* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download slides
DNA methylation wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
DNA sequencing wikipedia , lookup
Epigenetics wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
DNA barcoding wikipedia , lookup
Human genome wikipedia , lookup
DNA profiling wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Metagenomics wikipedia , lookup
Nutriepigenomics wikipedia , lookup
DNA polymerase wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Primary transcript wikipedia , lookup
Genetic engineering wikipedia , lookup
SNP genotyping wikipedia , lookup
Designer baby wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Genomic library wikipedia , lookup
Point mutation wikipedia , lookup
Microsatellite wikipedia , lookup
Non-coding DNA wikipedia , lookup
DNA vaccination wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Microevolution wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
DNA supercoil wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Molecular cloning wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Epigenomics wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Genome editing wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Helitron (biology) wikipedia , lookup
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. MCDB 1041 Class 27 Making recombinant DNA and using it Learning Goals • Explain why and how bacteria can be easily used to make copies of human DNA. • Compare the two methods for making lots of copies of DNA: PCR and bacterial amplification. • Given information about a bacterial plasmid and a piece of DNA, propose how you would cut and combine the two to create recombinant DNA. Quiz Friday Review session: Thursday at 12:30 –will email location 18-1 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. PCR is good for making lots of copies of a specific region of DNA However, it is most effective for smallish pieces of DNA (up to 10 Kb) When scientists want to make copies of large pieces of DNA, they often employ a different technique The advantage of the next technique is that pieces of DNA can be isolated, manipulated, and then amplified 18-2 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Making recombinant DNA Restriction enzymes cut DNA at particular locations Scientists can put different pieces of DNA together (by cutting with restriction enzymes and then sealing the pieces back together) 18-3 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Why make recombinant DNA? • Study how a gene (or its protein) normally work • delete genes • express a new protein in a chosen location (“Mr. Green Genes” at right!) • introduce specific mutations into a gene • Produce a lot of a specific protein medical uses (insulin, human growth hormone) • Produce an altered protein not normally produced by an organism genetically modified crops gene therapy 18-4 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Putting two pieces of DNA together requires that they have complementary sequences that can pair Isolate gene of interest by restriction enzyme digest (orange piece of DNA) Cut another piece of DNA with the same restriction enzymes (grey piece) The two pieces of DNA have complimentary sticky ends Add the enzyme ligase, and the two pieces of DNA become one piece 18-5 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. This circular piece of DNA is called a “plasmid” (more in a minute) They exist naturally in bacteria They get replicated just like a regular chromosome within the bacterium 18-6 400 million people in the world are at risk of a vitamin A deficiency, which can lead to blindn carrots, sweet potatoes, an -carotene (precursor to vitamin A), but these foods are not always available in the developing Copyright © The McGraw-Hill Companies, Inc. Permission required reproduction display. increase in the severity of infections in for young children.orFoods like Imagine your goal is to generate engineered rice that would contain Vitamin A. By adding a g Restriction enzymes and DNA (review) phytoene synthase (psy) from the daffodil plant, plus a promoter region that determines where expressed, -carotene will accumulate in the rice grain. picture below represents a piece of double-stranded DNA from daffodil. This DNA includ This DNA sequence can beThe cut by 4 differentrestriction enzymes phytoene synthase gene (psy), as well as additional sequences of DNA. E=Eco RI E P B H B P=Pst1 B=BglII Each lineline represent 1 Kilobase (1KB). You can(1Kb) amplify this 12 KB sequence from cells taken Each demarcates 1 Kilobase H=HindIII using PCR. This DNA sequence can be cut by 4 different restriction enzymes (denoted by E, P, B, and H) The restriction enzyme sites are shown below of the nucleotide sequencesin thatdetail occur at two of these restriction enzyme sites, along with the the REs. one with