* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Here - Personal Genome Project Study Guide
X-inactivation wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Population genetics wikipedia , lookup
Biology and consumer behaviour wikipedia , lookup
Heritability of IQ wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Medical genetics wikipedia , lookup
Behavioural genetics wikipedia , lookup
Epigenetics of neurodegenerative diseases wikipedia , lookup
Genomic imprinting wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Pathogenomics wikipedia , lookup
Oncogenomics wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Genetic testing wikipedia , lookup
Transposable element wikipedia , lookup
Gene therapy wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Whole genome sequencing wikipedia , lookup
Gene expression programming wikipedia , lookup
Gene expression profiling wikipedia , lookup
Point mutation wikipedia , lookup
Nutriepigenomics wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Quantitative trait locus wikipedia , lookup
Genomic library wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Human genetic variation wikipedia , lookup
Non-coding DNA wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Minimal genome wikipedia , lookup
Helitron (biology) wikipedia , lookup
Human genome wikipedia , lookup
Genetic engineering wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Human Genome Project wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Public health genomics wikipedia , lookup
Genome editing wikipedia , lookup
Genome evolution wikipedia , lookup
History of genetic engineering wikipedia , lookup
Genome (book) wikipedia , lookup
Personal Genome Project Study Guide Welcome to the Personal Genome Project Study Guide Website Here you will find lessons and practice tests to help you pass the Personal Genome Project (PGP) entrance exam. The PGP is a project from Harvard Medical School. In 2001, the Human Genome Project published a working draft of the human genome sequence, thus providing unprecedented advances in our knowledge of how a human works. The PGP makes sequencing personal. Just like the personal computer brought information technology to individuals, the PGP brings DNA sequencing to individuals. To enroll in the project, participants must pass an entrance exam. The Alan and Priscilla Oppenheimer Foundation developed the Personal Genome Project Study Guide to help people pass the exam. Personal Genome Project Study Guide The Personal Genome Project (PGP) is a project from Harvard Medical School that is sequencing key pieces of the DNA of its volunteers and publishing the results with extensive information about the volunteers' traits and medical history. The data are being made available on the Internet so that researchers can test hypotheses about the relationships among genes, traits, and environment. Harvard hopes to enroll 100,000 participants from the general public in the project. To enroll, participants must pass an entrance exam that tests basic genetics literacy, informed consent expertise, and knowledge about the rights and responsibilities of human research subjects. Personal Genome Project Study Guide The goal of this study guide is for you to pass the PGP entrance exam so that you can give truly informed consent to participate in the PGP. The entrance exam has six major topics. The study guide has a part for each of those topics. Click on a part button to the left to study the topics. Each part has one or more lessons and practice tests. It is recommended that you study the parts in order, but that's not absolutely necessary. If you already know some of the subjects, for example, you could skip ahead. Personal Genome Project Study Guide Question: Where do I take the actual PGP entrance exam? Answer: Information about registering for the actual exam is available here. Question: What is the passing score for the entrance exam? Answer: As of this writing, the passing score is 100%. Question: Where can I find more information about the policies and procedures of the PGP? Answer: More information is available here. Question:How many questions does the entrance exam have? Answer: About 60 Question: What types of questions are on the entrance exam? Answer: Multiple-choice, matching, and true/false. Most of the multiple-choice questions are the classic type that you probably remember from school where you had to select one correct answer out of choices A, B, C, and D. In some of the multiple-choice questions, however, you may be asked to select multiple correct answers. Question: Why do I have to take an exam to participate in the PGP? Answer: The PGP takes informed consent very seriously and believes that an exam is the best way to ensure that you have the knowledge necessary to understand the benefits and risks associated with participating in the project. Question: I missed a question on a PGP Study Guide practice test, but I think I should have gotten it right. Where can I send feedback regarding the study guide? Answer: You can send feedback to pgpstudy at oppenheimerfoundation dot org. Personal Genome