* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download cinnabar - UWL faculty websites
Zinc finger nuclease wikipedia , lookup
Gene expression profiling wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Protein moonlighting wikipedia , lookup
Polyadenylation wikipedia , lookup
Genome (book) wikipedia , lookup
Genetic engineering wikipedia , lookup
Non-coding RNA wikipedia , lookup
DNA supercoil wikipedia , lookup
Transposable element wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Epitranscriptome wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Epigenetics of human development wikipedia , lookup
History of RNA biology wikipedia , lookup
Human genome wikipedia , lookup
Epigenomics wikipedia , lookup
DNA vaccination wikipedia , lookup
Genetic code wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Genomic library wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Molecular cloning wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Metagenomics wikipedia , lookup
Designer baby wikipedia , lookup
Microsatellite wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
History of genetic engineering wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Non-coding DNA wikipedia , lookup
Microevolution wikipedia , lookup
Genome editing wikipedia , lookup
Primary transcript wikipedia , lookup
Point mutation wikipedia , lookup
Helitron (biology) wikipedia , lookup
Genetica 98: 249-262, 1996. (~) 1996KluwerAcademicPublishers. Printedin the Netherlands. 249 Molecular characterization of the cinnabar region of Drosophila melanogaster: Identification of the cinnabar transcription unit W i l l i a m D. Warren*, Stephanie Palmer & A n t o n y J. H o w e l l s Division of Biochemistry and Molecular Biology, Faculty of Science, The Australian National University, Canberra, ACT,, 2601, Australia *Present address: Peter MacCallum Cancer Institute, St Andrews Place, East Melbourne, Vic. 3002, Australia Received28 February1996Accepted24 May 1996 Key words: cinnabar, eye pigmentation, FAD binding, kynurenine 3-monooxygenase, mitochondrial membrane targetting sequence Abstract Early studies of eye pigmentation in Drosophila melanogaster provided compelling evidence that the cinnabar (cn) gene encodes the enzyme kynurenine 3-monooxygenase (EC 1.14.13.9). Here we report the cloning of approximately 60 kb of DNA encompassing the cn gene by chromosome walking in the 43E6-F1 region of chromosome 2. An indication of the position of cn within the cloned region was obtained by molecular analysis of mutants: 9 spontaneous cn mutants were found to have either DNA insertions or deletions within a 5 kb region. In addition, a 7.8 kb restriction fragment encompassing the region altered in the mutants was observed to induce transient cn function when microinjected into cn- embryos. The cn transcription unit was identified by Northern blotting and sequence analysis of cDNA and genomic clones from this region. The predicted cn protein contains several sequence motifs common to aromatic monooxygenases and is consistent with the assignment of cn as encoding the structural gene for kynurenine 3-monooxygenase. Introduction The brick red colour of the compound eye of Drosophila melanogaster is determined by the presence of the brown (ommochrome) and red (drosopterin) screening pigments that optically isolate the individual onunatidial units. These pigments are located mainly in specialized pigment cells that form a sleeve around each ommatidium. The biosynthetic pathways for the production of the two classes of pigments, which are biochemically aistinct, are under strict developmental control. Ommochrome deposition in the developing eye first begins around 47 h after pupariation and continues until two days after eclosion (Ryall & Howells, 1974), while the drosopterins first appear about 70 h after pupariation and are deposited until two to three days after adult emergence (Fan et al., 1976). These features of tissue-specific and temporal con1Ioi, in combination with the identification of over 50 genes that have a primary effect on pigment production (Lindsley & Zimm, 1992), make eye pigment synthesis in Drosophila melanogaster an attractive system for studying coordinated gene regulation. Xanthommatin, the main ommochrome screening pigment found in dipteran eyes, is biosynthetically derived from tryptophan via a series of oxidation reactions that involve N-formylkynurenine, kynurenine, and 3-hydroxykynurenine as intermediates (see reviews by Linzen, 1974; Phillips & Forrest, 1980; Summers, Howells & Pyliotis, 1982; Sullivan, 1984). Four eye colour genes of D. melanogaster - scarlet(sO, white(w), vermilion(v), and cinnabar (cn)-encode products that are absolutely required for xanthommatin synthesis because null mutations at these loci abolish brown pigment production entirely. Two of these genes (st and w) code for products that are involved in the uptake and storage of xanthommatin precursors (Sullivan & Sullivan, 1975; Howells & Ryail, 1975). Both st and w have been cloned and an examination of the amino acid sequences of their 250 putative protein products (Mount, 1987; Tearle et ai., 1989; Pepling & Mount, 1990; Ewart et al., 1994) has shown that they both belong to the Traffic ATPase (ABC) super-family of membrane transporters (Ames, Mimura & Shyamala, 1990; Hyde et al., 1990). The other two genes code for enzymes required for xanthommatin biosynthesis. The v gene encodes the pathway enzyme tryptophan oxygenase (Baglioni, 1960; Baillie & Chovnick, 1971; Walker, Howells & Tearle 1986). This gene has been cloned (Searles & Voelker, 1986; Walker, Howells & Tearle, 1986) and its molecular structure fully characterized (Searles et al., 1990). Compelling biochemical data indicates that the cn gene encodes the third enzyme of the pathway, kynurenine 3-monooxygenase (EC 1.14.13.9); 1 no activity of this enzyme was detected in adults or pupae of strains homozygous for three different mutant alleles of cn (cn 1 , cn s, and cn ssK) (Ghosh & Forrest, 1967; Sullivan, Kitos & Sullivan, 1973). In pupae that have one, two, or three copies of the cn + allele, enzyme activity is proportional to the cn + dose (Sullivan, Kitos & Sullivan, 1973). The activity of kynurenine 3-monooxygenase in D. melanogaster has been shown to vary in a developmentally specific manner, with peaks in both larval and pupal life (Sullivan, Kitos & Sullivan, 1973). Grillo (1983) determined that the larval activity can be attributed almost entirely to expression in the Malpighian tubules and that pupal kynurenine 3monooxygenaseactivity can be detected only in developing eye tissue. Thus the cn gene is of interest because of its distinct tissue and temporal specificity, being expressed only in the larval Malpighian tubules and in the developing eyes and ocelli of the pharate adult. The enzyme is also of interest because of its