E and one with H, what can you If you cut two piece of DNA, Letter on the DNA Restriction Enzyme Recognition Name of Restriction do next? sequence and cutting sequence Enzyme E G* A A T T C Eco RI a. Paste the two pieces together C T T A A *G b. Paste only E cut pieces or H cutCpieces together P T G C A*G Pst I G *A rejoined C G T C c. Nothing—once cut, DNA cannot be 1. G* A A T T C C T T A A *G C T G C A*G G *A C G T C 18-7 Eco RI In the strand of DNA shown below, find the restriction enzyme sites. TATAAGATTGCGATGCCCTGCAGCTATTCGGCTGCCTAAAATCGGCCCCTAAGAA ATATTCTAACGCTACGGGACGTCGATAAGCCGACGGATTTTAGCCGGGGATTCT restriction site If this sequence (above) of DNA were cut with both enzymes, how many pieces would be crea Hind III These restriction enzymes produce sticky ends where DNA nucleotides restriction site are not bound to their pair. Thus, they can be easily hooked up to another piece that has the complementary unbound nucleotides: Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. The picture below represents a piece of double-stranded DNA from daffodil. This phytoene synthase gene (psy), as well as additional sequences of DNA. E P B H B Each lineline represent 1 Kilobase (1KB). You can(1Kb) amplify this 12 KB sequence from Each demarcates 1 Kilobase using PCR. If this sequence of DNAof the were with nucleotidecut sequences that occur at two of these restriction enzyme sites, alo the REs. both E and H restrictionLetter enzymes, how Enzyme Recognition Name of Restriction on the DNA Restriction sequence and cutting sequence Enzyme E G* A A T T C Eco RI many pieces would be created? C T T A A *G P C T G C A*G Pst I a. 1 G *A C G T C b. 2 1. In the strand of DNA shown below, find the restriction enzyme sites. c. 3 TATAAGATTGCGATGCCCTGCAGCTATTCGGCTGCCTAAAATCGGCC ATATTCTAACGCTACGGGACGTCGATAAGCCGACGGATTTTAGCCGG d. 4 If this sequence (above) of DNA were cut with both enzymes, how many pieces w This DNA sequence can be cut by 4 different restriction enzymes (denoted by E, These restriction enzymes produce sticky ends where DNA nucleotides are not bound to their pair. Thus, they can be easily hooked up to another piece that has the complementary unbound nucleotides: 18-8 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. The picture below represents a piece of double-stranded DNA from daffodil. This phytoene synthase gene (psy), as well as additional sequences of DNA. E P B H B Each lineline represent 1 Kilobase (1KB). You can(1Kb) amplify this 12 KB sequence from Each demarcates 1 Kilobase using PCR. In gel below, if the gene of interest isand Thisisolate DNAat sequence can beat cut2 byKB 4 different enzymes (denoted by E, base andthe learn that theyou psy want gene you want begins to and endsinat 6 KB in the arn that the psy gene to isolate 2begins KB ends at 6restriction KB the of the nucleotide sequences that occur at two of these restriction enzyme sites, ded DNA in theabove. diagram you cutthewith the DNA withof a variety ofrestriction different restriction alo in the you the DNA aenzyme variety different indiagram between the IfEabove. andcutHIf restriction REs. ow with the letter of band the restriction enzyme thatonto was used to cut the DNA): which band on e letter of the restriction enzyme that was used the DNA): which band onName Letter thecut DNA Restriction Enzyme Recognition of Restriction sites, which on the gel represents that sequence and cutting sequence Enzyme ns gene of (write interest? thethe lane and the band size) ne your of interest? the (write lane and band size) piece? H B E H+ H E B+PE H+ Ladder(DNA of Ladder(DNA of known sizes P for known sizes for referen referen ce) B+Pce) 12 KB 1. 11 KB 10 KB G* A C T C T G *A A T T C T A A *G G C A*G C G T C Eco RI Pst I 12 KB In the strand of DNA shown below, find the restriction enzyme sites. 11 KB 10 KB TATAAGATTGCGATGCCCTGCAGCTATTCGGCTGCCTAAAATCGGCC 9 KB 9 KB ATATTCTAACGCTACGGGACGTCGATAAGCCGACGGATTTTAGCCGG A B C If6 this KB sequence (above) 6 KB of DNA were cut with both enzymes, how many pieces w These restriction 3enzymes produce sticky ends 3 KB KB where DNA nucleotides are not bound to their pair. Thus, they can be easily hooked up to 1 KB KB another piece that1has the complementary unbound nucleotides: A band out of the out gel and purify the purify DNA from the gel using specialized kit. dil psy DNA band of the gel and the DNA from the agel using a specialized kit. y gene into plasmid What restriction enzymes should you use toyou cut use to cut daffodil psy the gene into thebelow. plasmid below. What restriction enzymes should 18-9 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Features of Bacterial Plasmids • Bacterial plasmids are circular, have a site to initiate replication, and can serve as a carrier for another piece of DNA • Can be introduced back into bacteria, which will make many copies of the plasmid Essential