Project Study Guide For questions about the study guide, or to send feedback about the study guide, please send email to: pgpstudy at oppenheimerfoundation dot org For questions about the PGP, please send email to: general at personalgenomes dot org For questions about the Alan and Priscilla Oppenheimer Foundation, please send email to: info at oppenheimerfoundation dot org Personal Genome Project Study Guide The Personal Genome Project Study Guide was developed by a set of dedicated professionals on behalf of the Alan and Priscilla Oppenheimer Foundation. The Foundation would like to thank the Personal Genome Project of Harvard Medical School, and especially Jason Bobe, for the opportunity to work on the project. The Foundation would also like to thank Kathleen Page, Joan O. Weiss, Grace Richter, Linda Sturgeon, and many others who provided valuable advice and support. All writing Copyright (c) 2009 Alan and Priscilla Oppenheimer Foundation Personal Genome Project Study Guide Kathleen Page, Ph.D., is the author of the bulk of the lessons in the Study Guide. Dr. Page earned her B.A. in 1978 from the Department of Biochemistry, University of California, Berkeley; her M.A. in 1981 from the Department of Biological Sciences, University of California, Santa Barbara; and her Ph.D. in 1988 from the Department of Microbiology and Immunology, University of California, Los Angeles. Dr. Page's current research interests involve the isolation and identification of bacteria associated with environmentally-damaging acid mine drainage. Personal Genome Project Study Guide Joan Oppenheimer Weiss, M.S.W., is the author of the Genetics and Society lessons. Ms. Weiss was the founder of the Genetic Alliance and is co-author of "Starting and Sustaining Genetic Support Groups", The Johns Hopkins University Press, 1996. Personal Genome Project Study Guide Priscilla Oppenheimer is the Executive Editor for the Study Guide and the author of the Project Literacy lessons. Ms. Oppenheimer works in the computer networking field as a consultant and instructor, and is the author and coauthor of five books on computer networking. Ms. Oppenheimer earned her M.S. in Information Science in 1980 from the University of Michigan and is intrigued by DNA because it's information technology for nature. Personal Genome Project Study Guide Grace Y. Richter, Ph.D., edited and reviewed the lessons and practice tests. Dr. Richter earned her B.A. in Biology in 1986 from Reed College and her Ph.D. in Biology in 1995 from Oregon State University. She currently works for Life Technologies in Eugene, Oregon. Personal Genome Project Study Guide Linda Sturgeon was the Website Designer and Computer Programmer for the Study Guide. Ms. Sturgeon earned her B.S. in Computer Science in 2007 from Southern Oregon University. Ms. Sturgeon has over 20 years experience working in the 3D animation/special effects (games/film), multimedia, publishing, and advertising industries. She is the owner of Sturgeon Advertising, located in Southern Oregon. Personal Genome Project Study Guide Part I: Genetic Material Personal Genome Project Study Guide Part I: Genetic Material Lesson 1: Introduction to Cells, DNA, and Genes Upon completion of this lesson, you will be able to: Recall that genetic information is stored in DNA Explain that different cell types have different functions because different genes are active in different cells Recall that DNA resides in every cell's nucleus Recall that some DNA resides in a cell's mitochondria Explain the relationships among DNA, genes, and chromosomes Explain, in general terms, that genes play a role in determining traits and inherited diseases Personal Genome Project Study Guide Part I: Genetic Material Lesson 1: Introduction to Cells, DNA, and Genes The human body consists of trillions of cells. How do those cells know what function to carry out for your body? Each cell has programs encoded in its DNA. The programs are sets of genes that become activated in different cell types (such as muscle cells versus nerve cells). These programs are permanently embedded in cells, but their activity can be turned up or down according to a person's age, lifestyle, and environment. The programmed information in genes is so critical that slight changes in genes can lead to inherited diseases, or make us more inclined to develop some diseases. Personal Genome Project Study Guide Part I: Genetic Material Muscle cell Lesson 1: Introduction to Cells, DNA, and Genes Different sets of genes are active in different cell types. Although your muscle cells and nerve cells contain the same DNA sequences, they activate different sets of genes to give them different functions. Each cell type runs different programs. Muscle cells activate the genes needed to make muscle fibers. Nerve cells activate the genes needed to make neurotransmitters and connections with other nerve cells. Nerve cell Personal Genome Project Study Guide Part I: Genetic Material Lesson 1: Introduction to Cells, DNA, and Genes Different sets of genes are active during different times of a person's life. The human body develops from the time of