subcellular localization. In Saccharomyces (Bandlow, 1972), Neurospora (Cassady & Wagner, 1971), rat liver (Okamoto et al., 1967) and in the Mediterranean flour moth Ephestia (Stratakis, 1981), kynurenine 3-monooxygenase has been shown to be associated with the outer mitochondrial membrane. It seems likely that this is also the case in D. melanogaster because it has been localized to the mitochondria (Sullivan, Grillo & Kitos, 1974) and shown to be hydrophobic (Grillo, 1983). Three of the four genes known to be essential for the production of xanthommatin have been cloned. This paper describes the cloning of the fourth, cn. As described below, a short chromosome walk was ! Formerly known as kynurenine 3-hydroxylase (EC 1.14.1.2 pre1978, and EC 1.99.1,5 pre-1964) undertaken in the 43E-F region of chromosome 2, the chromosomal region to which cn has been localized by genetic and cytogenetic analysis (Lindsley & Zimm, 1992). By analysing the genomic DNA from a series of cn mutants using Southern blotting, a 5 kb region was identified as being the likely location of the cn gene. This and adjacent regions were sequenced and shown to contain a transcription unit with the potential to encode a polypeptide with several amino acid sequence motifs characteristic of monooxygenase enzymes. Materials and methods Drosophila stocks Wild-type and mutant strains of Drosophila melanogaster were obtained from a number of sources, listed in Table 1. All stocks were routinely reared at either 18 ° or 25 °C on standard cornmeal-treacle medium (Roberts, 1986). Library screening and Southern blotting For each step of the chromosome walk, three genome equivalents of an amplified Canton S genomic DNA library, constructed in EMBL3A (Walker, Howells & Tearle, 1986), were screened using standard procedures (Maniatis, Fritsch & Sambrook, 1982; Bender, Spierer & Hogness, 1983). cDNA clones were isolated from libraries constructed from seven- to nineday-old pupal RNA (Poole et al., 1985) and from size fractionated cDNA derived from newly emerged adult heads (Dreesen, Johnson & Henikoff, 1988). For both genomic and cDNA libraries, replica nitrocellulose filter lifts were hybridized with nick translated probe DNA at 60 °C as described by Walker, Howells, and Tearle (1986). Genomic DNA was isolated from adult flies as described by Bender, Spierer, and Hogness (1983). Bacteriophage lambda and plasmid DNA were prepared as described by Sambrook, Fritsch, and Maniatis (1989). Restriction digestions and Southern blotting were performed as described by Walker, Howells, and Tearle (1986) except that genomic Southern blots were hybridized at 42 °C in 50% formamide, 5 x SSPE, 1 x Denhardt's solution, 10% dextran sulphate, 0.1% SDS and 50 #g/ml herring-sperm DNA and washed at a final stringency of 0.5 x SSC/0.1% SDS at 65 °C. 251 Tab/e 1. Sources of Drosophila stocks Strain Background Origin Source Reference Canton S standard wild-type outcrossed to Canton S wild-type Spontaneous in wild-type Spontaneous in ln(2R)Cy ANti ANU I. Alcxandrov Lindslcy and Grell, 1968 Tearle, 1987 Lindsley and Zimm, 1992 Unknown¶ Unknown Unknown¶ Spontaneous in B bb Spontaneous in B bb Unknown¶ Spontaneous Spontaneous Spontaneous in y2su(wa) Spontaneous Spontaneous in vg MR induced MR induced radiation induced radiation induced radiation induced radiation induced BG ID BG BG Lindsley and Zimm, 1992 Lindsley and Zimm, 1992 Lindsley and Zimm, 1992 Lindslcy and Zimm, 1992 Lindsley and Zimm, 1992 Lindsley and Zimm, 1992 Tearle, 1987 Tearle, 1987 Tearle, 1987 A. Howells unpublished Valad~del Rio, 1982 M. Green unpublished M. Yarnomoto unpublished Alexandrev, 1984 Alexandrov, 1984 Lindsley and Zimm, 1992 Lindsley and Zimm, 1992 cn ! cn I SM5 cns T(Y;2)C T(¥;2)C cn4 ln(2LR)ds33kab2cn4bw vl cn 3sk cn MR1 wild-type wild-type l,'leldSJb38Jc?138Jbw 38j wild-type wild-type wild-type wild-type wild-type wild-type wild-type l(2)cn~thSO Dj~2R)cn7969 SM511(2)cn s4hS° SMSIDfl2R)cn 79b9 Df12R)CA53 Dfl2R)cn-h3 CyOIDj~2R)CA53 CyOIDj~2R)cn-h3 CIf38j cn 83c cn84h cn s q cn 86i cn~r cn 8sa ID BG ANU ANU ANU ANU A. Fontevilla M. Green M. Yamomoto I. Alexandrov I. Alexandrov TM TM Abbreviations: ANU, The Australian National University; BG, Bowling Green State University, Bowling Green Ohio, USA; ID, Indiana University, Bloomington Indiana, USA; TM, Max-Plank-Intitut fdr Entwicklungsbiologie, Tiibingen Germany. ¶The origin of these alleles is not reported in the literature. ¢entromeri¢ telomerlo -35 -30 -25 I I I -20 -15 -10 -5 I I I i 0 kl) 5 10 15 20 25 30 35 I I I I I I I I , f Ot~CASa Df(2R) Cn.h3 1(2)cna4hJo Illll II Df(2R) cn~b¢ I "~( ~1 (I I ~G3 l Gapdh ;LF2 [1¢ I I ~1111(( I I J ;~H2 ~E6 It II ~.J1 Figure 1. Basic restriction maps of the recombinant clones isolated from the 43E polytenc band region. The orientation of the walk in relation to the centromere and telomere and the location of the Gapdh gene are shown. Solid black bars indicate the regions deleted in Df(2R)CA53, Df(2R)cn-h3, Dfl2R)cn 79b9 and l(2)cn 84h80. Coordinates originate at the unique XhoI site in AH2 (see Figure 5), 252 RNA extraction, blotting, and RT-PCR procedures RNA was extracted from frozen animals by an adaptation of the method described by Bingham and Zachar (1985). 0.2 mg of frozen material was homogenized in 2.5 ml of 10 mM Tris-HC1 (pH8)/350 mM NaCI/2% SDS/7M urea/10 mM EDTA and immediately vortexed in 1 ml of buffered phenol followed by 1 ml of chloroform. The aqueous phase was then collected, reextracted as above, and ethanol precipitated. Poly A + RNA was then isolated from this crude preparation by oligo dT cellulose chromatography (Nakazato & Edmonds, 1974). Northern blot analysis was performed by electrophoresing equal quantities (approx. 10 #g) of glyoxylated poly A + RNA through 1% agarose, blotting onto nylon membrane (Hybond N+, Amersham), and hybridizing to a randomly primed 32p labelled DNA probe in 50% deionized formamide/2 x SSPE/1% SDS/1% BSA/0.5 mg/ml sheared herring testis DNA/10% dextran sulphate at 50 °C. Blots were washed at a final stringency of 0.1 x SSC, 1% SDS at 60 °C prior to autoradiography. cDNA was made from DNase treated poly A + RNA using a commercial eDNA synthesis kit (Pharmaeia P-L Biochemicals) utilizing the oligonucleotide YAACTGGAAGAATTCGCGGCCGCAGGAA(T)Is-3' to prime the reverse transcription (RT) reaction. Two rounds of hemi-nested PCR were performed on 1 #g of eDNA in 100 #l reactions. Each amplification contained 2.5 U Taq DNA polymerase/0.2 mM dNTPs/2 mM MgCl2/50 mM KCI/10 mM Tris pH 8.31100 pmol of each primer. Primers 5'-CAGAATCAAAACGATCTCCTG-3 ~ and 5~-CATITGCGACCTGGCCATGTAC-3 ', which are specific to cn exon 2, were used in combination with primer 5~-AAGAATTCGCGC~CG-CAGGAAT3~. Thermal cycling conditions for both primer combinations were as follows: 96 °C (5 min), 35 cycles of 96 °C (10 s), 65 °C (15 s), 72 °C (1.5 min) followed by a final extension of 72 °C (5 min). Plasmid cloning and sequencing Restriction fragments derived from recombinant phage were cloned using standard procedures (Sambrook, Fritsch & Maniatis, 1989) into the pBluescribe (pBS+ and pBS-, Stratagene) phagemid vectors. PCR amplified eDNA sequences were cloned into pBluescript (Stratagene) prepared as described by Marchuk et al. ( 1991). All phagemids were propagated in E. coli strain JPA101 (a TetR derivative of JM101 constructed by J. Adelman). 