Features Series of unique restriction sites Selectable Marker AmpR – ampicillin resistance gene Bacteria with AmpR will not die in the presence of ampicillin, while other bacteria will ORI – origin of replication (for bacteria) allows the plasmid to be replicated in bacteria 18-10 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Bacterial cells have to incorporate the plasmid “Transformation” + AmpR Plasmid+ gene Competent bacteria Chemically treated so they will take up DNA Few cells are transformed Transformation is a rare event, so you need a way to kill off all the cells that aren’t transformed, leaving only the cells that contain your gene. 18-11 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Select for transformed cells • the plasmid contains an ampicilin resistance gene AmpR • when a plasmid has this gene, it can make a protein that breaks down ampicilin, preventing this antibiotic from killing the bacteria Plate the bacteria on media that contains ampicilin If you grow bacteria on a plate that has ampicillin, which bacteria will survive? a. All bacteria b. Bacteria that contain the plasmid c. No bacteria media + ampicilin plasmid media + ampicilin 18-12 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Finally, break open these bacterial cells and remove the DNA from the plasmid Or, allow the bacterial cells to make protein from the DNA, then isolate the protein, which can be used to treat people who can’t make the protein This technique is used to make insulin for diabetics 18-13 Copyright © The Companies, required forincludes reproduction or display. The picture below represents a piece of McGraw-Hill double-stranded DNA Inc. from Permission daffodil. This DNA the daffodil Imagine your goal is to generate engineered rice that would contain Vitamin phytoene synthase gene (psy), as well as additional sequences of DNA. A. By adding a ge phytoene synthase (psy) from the daffodil plant, plus a promoter region that determines where t E P -carotene B Hwill accumulate B expressed, in the rice grain. The picture below represents a piece of double-stranded DNA from daffodil. This DNA include Each linegene: represent 1 Kilobase (1KB). KB sequencesequences from cells takenoffrom daffodil Psy Coding from E(psy), toYou H can phytoene synthase gene asamplify well this as 12 additional DNA. using PCR. E can be Pcut by 4 different B restriction H enzymes Bby E, P, B, and H). Below is a list B (denoted E B DNA P This sequence of the nucleotide sequences that occur at two of these restriction enzyme sites, along with the actual names of the REs. Letter on the DNA Restriction Enzyme Recognition Name of Restriction Crt gene. Coding from P to E. Each line represent 1 Kilobase can amplify this 12 KB sequence from cells taken f sequence and cutting sequence (1KB). You Enzyme Eusing PCR. G* A A T T C Eco RI C T T A A *G P C T G C A*G Pst I IfThis youDNA wantsequence these two genes to be hooked together in (denoted sequence, can be cut by 4 different restriction enzymes by E,crt, P, B, and H). G *A C G T C of the nucleotide sequences that occur at two of these restriction enzyme sites, along with the ac then psy, what can you do? the 1. REs. In the strand of DNA shown below, find the restriction enzyme sites. a. Letter Mix the DNA all together, cut with E, P and H.Name Separate on gel, on the DNA Restriction Enzyme Recognition of Restriction TATAAGATTGCGATGCCCTGCAGCTATTCGGCTGCCTAAAATCGGCCCCTAAGAATTCTTATCG ligate pieces sequence and cutting sequence Enzyme ATATTCTAACGCTACGGGACGTCGATAAGCCGACGGATTTTAGCCGGGGATTCTTAAGAATAGC G* ACut A with T T C RI P for other. b. E Keep DNA separate. E and H for one, Eco E and Ccut T Aenzymes, A *Ghow many pieces would be created? If thisSeparate sequence (above)on of DNA wereLigate. with T both gel. P C T G C A*G Pst I c. TheseRun gelenzymes to separate DNA. Cut with E and H for one, E and P for restriction produce sticky ends G *A C G T C where DNA nucleotides are not bound to their other. Ligate pair. Thus, they can be easily hooked up to 1.piecegel In strand of DNA shownMix below, the restriction enzyme sites. then d. another Run tothe separate DNA. all find together, cut with E,P,H, thatthe has complementary unbound nucleotides: ligate. TATAAGATTGCGATGCCCTGCAGCTATTCGGCTGCCTAAAATCGGCCCCTAAGAA ATATTCTAACGCTACGGGACGTCGATAAGCCGACGGATTTTAGCCGGGGATTCTT If this sequence (above) of DNA were cut with both enzymes, how many pieces would be creat 18-14 These restriction enzymes produce sticky ends Copyright © The Companies, required forincludes reproduction or display. The picture below represents a piece of McGraw-Hill double-stranded DNA Inc. from Permission daffodil. This DNA the daffodil Imagine your goal is to generate engineered rice that would contain Vitamin phytoene synthase gene (psy), as well as additional sequences of DNA. A. By adding a ge phytoene synthase (psy) from the daffodil plant, plus a promoter region that determines where t E P -carotene B Hwill accumulate B expressed, in the rice grain. Eco RI9:/$..