Download Something`s Fishy

Lab: Something’s Fishy
Zoology / Mrs. O’Connor
The Dilemma
One afternoon in early March, an officer at Florida Fish & Wildlife received an anonymous call.
The caller stated that a local market has been selling grouper that is being illegally fished by a
small group of fishermen in Tampa Bay. Grouper are off limits from November 1st through June
30th each year. The caller provided the officer with additional details, including the boat ramp
that the fishermen were using and when they leave and arrive each day.
The officer headed out to the market to follow up on the tip. Upon entering the store, the owner
became rather fidgety. “Can I help you?” The owner asked nervously. The officer said, “I hear
that you’ve got fresh grouper for sale. Is that true?” The shopkeeper walked over to the display
case where the grouper was located. The officer was already standing there eyeing the fish
suspiciously. “That’s the only fish we sell in this market that’s been frozen. With grouper off
limits until June 30th, we stock up in October and keep it in the freezer so we can sell it during
the off season.” The officer was pretty skeptical about this story because the fish looked very
fresh. He ordered a couple of filets and left the store.
When he returned to his office, he contacted a marine biologist at the local aquarium and
research facility. He asked the biologist if the filets could be tested to determine how long the
specimen had been dead. “Sure, we can do that. Bring it on down and I’ll test it for you.” A few
days later the biologist called the officer with results. “That’s some mighty fresh grouper that you
brought in.”
The following morning the officer visited the boat ramp. He watched as a small group of men
boarded a fishing boat that matched the description given by the anonymous tipster. Given the
pieces of the puzzle that had already fallen into place, he decided that there was certainly
probable cause to search the fishing boat later that day. For that, he called in another officer
and later that day they set out on their patrol boat and waited for the fishermen to return.
When the boat entered Palma Sola Bay, the officers turned on their lights and pulled up next to
the boat. They boarded the boat, asked questions, and seized nearly two-dozen filets from a
cooler on the boat. The fishermen had cleaned the fish while still out at sea making it nearly
impossible to identify the species. The captain of the boat tried to assure the officers that they
had caught redfish and trout that afternoon but the offers confiscated the fish for further
analysis.
The officer dropped off the fish at the Bayshore Forensics Lab where a group of scientists will
analyze the DNA of the fish to see if it was indeed off-season grouper. If test results indicate
that it is grouper, the fishermen face serious fines, including confiscation of the boat, as well as
possible jail time.
LAB: Something’s Fishy
Zoology / Mrs. O’Connor
Background Information
You have learned that DNA is a linear sequence of nucleotides made up of adenine, thymine,
guanine, and cytosine. This sequence of A, T, G, and C is unique to each individual.
Restriction enzymes cut DNA. Each restriction enzyme recognizes a specific group of “target”
base pairs and makes a cut within this area. The resulting fragments are called restriction
fragment length polymorphisms or RFLPs for short.
A DNA molecule containing several such targets will be cut into a number of fragments. The
DNA from one individual will always give the same pieces when cut with a specific restriction
enzyme because all of that person’s DNA is the same. DNA from different individuals may give
different size fragments.
Specialized gels are used to separate the fragments. During gel electrophoresis DNA is
injected into gels. The gel is place into a tray where it is subjected to an electrical current. Since
DNA is negatively charged, the DNA moves toward the positive end of the electric field. The
fragments move through the gel at rates relative to their size. Smaller fragments move towards
the positive end more rapidly than larger ones.
These fragments provide use with a DNA fingerprint, which like real fingerprints, are unique to
each individual. These fingerprints can be used to identify familial relationships, answer
questions about paternity, and solve crimes.
Part A: Restriction Enzyme Simulation
Two common restriction enzymes are EcoRI and PstI which will be provided to you in this lab
procedure. To better understand how EcoRI and PstI may help you in performing your DNA
fingerprinting experiment, first you must understand and visualize the nature of the cutting effect
of a restriction enzyme on DNA.
The line through the base pairs in this diagram represents the sites where bonds will break if the
restriction enzyme EcoRI recognizes the site GAATTC. The following analysis questions refer to
how a piece of DNA would be affected if a restriction enzyme were to cut the DNA molecule in
the manner shown below:
1. How many pieces of DNA would result from this cut? ______
2. Write the base sequence of the DNA fragments on both the left and right side of the “cut”.
Left
Right
3. DNA fragment size can be expressed as the number of base pairs in the fragment.
a. The smaller fragment is _____ base pairs (bp).
b. What is the length of the longer fragment? _____ bp
4. Consider the following sample of DNA shown below – single strands are shown for simplicity.
The sample is treated with the restriction enzyme EcoRI with a recognition sequence of
GAATTC.
CAGTGATCTCGAATTCGCTAGTAACGTT
a. How many fragments of DNA result from using this restriction enzyme? ______
b. List the fragment size in order from largest  smallest.
5. Now examine another strand of DNA. This sample is also treated with the restriction enzyme
EcoRI.
TCATGAATTCCTGGAATCAGCAAATGCA
a. How many fragments of DNA result from using this restriction enzyme? ______
b. List the fragment size in order from largest  smallest.
Part B: Gel Electrophoresis Simulation
Now that you know how restriction enzymes work, it’s time to look more closely at the gel
electrophoresis process.
1. Navigate to this website: http://learn.genetics.utah.edu/content/labs/gel/
2. As you go through the tutorial, fill in the information in the chart below.
Material / Tool
Agarose gel (also
referred to as gel)
Loading buffer
DNA size standard
Electric current
DNA staining
solution
Function – What does it do? What is its purpose?
Part C: Analysis and Conclusions – Answer questions in complete sentences.
1. Based upon your data, did the fishermen catch grouper illegally? Support your answer.
2. Out of the five different fish samples, which DNA sample had the smallest fragment?
Which one had the largest?
3. On day 1 of the lab, you added a restriction enzyme to each DNA sample. What would
have happened during the electrophoresis if you had forgotten to add this enzyme first?
4. When you placed the gel into the electrophoresis chamber, the wells containing the DNA
were located near the negative end of the chamber. Why was this necessary?
5. If you were called away during the electrophoresis procedure and were not able to
monitor your electrophoresis run, what do you think would happen if the electricity were
to remain running in your absence?
6. The technology that you used in this lab is the same as what is being used by forensic
scientists in real life situations. Think about how this technology is being used and
describe its impact on our society.