1 2 3 4 Size (kb) 28 -> 9.4-> 6.6-> 4.8-> 2.0-> Figure2. LocaliTafionofthe AG3cloneto the regionabsentin both the Df(2R)CA53and Df(2R)cn-h3defieeneies.Equal quantifies of EcoRI-eutgenomieDNAwereprobedwithradiolabelledAG3DNA. DNAsamplesincludeCantonS (lanes 1 and 4), Df(2R)CA53/CyO (lane 2), andDf(2R)cn-h3/CyO(lane3). Nucleotide sequences were determined from single-stranded DNA by a modification of the standard Sequenase method (Tsang & Bentley, 1988) using 35SdATP (Amersham, >1000 Ci/mmol) and 7C-deazadGTP (Boehringer) in place of dGTP (Mizusawa, Nishimura & Seela, 1986). Nested deletions required for sequence analysis were generated by the method of Henikoff (1987). Sequence analyses were performed with the MacVector (IBI) or GCG (Devereux, Haeberli & Smithies, 1984) suites of sequence manipulation programs. Protein and nucleic acid sequence database searches were performed using the BLAST algorithm (Altschul et al., 1990) via the electronic-mail search facility provided by the National Center for Biotechnology Information (NCBI). Embryo injections for transient expression assays Embryos (less than 40 min old) that had been manually dechorionated and desiccated were microinjected with cesium chloride purified plasmid DNA (600 mg/ml) essentially as described by Rubin and 253 Size (kb) 23 -> 9.4 -> 6.6 -> 4.3 -> 2.0 -> Figure 3. Localizationof the AF2, AG3, and AI-I2clonesrelative to the lesions in D~2R)cn7969 and l(2)cn84h80. Replica Southern blotscontainingapproximatelyequalIoadingsofEcoRI-eutgenomic DNA were probed with the AF2 (lanes 1-3), ~G3 (lanes 4--6), and ~,H2(lanes7-9). DNA samplesanalysedwere CantonS (CS), Df(2R)cnZgbg/SM5 (79b9), and l(2)cn84hSOISM5(84h80). Alexandrov and Alexandrov(1992) report Df(2R)cn7969to be lackingthe 43E5-7 to 43E19-F1 polytenebandregion. Spradling (1982). The injected animals were maintained at 20 °C until eclosion. Eye phenotype was scored within 24 h of eclosion and rechecked around 72 h later. Results Cloning the cinnabar region by chromosome walking )~G3, a genomic clone originating from within polytene band 43E and containing the glyceraldehyde 3phosphate dehydrogenase (Gapdh) gene (Sullivan et al., 1985), provided an entry point into the cn gene region. Using standard chromosome walking techniques, two sequential steps were taken from each end of the AG3 clone to isolate overlapping clones from a Canton S derived genomic library. Preliminary restriction mapping of DNA from the recombinant phage (denoted)~E6, )~F2, )~H2, and All; see Figure 1) showed that the genomic region covered by the five clones spans just over 60 kb. To localize the cloned sequences within the 43EF polytene band region, Southern blot analyses of genomic DNA from wild-type and from heterozygotes carrying Df(2R)CA53 , D~2R)cn-h3, Df(2R)cn 7~bg, and l(2)cn s4hs° were performed. All four of these chromosomes lack cn function as well as that of one or more flanking lethal complementation groups (Alexandrov, 1984; Alexandrov & Alexandrov, 1991; Lindsley & Zimm, 1992; Wustmann et al., 1989). Radiolabelled DNA prepared from the )tG3 clone was found to hybridize to Df( 2R )CA5 31CyO and Df( 2R )cn-h31CyO DNA with approximately half the intensity of that observed for wild-type (Figure 2). By probing Southern blots similar to that shown in Figure 2, it was found that the sequences covered by the entire 60 kb are absent in both Df(2R)CA53 and Df(2R)cn-h3 (data not shown). The hybridization signal with DNA from the l(2)cn s~hs° heterozygotes was reduced to about half that of wild-type for all the bands hybridizing to )~F2, AG3, and )~H1 (Figure 3, lanes 1, 4, and 7 compared to lanes 3, 6, and 9), as well as with AE6 and AJ1 (data not shown). This indicated that the entire genomic region covered by the walk is deleted in the l(2)cn s4 hso chromosome. In contrast, DNA from the Df(2R)cn 7969 showed wild-type levels of hybridization to AF2 (Figure 3, lane I compared to 2), and )~E6 (not shown), but reduced levels with AH2 (Figure 3, lane 7 compared to 8) and AJ1 (not shown). )~G3 appears to span one of the deletion endpoints in the Df(2R)cn 7969 chromosome, as one fragment (of about 6 kb) shows normal levels of hybridization while the others show reduced levels (Figure 3, lane 4 compared to 5). Alexandrov (1984) determined that the Df(2R)cn 7°b9 chromosome lacks cn function as well as that of a juxtaposed lethal complementation group immediately centromere proximal, whereas l(2)cn s4h8° lacks cn and the flanking lethal gene immediately distal (Alexandrov, 1984; Alexandrov, unpublished). From the orientation of the two deficiencies with respect to the chromosome it was deduced that the distal endpoint of Df(2R)cn 7969 is located within the AG3 sequences ant, of the five recombinant phage, AJ1 contains sequences closest to the centromere. Because cn function is absent in both Df(2R)cn 7~b9 and l(2)cn s~hs°, cn was concluded to lie on the centromeric side of the Df(2R)cn 7969 breakpoint, i.e., in the righthand region of)~G3, in )~H2, AJ1, or beyond. Southern blot analysis of cinnabar mutant strains In an attempt to locate the cn transcription unit within the region covered by the chromosome walk, 15 independently isolated, cytologically normal cn alleles (Table 1) were examined by genomic Southern analysis 254 Size (kb) 16 -> 1 2 3 4 5 6 7 8 Size (kb) 9 10 11 12 13 14 15 16 1"/ 18 20 -> 5-> 5-> 4-> 3-> 1.4 -> 1.1 -> 0.8 -> 1.5 -> Hybridization of radiolabeUed AH2 DNA to EcoRI digested (lanes 1-8) and SalI cHgested (lanes 9-18) genornic DNA from various mutants. DNA samples analysed include Canton S (lanes 1 and 9), cn I (lanes 2 and 10), cn rbr (lanes 3 and 11), cn 3 from Bowling Green (lanes 4 and 12), cn 83c (lanes 5 and 13), cn s4g (lanes 6 and 14), cn 84h (lanes 7 and 15), cn 38j (lanes 8 and 16), cn 35k (lane 17), and SMS/l( 2 )cn 84h80 (i.e., cn 2 , lane 18). Figure 4. cinnabar for DNA rearrangements. When AH2 was hybridized to blots carrying DNA cut with a variety of restriction enzymes, altered restriction patterns relative to wild type were found in a large number of the mutants (see Figure 4 for examples). This high level of restriction site polymorphism was not observed when the Southern filters shown in Figure 4 were stripped and hybridized with AE6, AF2, or All (data not shown). A detailed restriction map of the sequences carried in AH2 was constructed and the nature and position of the molecular