fertilization to old age. The changes that occur in our bodies as we develop are often due to changes in gene activities that are regulated by our stage of development. This is known as developmental gene regulation. Different sets of genes are turned on and off as we develop and age. For the most part, the genes themselves remain constant. Personal Genome Project Study Guide Part I: Genetic Material Lesson 1: Introduction to Cells, DNA, and Genes Sets of genes encode cellular programs, also called cellular activities. Genes are made of DNA. DNA is the abbreviation for the chemical deoxyribonucleic acid. DNA is a very long molecule. It looks like two strands wrapped around each other, resembling a twisted ladder or double helix. DNA is coiled into chromosomes, found in the nucleus of every cell. There is also a little bit of DNA in another part of cells, organelles called mitochondria. Personal Genome Project Study Guide Part I: Genetic Material Lesson 1: Introduction to Cells, DNA, and Genes Mitochondria are tiny, almost cell-like structures in the cytoplasm of cells. Mitochondria produce energy for cell functions. They have a small amount of DNA in the form of mitochondrial genes. Only a tiny fraction of human DNA is found in mitochondria. Mitochondrial DNA is transmitted only from mother to child, because the child only inherits its mother's and not its father's mitochondria. Mutations in the mitochondrial DNA sequence can be used to determine maternal lineage. Personal Genome Project Study Guide Part I: Genetic Material Lesson 1: Introduction to Cells, DNA, and Genes The vast majority of a cell's DNA is within the nucleus, a large compartment that contains chromosomes and enzymes needed for the function of DNA as a cellular blueprint. In the nucleus, DNA can be copied into more DNA or copied into RNA, a molecule that carries DNA's programmed information outside the nucleus for the purpose of making the proteins needed for cellular activities. Each gene is a section of DNA that has the information needed to make a protein. Personal Genome Project Study Guide Part I: Genetic Material Lesson 1: Introduction to Cells, DNA, and Genes Genes play a role in human disease. Some diseases are caused by a mutation (an alteration) in the DNA sequence of a single gene. In these cases a single protein is altered, and that is enough to cause disease. Some diseases are caused by infection or damaging environments. Many diseases have complex causes that involve multiple genetic mutations and/or environmental factors. Muscular dystrophy is an example of a disease caused by a mutation in a single gene. Asthma is an example of a disease with complex causation. Personal Genome Project Study Guide Part I: Genetic Material Lesson 1: Introduction to Cells, DNA, and Genes Muscular dystrophy, a muscle-wasting disorder, is caused by mutations in the DMD gene. The DMD gene codes for a protein called dystrophin that is necessary for muscle cells to maintain their shape. When this protein is missing, muscle cells literally burst as material from outside the cell membrane leaks in, raising cell pressure. Mutations in the DMD gene can cause Duchenne muscular dystrophy or its milder form, Becker muscular dystrophy. People who are born with muscular dystrophy experience gradual, severe muscle loss and become unable to walk by age 10. Sequencing the DMD gene can reveal who will develop muscular dystrophy. Striated muscle Personal Genome Project Study Guide Part I: Genetic Material Lesson 1: Introduction to Cells, DNA, and Genes Asthma is caused by a complex set of genes and environmental factors. Asthma is a chronic lung disease that causes a person's airways to tighten and inflame when exposed to different irritants or triggers. Asthma is complicated because it is affected by the environment a person lives in and mutations in at least five different genes. People with asthma have different kinds of mutations in these genes. Asthma runs in families, but because of its complex nature it is not yet possible to predict who will develop the disease. DNA sequencing can only reveal who might be at increased risk, and even then, the risk factor cannot yet be calculated. This disease is caused by both genetic and environmental factors. Personal Genome Project Study Guide Part I: Genetic Material Lesson 1: Introduction to Cells, DNA, and Genes The video and animation from the National Human Genome Research Institute (NHGRI) called "Our Molecular Selves" is a great introduction to the role our genome plays in shaping who we are. The NHGRI, which is part of the U.S. National Institutes of Health (NIH), developed the Human Genome Project in collaboration with the U.S. Department of Energy. The video can be viewed at http://www.genome.gov/25520211. Personal Genome Project Study Guide Part I: Genetic Material Lesson 1: Introduction to Cells, DNA, and Genes Practice Test Question 1: Genes have __________ that act(s) as a blueprint for the making of __________ . A. A chromosome/cellular activities B. DNA codes/protein C. Cellular activities/chromosomes D. DNA/chromosomes Question 2: The human body has many