 introns, 2 5’ UTRs, & 1 3’ UTR AT5G03210 is 4167 bp downstream and AT5G03230 is 656 bp upstream to it What else is known about AT5G03220? Codes for transcriptional coactivator or related gene Contains the F-box motif on the aminoterminus Works in conjunction with other proteins in the regulation of transcription How does Scarlet Runner Bean model mRNA activity of Arabidopsis? Approximations of activity levels of ortholog SRB gene was used to model those expected of Arabidopsis (right) The mRNA of the gene was found to be inactive, or present in trace amounts, in the flower organs of SRB However it was only an approximation… PCSC13532 (39128) Length = 344 Score = 52.0 bits (26), Expect = 2e-06 Identities = 32/34 (94%) Strand = Plus / Plus Query: 223gatgttcttccaagcttagaagaacaaggagtgc 256 | | | ||| | | | | | | | | || | | | | | | | | | | | | | | | | Sbjct: 290 gatgttctaccaagcttggaagaacaaggagtgc 323 When is AT5G03220 active in Arabidopsis Thaliana? Genechip Analysis of mRNA Activity and Regulation at Various Stages of Plant Development for AT5G03220 900 800 Level of Activity/Regulation 700 600 500 Wild Type Lec1 Mutant 400 300 200 100 0 Ovules 24-Hr Seeds MidMaturation (Cotyledon Stage) Seeds Mature Green Seeds PostSeedlings Maturation (3DAI) Green Stage of Grow th Seeds Leaves Roots Stem C24 Leaves Mutant line results indicate more up-regulation post-24Hr seed stage, and more down-regulation slightly after 30 days after pollination As compared to the Wild Type activities of mRNA corresponding to AT5G03220, activities are affected by the mutation in the Lec1 Mutants. Who wants to Knockout AT5G03220? T-DNA Madison Screens ~612 bp ~408 bp ~500 bp 500 Knockout candidates for AT5G03220 were identified to be contained in Superpool 1 (left), DNA Pool 6 (right) of the Madison Lines. Sequencing results were repetitively unsuccessful in giving definitive results. Expected sizes of amplified product were predicted to be between 400 and 615 bp in length from Autoradiography. Using SALK Lines to Genotype SALK line 109178 was chosen due to its position in a 5’UTR of the gene. Plants exposed to the TDNA were assayed for Wild Type and Mutant alleles in hopes to find an embryo lethal form of the gene. It was determined with the first ten extracted DNA samples that their genotypes were all homozygous Wild Type. Is this T-DNA Insertion Embryo Lethal? All ten samples displayed the presence of at least one Wild Type Allele, and through T-DNA specific PCR, it was verified that all of the plants were homozygous for the Wild Type allele. So far, results obtained suggests the high possibility that the SALK 109178 insertion may cause embryo-lethality in gene AT5G03220. Further assays on a second set of extracted DNA samples will serve to create a more robust set of data from which to draw a definitive conclusion as will dissecting siliques to provide phenotypes to the genotypic descriptions obtained. The fight ain’t over yet! Hopefully, with the verification with the next set of DNA of embryo-lethality, the focus will shift to a more in depth study of AT5G03220. Applications in agriculture have enormous potential in terms of improving seed viability through the research of these knockouts.