lesion in each mutant (as determined from a series of detailed genomic Southern analyses) was determined (Figure 5). DNA insertions or deletions were mapped to a region in the centre of the AH2 clone in 9 of the 15 c n alleles examined, suggesting that t h e c n transcription unit spans this region. Of these 9 alleles, 7 showed a single alteration while 2 alleles ( c n 3 a n d c n 84h) have two. The c n s strain obtained from the Bowling Green Stock Center contains a 0.5 kb deletion as well as a 7.5 kb insertion located about 5 kb distally, although this insertion was not found in DNA from t h e c n 3 strain obtained from the Indiana Stock Center (data not shown). For c n 8 ~ h , two insertions were detected, one of 0.4 kb and a second of approximately 1 kb located about 4 kb distally (Figure 5). Both c n ~ and c n sSk show a 0.5 kb deletion that appears to be identical in both size and position. Two other alleles ( c n 1 , cn rbr) contain identical 1.5 kb deletions (compare the relevant lanes in Figure 4 for examples) and and c n 4 have identical 8 kb DNA insertions (data for c n 4 not shown). In addition, identical restriction patterns to that observed for c n 1 were also seen in DNA from c n s s d a n d c n M m (data not shown). cn 2 of cinnabar b y t r a n s i e n t e x p r e s s i o n Transient expression of microinjected DNA was used to ascertain whether the region of )~H2 identified by mutant analysis could supply c n function in v i v o . Transient expression of injected DNA containing the c n transcription unit was considered likely to induce partial xanthommatin deposition in c n - individuals because 1) c n is non-cell autonomous in tissue transplantation experiments (Beadle & Ephrussi, 1936), 2) xanthommatin deposition in adult eye tissues can be partially restored by feeding c n - larvae on a diet supplemented with 3-hydroxykynurenine (Schwabl & Linzen 1972), and 3) microinjection of rosy+ and v+ encoding DNA into r o s y - a n d v - embryos has previously been shown to partially restore adult eye pigmentation (Rubin & Spradling, 1982; P.W. Atkinson and W.D.W, unpublished). Plasmid DNA containing the 7.8 kb X h o I - K p n I fragment (designated XK8, coordinates 0 to +7.8, Figure 5), which includes the region altered in the c n mutants, was found to induce partial xanthommatin deposition in 37% of the adults developing from microinjected c n 1 ;w B ~ embryos. Thus, the XK8 fragment was concluded to contain the c n gene. Localization 255 I""4 cd lxl ea I1==1 -d r/) "~ ~ , ~ , 4 h M N mr~ -2.0 0.0 +2.0 N ~m~m~ mM~t~ ~ r#3 M A: B: XK8 subclone +4.0 +6.0 +8.0 +10.0 +12.0 +14.0 I C: I}I +2.0 +3.0 l k b insertion in cn 84h D: L~J+4.0 c n 3sk +5.0 i c n 84h +6.0 +7.0 L ,1 ca1 cnr~r 88d Polymorpl insertion i e- e.' Figure 5. Summary of the molecular characterization of the cinnabar gene region. (A) Restriction map of the AH2 clone; (B) Location of the XK8 sequences shown to induce eye pigmentation in cn- animals; (C) Enlarged restriction map of the central portion of AH2; (D) Molecular lesions identified by Southern blot analysis of cn mutants. Insertions (A) and deletions (V) are indicated in proportion to their size and location. Coordinates correspond to kilobases from the unique XhoI site, Sequence analysis of the cinnabar region In order to establish the molecular structure of the cn gene region, the sequence of 12.3 kb of genomic DNA (from the XhoI site, coordinate 0.0, to the Xba I site, coordinate + 12.3) was determined, as was the sequence of several partial cDNA clones and an RT-PCR product derived from this region. The portion of the genomic sequence data that includes the cn gene is shown in Figure 6. The cn gene is interupted by two introns whose splice donor and acceptor sequences compare favorably to the known Drosophila consensus (Mount et al., 1992). The second ATG codon of exon 1 (nucleotides 3741-3743) appears to be the cn initiation methionine because it is flanked by sequences similar to the D. melanogaster translation initiation consensus (Cavener & Ray, 1991). In addition, codon preference analysis (Gribskov, Devereux & Burgess, 1984) of the sequences flanking this ATG revealed it to be coincident with the transition from triplets that poorly correlate with the known Drosophila codon bias, to triplets that more closely resemble the bias found in Drosophila coding sequences. Sequences similar to the CCAAT (nucleotides 3556-3563), TATA (nucleotides 3600-3605), and mRNA CAP (nucleotides 3683-3689) 256 2679 CATTTTGGT TC-CCTTTTGTGGTTCTCCTTGGATGCTATCTATAGAGTACAAATAAAGTTCGCTCTTTTCGCCGTTCCGCTCTTGGTTTTCCTCTAGTTTCcTTTAAAGTCCTACGC•G 2799 2919 3039 3159 3279 3399 3519 3639 CGGGCTATCCTGCACATGCTACTGTGGTTTTTGGGC~TTACGGTTTTGTTGTGGAAATATTCGGTTTTCTATTTTCTATTGTGCATGAGTTTTTCCACAC'CAGCTTTTGG~ ACCGC~GCGACAAAAAATACCTTGGTGGCCAAGGAAGAATACCA~AGCGTTGGCAACGC GTTGACAGGGTTGTCAGCGTTTGTCACATTAATTTAAATTAGCGeGGT TTTTTAAAACAGu~ACATGTATTTATTTATTTATACT T T T A G T A A T T G A A C ' / W - ~ 2 A T G A C A ~ A G T A T G A T CCAAAATTTCCATTCAGATAC~ ~ ~ ~ A ~ T CTTAAGTGTAAGTGCTCACAATTTACAGTTCTTATCTGTTTAAAATGTTTAATTATATCATGTAATCTGGGCTGGcTTAATCTAATG-FFF~A~G~~~ TTA CCATCC~ud~aATAGATGCATTTGTAcGAGTATGTAATAAAGAA~AATAA~AACATATTCTGAATTTTC~AAq-~TGTAATGATATA~C~~ AGTTAACTTAC-CTTATTTAACAAGTA~A~A~GAGGAAACGCAGGTCAATA~CATTCGTTTC~AAATACTACTGATACAAk~TAATA~C~G~~A ACAGTTTTGAAAGgFF~TGC~TTATAGAGTGGGC~TCTTACATAGCGTAGAATCTATGTACATA~CCTCTAGCTTATATA~e~-~-a.s~ATTTGTTGATCGGGATGTTTATACGG A~TCGCTTT~TGGTTACACATGCTTCTCAACGAATCAAGTATCAGGTGTAAAATCTTCATTTTCTGCAGCCCAACTTA~ACCC~C~G~TA~G (-- dCnB2 1 3759 7 3879 47 3999 87 4119 4239 4359 cinnabar L H L VG F P Q O H O T T I m T i ¥ C P SD I I S W L I ~ I S 110 4599 150 4719 190 4839 230 4959 270 5079 310 5199 350 5319 390 5439 430 P M F v A T P A S C L A S I S Z CCATCTTCATTTCGCTGCCAACGAGCCAGCAGAACGGTCATGAGCCCAGGAATCGTTAGCCAGGAGGTAAACGGCCGCCAGGAGCCAACAGAAGCTGCGAGGGACGAGAGACATGGA~ P S S P R C Q R A S R T V M S P G I VS Q E VI~G R Q E P T E A A R D E R H G R ~GC ~GGGTGGCGGTTATTC~GCAGGACTTGTGAGTGTAACAAAGTTA~AAGTATACAATTATTA~TCTGCGAAAGCATAAATAC`ATTGTC-GGTCTATAAATATAGCGAATGAA R R R V A V I G A G L ATTTAGTGTTAATCATTAACAAAATAAT&TATAGTCTATATTTAGAGTAGAcCGTAGTACGGTTATAAACAGGCAATAATTCTAGTTTATCTTCATGTTATCTAAAA•TAAGCTTTGCTA ATTTGCTABAATACACATCATAGTAGTAGAATTATAGAATTCGAATTCTTTTCGAATCATTCCTAAGTAATCTTTAAATTATGCTGCATTTTGATGTGTCTTCACATATGTAGTTAGA~G CGTTATCTTTAGTGTTTTTAAATCCC TGCTTCCAGATATAAGGCTCTTATCACGCTTTCTACGCATCTTATTCTcCATAACACTAGGTGGGTTCTCTGGCAGCCTTGAAeTTTGCCCGCA 98 4479 -.) CTGCATTTGG~CGCAC-CAACATC~AACAACCATAGATACCATTTA~CCATC~V~CATAATCTCTTGGTTAAACATTTCC CCAGCCAGTTC~CTGGCTTCCATCTCGATT V G S L A A L N F TGGGCAACCACGTG~ATTTGTACGAGTACCGGGAGGATATCCGCCAGGCCCTAGTGGTTCAGGGCAGGAGTATTAACCTC-GCTCTTTCGCAGCG~CGT~ G N H V D L Y E Y R E D I R Q A L V V Q G R S I N L A L S Q R GTC TGGAGCAAGAGGTGCTGC~CACCC-CCATACCCATC~G A G G C A G A A T G C T C C A C G A T G T G C G A G G A A A C T C C A ~ C T A T A C ~ C L E