different cell types. Nearly all cell types in the same individual have the same __________ . A. Proteins B. Cellular activities C. Functions D. DNA sequences Question 3: As we grow and mature, our genes __________ . A. Disintegrate B. May increase or decrease their level of expression or activity C. Gradually decrease their level of expression D. Gradually turn into protein Question 4: Mitochondria are A. The structure that houses the chromosomes B. The structure that produces energy for cells C. A type of DNA D. Proteins Question 5: Which statement about genes and human disease is most accurate? A. Knowing the DNA sequence of all your genes is sufficient information to predict the occurrence of any genetic disease. B. Genetic diseases are most reliably predicted by family history rather than DNA testing. C. Whereas some genetic diseases can be predicted based on the presence of a particular gene sequence, other genetic diseases are too complex to be predictable at this time. D. Environmental factors have more influence than gene sequence on disease occurrence. Submit Reset Personal Genome Project Study Guide Part I: Genetic Material Lesson 2: The Structure of DNA Upon completion of this lesson, you will be able to: Recognize the DNA double helix structure and its main components Match vocabulary words to their definitions, including DNA, double helix, nucleotide, base pair, gene, intergenic region, genome, and chromosome Estimate the amount of genetic material in a typical human cell in terms of the number of base pairs, genes, and chromosomes Estimate the level of similarity in the DNA of humans Personal Genome Project Study Guide Part I: Genetic Material Lesson 2: The Structure of DNA The information in DNA is stored as a code made of four chemical bases: adenine (A), guanine (G), cytosine (C), and thymine (T). This system of encoding information is very similar to the way a sequence of letters encodes a meaningful sentence. A single strand of DNA is made of the bases (or letters) A, C, G, and T: ATGCTCGAATAAATGTGAATTTGA The letters make a code for the building blocks of proteins. You can think of these as words: ATG CTC GAA TAA ATG TGA ATT TGA The words combine in a long string to make the code for complete proteins. You can think of these as sentences: <ATG CTC GAA TAA GCC CAT CCC TGA> <ATG TGA AAA TGT GGG ATT TGA> These "sentences" are protein-coding DNA sequences called genes. Genes are the blueprint for cellular production of proteins. Proteins are required for the structure, function, and regulation of the body's cells, tissues, and organs. Personal Genome Project Study Guide Part I: Genetic Material Lesson 2: The Structure of DNA The DNA duplex molecule, also called the double helix, consists of two strands that wind around each other. The strands are held together by chemical attraction of the bases that DNA is made of. A bonds to T and G bonds to C. The bases are linked together to form long strands by a "backbone" chemical structure. The DNA bases and backbone twist around to make a duplex spiral. The backbone structure is shown in orange and yellow. The bases are shown as sticks and the backbone structure is shown as ribbons. Personal Genome Project Study Guide Part I: Genetic Material Lesson 2: The Structure of DNA The association of DNA bases on two strands, A:T and C:G, is called base pairing. The two strands of DNA are complementary. Knowing the base sequence of one strand automatically provides the sequence of the other strand. The duplex DNA of the human genome consists of about 3 billion base pairs, and about 99.9 percent of those bases are the same in all people. Personal Genome Project Study Guide Part I: Genetic Material Lesson 2: The Structure of DNA Individual DNA bases are also called nucleotides. Technically speaking, a nucleotide is a DNA base plus its backbone segment. The terms base and nucleotide are often used interchangeably. For example, an alteration (mutation) in DNA sequence can be called a base substitution or a nucleotide substitution. Adenine base, the letter "A" in DNA sequences Adenine nucleotide, the letter "A" in DNA sequences plus its backbone segment Personal Genome Project Study Guide Part I: Genetic Material Lesson 2: The Structure of DNA The human genome has 3 billion base pairs (equivalent to 6 billion bases total). The genome is divided into 22 regular (autosomal) chromosomes, two different kinds of sex chromosomes (X and Y), and a tiny amount of DNA that resides in mitochondria (see Lesson 1). The chromosomes vary in size and in the number of genes they encode. The Y chromosome is the smallest, with about 50 million base pairs and 200 genes. Chromosome 1 is the largest, with about 240 million base pairs and 3000 genes. The total number of genes in the human genome is estimated at 20,00025,000. Personal Genome Project Study Guide Part I: Genetic Material Lesson 2: The Structure of DNA Women have, normally, two copies of every chromosome except the Y chromosome. Women do not have the Y chromosome. Men have, normally, two copies of every regular (autosomal) chromosome and only one copy each of the X and Y