Download Studying the Embryo Lethality of AT5G03220

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project

Document related concepts

Transposable element wikipedia , lookup

Epigenetics of neurodegenerative diseases wikipedia , lookup

Copy-number variation wikipedia , lookup

Cre-Lox recombination wikipedia , lookup

Epistasis wikipedia , lookup

Genome evolution wikipedia , lookup

NEDD9 wikipedia , lookup

Non-coding DNA wikipedia , lookup

Zinc finger nuclease wikipedia , lookup

Genome (book) wikipedia , lookup

No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup

Genomics wikipedia , lookup

Genetically modified crops wikipedia , lookup

Epigenetics in learning and memory wikipedia , lookup

Deoxyribozyme wikipedia , lookup

Epigenomics wikipedia , lookup

Messenger RNA wikipedia , lookup

Neuronal ceroid lipofuscinosis wikipedia , lookup

Saethre–Chotzen syndrome wikipedia , lookup

Dominance (genetics) wikipedia , lookup

Cell-free fetal DNA wikipedia , lookup

Gene desert wikipedia , lookup

Gene therapy of the human retina wikipedia , lookup

Epitranscriptome wikipedia , lookup

Genetic engineering wikipedia , lookup

Gene expression profiling wikipedia , lookup

Nutriepigenomics wikipedia , lookup

Gene wikipedia , lookup

Gene expression programming wikipedia , lookup

Gene therapy wikipedia , lookup

Point mutation wikipedia , lookup

Primary transcript wikipedia , lookup

Gene nomenclature wikipedia , lookup

Epigenetics of diabetes Type 2 wikipedia , lookup

Vectors in gene therapy wikipedia , lookup

RNA-Seq wikipedia , lookup

Genome editing wikipedia , lookup

Site-specific recombinase technology wikipedia , lookup

History of genetic engineering wikipedia , lookup

Therapeutic gene modulation wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Microevolution wikipedia , lookup

Designer baby wikipedia , lookup

Helitron (biology) wikipedia , lookup

Transcript
Put Your Dukes Up
AT5G03220!
Studying Embryo Lethality of
Knockout T-DNA Mutagenesis on
Arabidopsis Thaliana Genes
By Aditi S. Hendi
What was studied of AT5G03220?





Physical Characteristics and Descriptive
Analysis of Gene
Determination of T-DNA Insertion
Candidates for Knocking Out the Gene
Activity at Various Stages in Plant
Development of Gene
Genotyping Plants Affected or Exposed
to T-DNA
Effect of Results of Genotyping
What is AT5G03220?




Located on Arabidopsis Chromosome 5
Reverse Complementary Oriented
Has 6 exons, 5 introns, 2 5’ UTRs, & 1 3’ UTR
AT5G03210 is 4167 bp downstream and AT5G03230 is
656 bp upstream to it
What else is known about
AT5G03220?



Codes for
transcriptional coactivator or related
gene
Contains the F-box
motif on the aminoterminus
Works in conjunction
with other proteins in
the regulation of
transcription
How does Scarlet Runner Bean model
mRNA activity of Arabidopsis?



Approximations of activity levels of ortholog SRB gene
was used to model those expected of Arabidopsis (right)
The mRNA of the gene was found to be inactive, or
present in trace amounts, in the flower organs of SRB
However it was only an approximation…
PCSC13532 (39128)
Length = 344
Score = 52.0 bits (26), Expect = 2e-06 Identities = 32/34 (94%)
Strand = Plus / Plus
Query: 223gatgttcttccaagcttagaagaacaaggagtgc 256
| | | ||| | | | | | | | | || | | | | | | | | | | | | | | | |
Sbjct: 290 gatgttctaccaagcttggaagaacaaggagtgc 323
When is AT5G03220 active in Arabidopsis Thaliana?
Genechip Analysis of mRNA Activity and Regulation at Various Stages of Plant Development for
AT5G03220
900
800
Level of Activity/Regulation
700
600
500
Wild Type
Lec1 Mutant
400
300
200
100
0
Ovules


24-Hr
Seeds
MidMaturation
(Cotyledon
Stage)
Seeds
Mature
Green
Seeds
PostSeedlings
Maturation
(3DAI)
Green
Stage of Grow th
Seeds
Leaves
Roots
Stem
C24 Leaves
Mutant line results indicate more up-regulation post-24Hr seed stage, and more down-regulation slightly after
30 days after pollination
As compared to the Wild Type activities of mRNA
corresponding to AT5G03220, activities are affected by
the mutation in the Lec1 Mutants.
Who wants to Knockout AT5G03220?
T-DNA Madison Screens
~612 bp
~408 bp
~500 bp


500
Knockout candidates for AT5G03220 were identified to be
contained in Superpool 1 (left), DNA Pool 6 (right) of the
Madison Lines.
Sequencing results were repetitively unsuccessful in giving
definitive results. Expected sizes of amplified product were
predicted to be between 400 and 615 bp in length from
Autoradiography.
Using SALK Lines to Genotype



SALK line 109178 was
chosen due to its position
in a 5’UTR of the gene.
Plants exposed to the TDNA were assayed for
Wild Type and Mutant
alleles in hopes to find an
embryo lethal form of the
gene.
It was determined with
the first ten extracted
DNA samples that their
genotypes were all
homozygous Wild Type.
Is this T-DNA Insertion Embryo
Lethal?



All ten samples displayed the presence of at least one
Wild Type Allele, and through T-DNA specific PCR, it was
verified that all of the plants were homozygous for the
Wild Type allele.
So far, results obtained suggests the high possibility that
the SALK 109178 insertion may cause embryo-lethality
in gene AT5G03220.
Further assays on a second set of extracted DNA
samples will serve to create a more robust set of data
from which to draw a definitive conclusion as will
dissecting siliques to provide phenotypes to the
genotypic descriptions obtained.
The fight ain’t over yet!

Hopefully, with the verification with the
next set of DNA of embryo-lethality, the
focus will shift to a more in depth study of
AT5G03220. Applications in agriculture
have enormous potential in terms of
improving seed viability through
the research of these knockouts.