R Q R E Q V L L N A E T V A I r, L P N M A R C G D R K M L L P H N D I V R R C G H Ig F g E S H ~ K V L L T Y S D A R K A L P N I N C ~ L R N Q T E A C C G L ~ S R M V G ~ A C A ~ C ~ T ~ T ~ TGGGACGTCGACAGCTGAACGAAGTC~-FFFI~AATGCC T C C 2 G A T A A G C T G C C C A A T A T A C G C T G C C A C T T C G A G C A C A A G C ~ C ~ ~ G G A C ~CG Y S V F R E Y C M E GCAATCCCGCCAAGGAAGCCGTAGCTGCCCATGcTGATCTTATAGTCGGCTGCGATGGTGCCTTCAGTAGTGTGCGCCAGCACTTGGTCCGTTTGCCGGGCTTCAACTACTC C ~ N P A K E A V A A H A D L I V G C D G A F S S V R Q H L 11 R L P G F N Y S Q ACATAGAAACGGGGTATCTGGAGCTCTGCATACCcTCGAAATCGGGAGACTTCCAGATGCCTGCCAACTATCTGCACATATGGCCGCGTAACACCTTCATGATGATTGCCCTGC CGAATC I E T G Y L E L C I P S K S G D F O M P A N Y L III W P R N T F M M I A L P N Q A G G A T A A G T C T T T C A C G G T C A C G C T G T C C A T G C C C T T T G A G A T C T T ~ T T C A G A A T C A A A A C G A T CT C C T G G A A T T C T T T ~ G C T G A A C T T C C ~ C ~ C ~ C ~ D K S F T V T L S N P F E I F A G I Q N Q N D L L E F F K L N F R D A L P L I G A H A M R W GAGAGCAACAGCTCATAAAGGACTTCTTCAAGACCAGGCCACAGTTTCTGGTGTCCATCAAGTGCCGGCC GTATCATTATGCGGAT~CTGAT~TGCCGCCCAT~ E Q Q L I K D F F K T R P Q F L V S I K C R P Y H Y A D K A b I b G D A TGGTTCcGTAcTACGGCCAGGGTATGAATGCTGGAATGGAGGATGTCACGCTGCTCACCGACATTTTGGCCAAGCAGCTGCCACTGGACGA~C~CCC~~CC~ V P Y Y G Q G M N A G 14 E D V T L L T D I L A K Q L P L D E T L A b F T E S GGCAGGACGCCTTCGCCATT~C.CGACC T G G C C A T G T A C A A T T A T G T ~ T C , C G T T T T ~ C T A G A A T T C A T A T A G ~ A T A ~ ~ T ~ A ~ T Q D A F A Z C D L A M Y N Y V E M 5559 547 5679 587 5799 GCGAGACCTGACCAAACGTTGGACATTCCGGCTGCGGAAATC-GCTGGACACACTGCTCT TCCGTCTGTTTCCT G G T T G G A T T C C T C T C T A T ~ C A G C G T ~ CC ~ T A ~ C ~ A R D L T K R W T F R L R K W L D T L L F R L F P G W I P L Y N S V S F S S M P Y TCGACAGTGCATTGCCAACCGGAAGTGGCAGGATCAGCTGCTGAAAOGCATTTTC~CACTTTTTTGGCCGCCATTGTGACTGGTGGAGCTATATATG ~ G A ~ A T ~ G R Q C I A /~ R K W Q D Q L L K R I F G A T F L A A I V T G G A I Y A Q R F b STOP TAAAATTTAAAGT~ATATAAATTGTTACACTGATTATAAAGTAAATCGTCTGAA~rAGTACTAGTAAATTTTATTAATAAGATAGTACACAAACATTATTAGCATT~CC~A~ 5919 6039 6159 GAAATGATAAGTGTAGATATACAGCAACTATATTTCAAACTGGAGTGTGTTT~TTAAAAGACATATTTAAGTACGAATGATATTAC CGACAATACCA~YTCdkAAAA~ATA~T ACATA~TATATGGAAA~FFrACAAATGTTGCACCGCAAATGTTGCTAC~C~-ACCA~AAACATTTACACCCACACATTTTGTATCTTTAAATTTCTTGACTATGAAACG CAACATGTTGAGA~AACGTCTTATACTTTATGTTCGATTTGATGAGAAA.Fx-x-s-F~TGGATTTAAATCTGTCTGTTGTGCTCAATAAAAGGTGTTTACTTATTCAAAAATACc~G Figure 6. Nucleotide sequence and deduced amino acid translation of the cinnabar gene. The sequence shown starts at the ATG initiation codon of the adjacent, divergently transcribed dCnB2 transcription unit (Warren, Phillips & Howells, 1996). Putative CCAAT (nucleotides 35563563), TATA(nucleotides 3600-3605), mRNA CAP site (nucleotides 3683-3689), AUG initiation signal sequences (nucleotides 3738-3743), and polyadenylation signal sequences (nucleotides 6240-6245) are double underlined and the location of the poly A tail determined by cDNA analysis indicated. Nucleotide numbering corresponds to sequences deposited in GenBank accession U56245. consensus sequences (McKnight & Kingsley, 1982; Hultmark, Klemenz & Gehdng, 1986) were also identiffed in the region upstream of this ATG codon (Figure 6). Analysis of sequences derived from the Y end of the cn transcript, obtained by RT-PCR amplification of RNA isolated from 56-74 h pupae, revealed a poly A tract commencing after nucleotide 5859. Since the first consensus AATAAA polyadenylation signal sequence downstream of the stop codon at the end of exon 3 occurs at nucleotide 6240 (Figure 6), a cryptic polyadenylation signal must have been used to terminate this transcript. Given the location of the mRNA CAP consensus, the size of the two introns and loca- tion of the poly A tail, the full length cn transcript was predicted to be approximately 1.8 kb. Comparison of the cinnabar protein sequence to other monooxygenases Conceptual translation of the cn gene, presented below the nucleic acid sequence shown in Figure 6, yields a protein product that is 524 amino acids in length. This sequence was used to search the Swiss-Prot/PIR protein databases as well as translations of the GenBank/EMBL/DDBJ nucleotide sequence databases. Sequence similarity to a number of proteins was detected, including several known monooxygenases that act on aromatic substrates. In addition, homology was 257 .Ira ,, ~.-I ~ III .11 °H * N * * * * ~,~ ~.~ iiii I-,. : : : : ,.c 8.~ ~-~ :gl °'::~ ~ H ° ~ , o :=~~ . ~ ~.~m~ H I * * ~ , !+ ~ * * * * * H , * * * * H . * * * * J~t~ .qr~ H * * * , * m 0 U r ,j ~ . 0 , * * ' * 0 , * * * * ::~::: '"'" o , . H O ~ m~ ~ ~ m ~ H ~ , .~..~ a ~ ~ ° 258 observed between sequences near the N-terminus of the c n protein and a large number of FAD binding enzymes. An alignment of the cn protein to a number of these homologous proteins is shown in Figure 7. Two conserved domains were clearly identified; the first, spanning residues 89-117, are involved in the binding of FAD (Wierenga, Terpstra & Hol, 1986) and the second, spanning residues 383-411, are implicated in the formation of a substrate binding cavity and NADPH binding site (Weijer et al., 1983; Sejlitz et al., 1990). The extended sequence similarity to several known monooxygenases and the presence of FAD and NADPH/substrate binding motifs in the proposed cn protein indicates that cn encodes a flavin containing aromatic monooxygenase. In order to investigate aspects of the secondary structure of the polypeptide encoded by cn, hydropathy predictions were made using the method of Kyte and Doolittle (1982). With the exception of the extreme N- and C-terminal regions, the hydropathy of the cn protein is consistent with a globular cytosolic structure (data not shown). The N- and C-terminal regions are hydrophobic and could be involved in membrane anchoring. Because other outer mitochondrial membrane targeted enzymes have been proposed to contain an amphiphilic alpha helix at their N-terminus (von Heijne, 1986), this region of the cn protein was examined in detail for such structures. Although the extreme N-terminus has very few charged residues and appears unlikely to form an alpha helix, a region of probable helical structure begins at around residue 70. Given that the FAD binding motif, found within the first 20 or so amino acids in all the other known monooxygenase sequences belonging to subclass EC 1.14.13, is located just over 90 amino acids from the N-terminus of the c n protein, it seems likely that the first 70 amino acids are involved in mitochondrial targeting and/or anchoring. of cinnabar e x p r e s s i o n To determine the transcriptional characteristics of cn, a 0.8 kb partial cDNA clone spanning sequences from nucleotides 3887 to 5068 was hybridized to polyA+ RNA extracted from larvae, pupae, and newly emerged adults. Two