chromosomes. Humans have a total of 46 chromosomes inside nearly all of their cells. There are 22 paired autosomal chromosomes and a pair of sex chromosomes, making 23 pairs of chromosomes. Because the genes are the same on each pair of autosomal chromosomes, we have a backup copy of most of our genes. Each different kind of chromosome is colored differently in this diagram of the chromosomes found in a woman. The two X chromosomes (pink) are in the lower right corner. Personal Genome Project Study Guide Part I: Genetic Material Lesson 2: The Structure of DNA Only some of the DNA in chromosomes encodes genes. Most of the DNA sequences in the human genome are seemingly useless because they do not contain any information needed to produce proteins. These noncoding DNA sequences are interspersed between coding sequences (genes) and are called intergenic regions. Personal Genome Project Study Guide Part I: Genetic Material Lesson 2: The Structure of DNA Lesson 2: The Structure of DNA For a more in-depth look at chromosome structure watch the video "Chromosome 11 flyover" narrated by Doug Thomas. http://www.dnalc.org/ddnalc/resources/chr11a.html Personal Genome Project Study Guide Part I: Genetic Material Lesson 2: The Structure of DNA Practice Test Question 1-11: Type in the letter of the most appropriate phrase (on the right) to match the terms below 1. Double helix 2. Gene 3. Intergenic region 4. Autosomal chromosomes 5. X and Y chromosomes 6. Base pairs 7. Nucleotide 8. Genome 9. Nucleus 10. Mitochondria 11. Protein Question 12: About how many genes are in the human genome? Question 13: Does most of the DNA in the human genome code for protein? (Y/N) Question 14: How many chromosomes does a typical human cell have, in total? Question 15: Which human chromosome is absent in females? a. b. c. d. e. f. g. h. i. j. k. DNA that encodes a protein Product of gene expression House(s) most of the cell's DNA House(s) a small fraction of the cell's DNA All of the cell's DNA Duplex DNA DNA not involved in coding for protein Sex chromosomes Present as matched pairs in both men and women A base plus backbone structure 3 billion in the human genome Question 16: What percentage of base pairs are the same in every person? Provide your answer with one number after the decimal point. (Example: 15.9) Submit Reset Personal Genome Project Study Guide Part I: Genetic Material Lesson 3: DNA's Role in Determining Your Traits Upon completion of this lesson, you will be able to: Recognize that both genes and environment play a role in defining a person's traits Recall that most human DNA sequence variation is in the form of single nucleotide polymorphisms (SNPs) Explain the relationship among genes, alleles, genotypes, and phenotypes Explain that variations in DNA sequence result in different versions of genes within the human population Match vocabulary words to their definitions, including trait, allele, genotype, phenotype, single nucleotide polymorphism (SNP), genetic potential, and penetrance Personal Genome Project Study Guide Part I: Genetic Material Lesson 3: DNA's Role in Determining Your Traits The genome sequence of each person is unique, with the exception of identical twins. Although the frequency of base pair substitutions between different individuals is only 0.1%, obvious differences in physical traits are seen from person to person. A trait is an observable characteristic of a person, such as height or temperament. Genes encode proteins that direct the cells in our body to develop certain traits. The environment we live in also influences the development of traits. For example, your DNA may encode proteins that allow you to grow tall, but poor nutrition, certain infections, and traumatic accidents may prevent you from ever becoming tall. Personal Genome Project Study Guide Part I: Genetic Material Lesson 3: DNA's Role in Determining Your Traits A typical human gene has about 1000 base pairs that code for one protein. On average, we expect that one of the base pairs in any gene would vary in at least 1% of people. This kind of variation is called a single nucleotide polymorphism or SNP for short. "Poly" means many and "morphism" means form. A polymorphic DNA sequence is a sequence that has more than one form in different people. A SNP is a location along a genomic sequence that varies from person to person. SNPs are responsible for many of the different traits we observe among people. You inherit your SNPs from your parents. Everyone has thousands of SNPs, but they are not found in all genes. Personal Genome Project Study Guide Part I: Genetic Material Lesson 3: DNA's Role in Determining Your Traits When a particular gene occurs in slightly different forms (sequences) in some people, the gene is said to be polymorphic. Most gene polymorphisms do not produce new traits, although some of them do. For example, the gene that encodes the ABO blood type trait is polymorphic; it has several SNPs and over 180 sequence variants. But all variants can be classified into the 3 groups, A, B, and O. In this example, there are 3 blood group traits. The trait is determined by a single gene