$ The picture below represents a piece of double-stranded DNA from daffodil. This DNA include %&'()&'*+,,'(-$ Each linegene: represent 1 Kilobase (1KB). KB sequence from cells takenoffrom daffodil .('*-"+(-$ Psy Coding from E(psy), toYou H can phytoene synthase gene asamplify well this as 12 additional sequences DNA. using PCR. Amp R (-/-01+2/-$*+"3-"$ 4#,5$...$ 60'$7.$ %(1$8$ 9:/$..$ E can be Pcut by 4 different B restriction H enzymes Bby E, P, B, and H). Below is a list B (denoted E B DNA P This sequence of the nucleotide sequences that occur at two of these restriction enzyme sites, along with the actual names of the REs. Letter on the DNA Restriction Enzyme Recognition Name of Restriction Crt gene. Coding from P to E. Each line represent 1 Kilobase can amplify this 12 KB sequence from cells taken f sequence and cutting sequence (1KB). You Enzyme Eusing PCR. G* A A T T C Eco RI C T T A A *G !"#$ P C T G C A*G Pst I This DNA sequence can be cut by 4 different restriction enzymes (denoted by E, P, B, and H). G *A C G T C of the nucleotide sequences that occur at two of these restriction enzyme sites, along with the ac the 1. REs. In the strand of DNA shown below, find the restriction enzyme sites. Once joined Restriction your genes of Recognition interest together, Letter you’ve on the DNA Enzyme Name of Restriction TATAAGATTGCGATGCCCTGCAGCTATTCGGCTGCCTAAAATCGGCCCCTAAGAATTCTTATCG sequence and cutting sequence you need to get them into this plasmid. How Enzyme should ATATTCTAACGCTACGGGACGTCGATAAGCCGACGGATTTTAGCCGGGGATTCTTAAGAATAGC E G* A A T T C Eco RI you cut the soT can incorporate the DNA T A A *G If this sequence (above)plasmid of DNA wereCcut withit both enzymes, how many pieces would be created? P be grown in bacteria C T G C A*Gampicillin in thePst I and with These restriction enzymes produce sticky ends G *A C G T C where DNA nucleotides are not bound to their environment? pair. Thus, they can be easily hooked up to 1.pieceIn strand a. With Phasand Eof DNA shown below, find the restriction enzyme sites. another thatthe the complementary unbound nucleotides: b. With H and E TATAAGATTGCGATGCCCTGCAGCTATTCGGCTGCCTAAAATCGGCCCCTAAGAA c. ATATTCTAACGCTACGGGACGTCGATAAGCCGACGGATTTTAGCCGGGGATTCTT With B d. With P and H If this sequence (above) of DNA were cut with both enzymes, how many pieces would be creat 18-15 These restriction enzymes produce sticky ends Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Practice: Here is a bacterial plasmid and a piece of human DNA that contains a gene called tol. You want to join the tol gene and the bacterial plasmid together, and you want all of the tol gene to be present. You also want to use Ampicillin (Amp) to select for bacteria that take up this plasmid. What enzyme(s) should you use to cut both the plasmid and the genomic DNA? Amp resistance gene Ori Unique restriction sites tol gene BamHI EglI A. XhoI B. BamHI C. EglI and BamHI D. EcoRII 18-16 E. BamHI and XhoI BamHI EcoRII XhoI EglI EcoRII XhoI XhoI XhoI EcoRII BamHI Human genomic DNA Plasmid DNA Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Another one: Here is a bacterial plasmid and a piece of human DNA that contains a gene called qt. You want to join the qt gene and the bacterial plasmid together and introduce them into bacteria. You also want to use Ampicillin (Amp) to select for bacteria that take up this plasmid. What enzyme(s) should you use to cut both the plasmid and the genomic DNA? Amp resistance gene Ori Unique restriction sites qt gene EcoRII A. XhoI EglI B. BamHI and XhoI BamHI C. EglI D. EcoRII 18-17 E. BamHI and EcoRII EcoRII XhoI EglI EglI XhoI XhoI BamHI Human genomic DNA Plasmid DNA Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. An organism that contains DNA from another organism in its genome is called a “transgenic organism” Thus, a bacterium with a piece of human DNA in it is a transgenic bacterium! A plant engineered to contain a piece of DNA from another organism is also transgenic: we usually call these “GMOs” 18-18 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Genetically Modified Foods • • • • higher yield improved quality pest or disease resistance tolerance to heat, cold and drought. Plants have been bred for years to specifically yield these desirable qualities Transgenic technology allows the introduction of genes from OTHER organisms into a plant or animal to yield a specific outcome 18-19 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. One example: Insect Resistance Bt corn Normal corn Bacillus thuringiensis (Bt) (a bacterium): Makes a protein that causes paralysis and death to some insects (corn weevil). 18-20 Use this rather than an applied pesticide, which often kills beneficial insects as well!