transcripts of about 1.8 kb and 2.2 kb were detected in varying amounts in mid- and late-larvae and in early- and mid-pupae with the highest levels being present in mid-pupae (Figure 8). Low levels of both transcripts were observed in RNA from late pupae, but neither could be detected in newly emerged adults. ~ te t~ Size (kb) 4.3-> 0.5-> Figure 8. Northern blot analysis of cn mRNA. RNA extracted from 50-70 h larvae (mid larvae), 72-92 h larvae (late larvae), 24-32 h pupae (early pupae), 40--58 h pupae (mid-pupae), 72-78 h pupae (late pupae), and newly emerged adults (NEA) was hybridized with a radiolabelled plasmid done containing cn eDNA sequences. Each lane contained equal quantifies of polyA+ RNA as judged by ethidium bromide staining of the gel prior to blotting. The leftmost lane shows size standards ( Hindl]I fragments of X phage DNA). This developmental profile is consistent with the developmental variation in kynurenine 3-monooxygenase enzyme activity, which shows peaks in both larval and pupal life with the highest activity being present in mid- to late-pupae (Sullivan, Kitos & Sullivan, 1973). Although both transcripts are found during larval and pupal development, the 1.8 kb transcript appears to be the dominant cn mRNA in larvae, whereas the 2.2 kb transcript is the dominant c n mRNA found in pupae. The size of the 1.8 kb mRNA is consistent with the cn gene structure detailed in Figure 6, while the exact nature of the 2.2 kb mRNA has not yet been determined. Northern blot analysis Discussion Four independent lines of evidence indicate that we have cloned and sequenced the c n gene: (i) the cloned sequences encompass a region that displays altered restriction patterns in nine different c n mutants; (ii) an 8 kb restriction fragment from this region is capable of supplying c n function when introduced into c n mutants; (iii) the deduced cn protein displays amino acid similarity to other proteins known to encode aro- 259 matic monooxygenases, and (iv) the cloned sequences hybridize to RNA transcripts with developmental profiles consistent with the developmental variations seen in kynurenine 3-monooxygenase activity. The molecular analysis of c n mutants shows several unexpected features. Whereas a high proportion of spontaneous mutations in a number ofD. m e l a n o g a s t e r genes are caused by the insertion of transposable elements (Berg & Howe, 1989), only c n ~ and c n ~ appear to contain transposable element insertions. The 7.5 kb insertion detected in a c n s strain obtained from the Bowling Green Stock Center may be a transposable element, but it is unlikely to be associated with the loss of c n activity because it lies about 6 kb upstream from t h e c n gene and is not present in the c n s strain obtained from Indiana University. The molecular analysis of c n mutants also revealed a number of seemingly identical lesions, including four mutants ( c n I , c n rbr, c n M R1 a n d c n s s a ) that have similar 1.5 kb deletions. The finding that c n ~br is associated with a deletion is difficult to reconcile with the reported instability of this mutant and of its ability to induce reversions of c n I and c n ~ alleles in t r a n s (Valade del Rio, 1974; 1982). One possible explanation for these results is that the four alleles simply represent copies of the c n 1 lesion resulting from cross contamination of strains. For the c n s s a a n d c n M n l alleles, which were isolated relatively recently as single mutant individuals in separate MR mutagenesis experiments, strain contamination seems less likely. Although the details of c n M n l isolation are uncertain, the c n s s a allele was selected over a chromosome containing the c n 1 allele (M.M. Green, unpublished). Since MR chromosomes have been shown to induce P-element mobilization (Green, 1986) and therefore must also induce P-transposase activity, c n 88a and c n M m may have been derived from c n I by gene-conversion following a P-element excision and subsequent double-stranded break repair, as described by Engels et al. (1990). Northern blot analysis revealed two c n mRNAs of about 1.8 and 2.2 kb, the former being consistent with the anticipated size of the c n transcript as inferred from the DNA sequence data. Although we have no definitive data on the 2.2 kb mRNA, the simplest explanation is that this transcript contains an additional 400 bp of 3' untranslated sequences resulting from polyadenylation following the signal found at nucleotide 6240 instead of the cryptic signal used for generating the 1.8 kb mRNA. The developmental profile of c n transcript levels is consistent both with the biology of eye pigmentation (Summers, Howells & Pyliotis, 1982) and with the developmental variation in levels of kynurenine 3-monooxygenase enzyme activity (Sullivan, Kitos & Sullivan, 1973). Comparison of the c n polypeptide to other flavincontaining monooxygenases that act on aromatic substrates led to the identification of two conserved sequence motifs corresponding to the FAD binding site and to the putative NADPH binding active site regions. Given the biochemical similarites of this class of enzymes (requiring NADPH to catalyse the incorporation of one atom of oxygen into an aromatic substrate) the lack of more general sequence similarity seems surprising. A comparison of the sequences of kynurenine 3-monooxygenase from a number of other species would provide insight into the level of sequence variation resulting from the different substrate specificities of these enzymes and their mitochondrial targeting signal sequences. Towards this end we have commenced the characterization of t h e D . v i r i l i s c n homologue (C. Patterson, S.E & A.J.H., unpublished). The unusual position of the FAD binding motif in the c n protein, found within 20 residues of the Nterminus of all of the other known flavin-containing monooxygenase-like sequences shown in Figure 7, is consistent with the proposal that the first 80 N-terminal residues of the c n protein contain sequences necessary for mitochondrial targeting. However, the nature of sequence motifs involved in targeting proteins to the outer mitochondrial membrane is still in considerable doubt. Monoamine oxidase B is another nuclearencoded FAD binding enyzme targeted to the outer mitochondrial membrane (Greenawalt & Schnaitman, 1970), which in contrast to the c n protein, has its FAD binding domain located extremely close to the N-terminus (Ito et al., 1988). Similarly, the 42 kD and 38 kD outer mitochondrial membrane proteins, involved in the mitochondrial protein import mechanisms in yeast and Neurospora respectively (Baker et al., 1990; Kiebler et al., 1990), do not contain Nterminal targeting sequences of the type employed by other well-characterized outer membrane proteins such as porin or the 70 kD protein (Hase et ai., 1984; Mihara & Sato, 1985; Kleene et al., 1987). The work presented in this paper provides a firm basis for future studies of the structure, function, and regulation of the c n gene. A comparison of cDNA and genomic DNA sequences from this region has also led to the characterization of a divergently transcribed gene, d C n B 2 , located immediately upstream of c n (coordinates + 1.1 to +2.7), which encodes a protein homologous to the Ca z+ binding regulatory sub- 260 unit of the protein phosphatas¢, calcineurin (Warren, Phillips & Howells, 1996). The identification of initiation codons for both cn and for the divergently transcribed dCnB2 gene defines a 1 kb regulatory region that probably contains all of the cis-acfing sequences involved in the regulated expression of both dCnB2 and cn. Comparison of this region with upstream regions in the other genes involved in xanthommatin production may provide valuable information about the ciselements and trans-acting factors that act to coordinate the expression of genes involved in this common metabolic process in the terminally differentiated pigmerit cells of the developing adult eye. Such information should contribute to a greater understanding of the molecular mechanisms that regulate the activity of genes in time and space during metazoan development. References Alexandrov, I.D., 1984. Comparative genetics of neutron- and gamma-my-induced lethal b, cn and vg mutations in D. melanogaster. Dros. Inf. Serv. 60: 45-47. Alexandrov, I.D. & M.V. Alexandrov, 1991. Cytogenetics of the cinnabar mutations induced by different quality radiations. Dros. Inf. Serv. 70: 16. Altschul, S.E, W. Gish, W. Miller, E.W. Myers & DJ. Lipman, 1990. Basic local alignment search tool. J. Mol. Biol. 215: 403--410. Ames G.E, C.S. Mimura & V. Shyamala, 1990. Bacterial periplasmic permeases belong to a family of transport proteins operating from Escherichia coli to human: Traffic ATPases. FEMS Micro. Rev. 6: 429--46. Baglioni, C., 1960. Genetic control of tryptophan peroxidaseoxJdase in Drosophila melanogaster. Nature 184: 1084-1085. Baillie, D.L. & A. Chovnick, 1971. Studies on the genetic control of tryptophan pyrrolase in Drosophila melanogaster. Mol. Gen. Genet. 112: 341-353. Baker, K.P., A. Schaniel, D. Vestweber & G. Schatz, 1990. A yeast mitochondrial outer membrane protein essential for protein import and cell viability. Nature 348: 605--609. Bandiow, W., 1972. Membrane separation and biogenesis of the outer membrane of yeast mitochondria. Biochem. Biophys. Acta 282: 105-122. Beadle, G.W. & B. Ephrnssi, 1936. The differentiation of eye pigments in Drosophila as studied by wansplantatlon. Genetics 21: 225-247. Bender, W., P. Spierer & D.S. Hoguess, 1983. Chromosomal walking and jumping to isolate DNA from the Ace and rosy loci and the Bithorax complex in Drosophila melanogaster. J. Mol. Biol. 168: 17-33. Berg, D.E. & M.M. Howe, 1989. Mobile DNA. American Society for Microbiology Publications, Washington DC. Bingham, P.M. & Z. Zachar, 1985. Evidence that two mutations, w D zl and z I , affect synapsis dependent genetic behavour of white are transcriptional regulatory mutants. Cell 40: 891-827. Cassady, W.E. & R.E Wagner, 1971. Separation of mitochondrial membranes of Neurospora erassa I. Localization of Lkynurenine-3-hydroxylase. J. Cell Biol. 49: 535-541. Cavener. D.R. & S.C. Ray, 1991. Eukaryotic start and stop translation sites. Nuc. Acids Res. 19: 3185-3192. Devereux, J., P. Hacberli & O. Smithies, 1984. A comprehensive set of sequence analysis programs for the VAX. Nuc. Acids Res. 12: 387-395. Dreesen, T.D., D.H. Johnson & S. Henikoff, 1988. Thebrown protein of Drosophila melanogaster is similar to the white protein and to components of active transport complexes. Mol. Cell. Biol. 8: 5206--5215. Engels, W.R., D.M. Johnson-Schlitz, W.B. Eggleston & J. Sved, 1990. High-frequency P element lossinDrosophila ishomologue dependent. Cell 62: 515-525. Ewart, G.D., D. Cannell, G.B. Cox & A.J.Howells, 1994. Mutational analysis of the Traffic ATPase (ABC) transportersinvolved in uptake of eye pigment precursors in Drosophila melanogaster. J. Biol. Chem. 269: 10370-10377. Fan, C.L., L.M. Hall, A.J. Skrinska & G.M. Brown, 1976. Correlation of guanosine triphosphate cyclohydrolase activity and the synthesis of pterins in Drosophila melanogaster. Biochem. Genet. 14: 271-280, Ghosh, D. & H.S. Forrest, 1967. Enzymatic studies on the hydroxylation of kynurenine in Drosophila melanogaster. Genetics 55: 423-431. Green, M.M., 1986. Genetic instability in Drosophila melanogaster. The genetics of an MR element that makes complete P insertion mutations. Proc. Natl. Acad. Sci. USA 83: 1036-1040. Grecnawalt, J.W. & C. Schnallman, 1970. An appraisal of the use of monoamine oxidase as an enzyme marker for the outer membrane of rat liver mitochondria. J. Cell. Biol. 46: 173-179. Gribskov, M., J. Devereux & R.B. Burgess, 1984. The codon preference plot: Graphic analysis of protein coding sequences and prediction of gene expression. Nuc. Acids Res. 12: 539-549. Grillo, $.L., 1983. The biological and biochemical characterization of L-kynurenine monooxygenase from Drosophila melanogaster. Ph.D. thesis, Syracuse University, New York. Hase, T., U. Muller, H. Riezman & G. Schatz, 1984. A 70-kd protein of the yeast mitochondrial outer membrane is targeted and anchored via its exlreme amino terminus. EMBO J. 3: 31573164. Hent_~off, S., 1987. Unidirectional digestion with exonuclease HI in DNA sequence analysis. Methods Enzymol. 155: 156-165. Howells, AJ. & R.L. Ryall, 1975. A biochemical study ofthescarlet eye colour mutant of Drosophila melanogaster. Biochem. Genet. 13: 273-282. Hultmark, D., R. Klemenz & WJ. Gehring, 1986. Translational and transcriptional control elements in the untranslated !eader of the heat-shock gone hsp22. Cell 44: 429--438. Hyde, S.C., E Emsley, M.J. Hartshorn, M.M. Mimmack, U. Gileadi, S.R. Pearce, M.P. Gallagher, D.R. Gill, R.E. Hubbard & C.E Higgins, 1990. Structural model of ATP-binding proteins associated with cystic fibrosis, multidrug resistance and bacterial transport. Nature 346: 362-365. Ito, A., T. Kuwahara, S. Inadome & Y. Sagara, 1988 Molecular cloning of a cDNA for rat liver monoamine oxidase B, Biochem. Biophys Res. Comm. 157: 970-976. Kiebler, M., R. Pfaller, T. Sollner, G. Griffiths, H. HorsUnann, N. Pfanner & W. Neupert, 1990. Identification of a mituehondrial receptor complex required for recognition and membrane insertion of precursor proteins. Nature 348: 610-616. Kleene, R., N. Pfanner, R. Pfaller, T. Link, W. Sebald, W. Neupert & M. Tropschug, 1987. Mitochondrial porin ofNeurospora crassa~ cDNA cloning, in vitro expression and import into mitochondria. EMBO J. 6: 2627-2633. 261 Kyte, J. & R. E Doolittle, 1982. A simple method for displaying the hydropathic character of a protein. J. Mol. Biol. 157: 105-132. Lindsley D.L., & G. Zimm, 1992. The genome of Drosophila melanogaster. Academic Press, San Diego. Linzen, B., 1974. The tryptophan to ommochrome pathway in insects. Adv. Insect Physiol. 10:117-246. Muniatis, T., E. Fritsch & J. Samhrook, 1982. Molecular Cloning: A Laboratory Manual. Cold Spring Hafoor Laboratory, New York. Marchnk, D., D. Drumm, A. Saulino &ES. Collins, 1991. Construction of T-vectors, a rapid and general system for direct cloning of unmodified PCR products. Nuc. Acids Res. 19:1154. McKnight, S.L. & R. Kingsley, 1982. Transcriptional control signals of a enkaryotic protein-coding region. Science 217:316-324. Mihara, K. & R. Sato, 1985. Molecular cloning and sequencing of eDNA for yeast porin, an outer mitochondrial membrane protein: a search for targeting signal in the primary structure, EMBO J. 4: 769-774. Mizusawa, S., S. Nishimura & E Seela, 1986. Improvement of the dideoxy chain termination method of sequencing by use of deoxy7-deazagnanosine triphosphate in place of dGTP. Nue. Acids Res. 14: 1319-1324. Mount, S., C. Burks, G. Hertz, G. Stonno, O. White & C. Fields, 1992. Splicing signals in Drosophila: intron size, informaton content and consensus sequences. Nuc. Acids Res. 20: 42554262. Mount, S. M., 1987. Sequence similarity. Nature 325: 487. Nakahigashi, K., K. Miyamoto, K. Nishimura & H. Inokuchi, 1992. Isolation and characterization of a light-sensitive mutant of Escherichia coli K-12 with a mutation in a gene that is requited for the biosynthesis of ubiquinone. J. Bacteriol. 174: 7352-7359, Nakazato, Y.E & M. Edmonds, 1974. Purification of messenger RNA and heterogeneous nuclear RNA containing poly (A) sequences. Methods Enzymol. 29: 431-443. Okamoto, H., S. Yamarnoto, M. Nozaki & O. Hayaishi, 1967. On the submitochondrial localization of L-kynurenine-3-hydroxylase. Biochem. Biophys. Res. Commun. 26: 309-314. Pepling, M. & S.M. Mount, 1990. Sequence of a eDNA from the Drosophila melanogasterwhite Gene. Nuc. Acids Res. 18: 1633. Phillips, J.E & H. S. Forrest, 1980. Ommochromes and pteridines, pp. 542-623, in The genetics and biology of Drosophila, edited by M. Ashbumer and T.R.E Wright. Academic Press, London. Poole, S.J., L.M. Kauvar, B. Drees & T. Komberg, 1985. The engrailed locus of Drosophila: Structural analysis of an embryonic transcript. Ceil. 40: 37-43. Roberts, D.B., 1986, Basic Drosophila care and techniques, pp. 1-38 in Drosophila, a practical approach, edited by D.B. Roberts. IRL Press, Oxford. Rubin, G. & A. Spradling, 1982. Genetic transformation of Drosophila with transposable element vectors. Science 218: 348353. Ryall, R.L. & A.J. Howells, 1974. Ommochrome biosynthetic pathway of Drosophila melanogaster: variations in levels of enzyme activities and intermediates during adult development. Insect Biochem. 4: 47-61. Sambrook, J., E.E Fritsch & T. Maniatis, 1989. Molecular cloning: A laboratory manual. Cold Spring Harbor Laboratory Press, New York. Schwabl, G. & B. Linzen, 1972. Formation of eye pigment granules after feeding ommochrome precursors to Drosophila v and cn. W. Roux Arch. Dev. Biol. 171: 223-227. Searles, L.L. & R. Voelker, 1986. Molecular characterization of the Drosophila vermilion locus and its supressible alleles, Prec. Natl. Acad. Sci. USA. 83: 404-408. Searles, L.L., R,S, Ruth, A.M. Fret, R.A. Fridell & A.J. Aft, 1990. Structure and transcription of the Drosophila melanogaster vermilion gnne and several mutant alleles. Mol. Cell. Biol. 10: 14231431. Sejlitz, T., C. Wernstedt, A. Engstroem & H.Y. Neujahr, 1990. Amino acid sequences around the pyridoxal-5t-phosphatebinding sites of phenol hydroxylase. Eur. J. Biochem. 187: 225228. Speer, B.S., L. Bedzyl & A.A. Salyers, 1991. Evidence that a novel tetracycline resistance gene found on two bacteroides transposons encodes an NADP-requiring oxidoreductase. J. Bacteriol. 173: 175-183. Stratakis, E., 1981. Submitochondrial localization of kynurenine 3hydroxylase from ovaries of Ephestla kulmiella. Insect Biochem. I 1: 735-741. Sullivan, D.T., 1984. Tryptophan metabolism in Drosophila, pp. 697-710 in Progress in Tryptophan and Serotonin Research, edited by. H. G. Schlossberger, W. Kochen, B. Linzen and H. Steinbart. Walter de Gruyter & Co., Berlin. Sullivan, D,T. & M.C. Sullivan, 1975. Transport defects as the physiological basis for the eye color mutants of Drosophila melanogaster. Biocbem. Genet. 13: 603-613. Sullivan, D.T., R.J. Kitos & M.C. Sullivan, 1973. Developmental and genetic studies on kynurenine hydroxylase from Drosophila melanogaster. Genetics 75: 651-661. Sullivan, D.T., S.L. Grillo & R.J. Kitos, 1974. SubceUular localization of the first three enzymes of the 0mmochrome synthetic pathway in Drosophila melanogaster. J. Exp. Zool. 188: 225234. Sullivan, D,T., W.T. Carroll, C.L. Kanik-Ennulat, Y.S. 1-Iitti, J.A. Lovett & L.V. Kalm, 1985. Glyceraldehyde 3-phosphate dehydrogenase from Drosophila melanogaster. J. Biol. Chem. 260: 4345-4350. Summers, K.M., A.J. Howells & N.A. Pyliotis, 1982. Biology of eye pigmentation in insects. Adv. Insect Physiol. 16:119-166. Tearle, R.G., 1987. Genetic and molecular biological analysis of the ommochrome biosynthetic pathway in Drosophila melanogaster. Ph.D. thesis, Australian National University, Canberra. Tearle, R.G., J.M. Belote, M. McKeown, B.S. Baker & A.J. Howells, 1989. Cloning and characterization of the scarlet gene of Drosophila melanogaster. Genetics 122: 595-606. Tsang, T.C. & D.R. Bentley, 1988. An improved sequencing method using sequenase that is independant of template concentration. Nue. Acids Res. 16: 6238. Valade del Rio, E., 1974. cnrbr: rojo brillante. Dros. Inf. Serv. 51: 22. Valade del Rio, E., 1982. Unstable genetic system in Drosophila melanogaster: I. Instability at the cinnabar locus. Expefientia 38: 790-792. yon Heijne, G., 1986. Mitochondrial targeting sequences may form amphiphilic helicies. EMBO J. 5: 1335-1342. Walker, A.R., A.J. Howells & R.G. Tearle, 1986. Cloning and characterization of the vermilion gene of Drosophila melanogaster. Mol. Gen. Genet. 202: 102-107. Warren, W.D., A.M. Phillips & A.J. Howells, 1996. Drosophila contains both X-linked and autosomal homologues of calcineurin B. Gene (in press). Weijer, W.J., L Hofsteenge, J.J. Beintema, R.K. Weirenga & J. Drenth, 1983. p-Hydroxybenzoate hydroxylase from Pseudomonasfluorescens 2. Fitting of the amino-acid sequence to the tertiary structure. Eur. J. Biochem. 133: 109-118. Wierenga, R.K., P. Terpstra & W.G.J. Hol, 1986. Prediction of the oceurrance of the ADP-binding ~a/~-fold in proteins, using an amino acid sequence fingerprint. J. Mol. Biol. 187: 101-107. 262 Wustmann, G., J. Szidonya, H. Taubert & G. Reuter, 1989. The genetics of position-effect variegation modifying loci in Drosophila melanogaster. Mol. Gen. Genet. 217: 520-527. You, I.-S,D. Ghosal & I.C.Gunsalus, 1991. Nuclcotidc sequence analysis of the PseudomonasputidaPpG7 salicylate hydroxylase gene (nahG)and it's 3'-flanking region. Biochemistry 30: 16351641.