that has SNPs. The SNP variants are classified into 3 different classes of alleles. An allele is a variant form of a gene that produces variation in a trait. Most human genes have a single known allele; the traits they produce appear the same in everyone. Personal Genome Project Study Guide Part I: Genetic Material Lesson 3: DNA's Role in Determining Your Traits Biomedical researchers are still in the early stages of learning about SNPs. Although most SNPs do not produce noticeable physical changes in people, some SNPs predispose people to particular diseases. Our understanding of the relationships between SNPs and traits is certain to increase greatly over the next few years. SNPs = Polymorphisms Genes have many polymorphisms but few alleles. Variant alleles cause variant traits. Personal Genome Project Study Guide Part I: Genetic Material Lesson 3: DNA's Role in Determining Your Traits Interestingly, genes were known to have allelic variation long before any DNA sequences were determined. This is because some traits were known to vary according to rules of gene inheritance, such as the color of petals in the pea plant, as shown in the graphic on the right. Geneticists often use the terms "genotype" and "phenotype" when referring to alleles and traits. Genotype is defined as the alleles present in an individual's genome. Phenotype is defined as the traits present in an individual. Personal Genome Project Study Guide Part I: Genetic Material Lesson 3: DNA's Role in Determining Your Traits Penetrance is defined as the percentage of individuals carrying a particular allele who also express the particular trait associated with that allele. For example, 95% of people who have the allele for Huntington's disease actually develop the trait (the disease) known as Huntington's. Other genes have alleles with high penetrance as well. An example is the ability to taste the bitter compound PTC. There are two alleles for the PTC gene, taster and non-taster. The taster allele shows almost 100% penetrance. This means that almost everyone who has the taster allele has the trait of being able to taste the compound PTC as bitter. Many genes have alleles with low penetrance. An example is the HLA gene allele DR4. 20% of people who have the DR4 allele develop rheumatoid arthritis as they age. Personal Genome Project Study Guide Part I: Genetic Material Lesson 3: DNA's Role in Determining Your Traits Because most traits are influenced by several genes and environmental factors, it is not possible to predict all the traits that will develop in an individual, even when the person's genotype is known. In addition, the low penetrance of many alleles means that only a low percentage of people with any particular allele will have the associated trait. The term genetic potential is used to describe the information in a person's genome (their genotype) that could produce particular traits if environmental factors were favorable for the development of those traits. For example, if a person has the DR4 allele, they have the genetic potential to develop rheumatoid arthritis, but other factors in addition to that allele must come into play before the disease will occur. Most of us have the genetic potential to produce strong muscles and a lean body, but those traits typically do not appear unless a fitness program and diet regime are followed. Another common way of describing the influence of alleles on traits is to determine the risk that a particular allele has on development of a particular disease. For example, about 2% of adults over age 50 have rheumatoid arthritis. About 20% of people over age 50 with the DR4 allele have rheumatoid arthritis. Although most people with DR4 do not get rheumatoid arthritis, if you have DR4, you are ten times more likely to get the disease than if you do not have DR4. Personal Genome Project Study Guide Part I: Genetic Material Lesson 3: DNA's Role in Determining Your Traits Practice Test Question 1: All genes have ______ A. At least one allele B. Multiple alleles C. SNPs D. Genotypes Question 2: The existence of multiple alleles of a particular gene A. Always results in mutation of the genome B. Indicates that multiple phenotypes may be possible C. Indicates a high SNP frequency in the gene D. Increases the penetrance of the alleles Question 3: The higher the penetrance of an allele A. The more common it is among people B. The more variation it has in its sequence C. The more likely it is to result in a variant trait D. The more likely it is to result in a favorable trait Question 4: Type in the letter of the most appropriate phrase (on the right) to match the terms below 1. Trait 2. Allele 3. Genotype 4. Phenotype 5. SNP 6. Genetic potential 7. Penetrance Submit Reset Personal Genome Project Study Guide Part II: Gene Transmission Personal Genome Project Study Guide Part II: Gene Transmission Lesson 4: Gene Expression and Personal Traits Upon completion of this lesson, you will be able to: Recall that humans have two copies of most genes, except for those found on the sex chromosomes Define the terms diploid, haploid, multigenic trait, dominant allele, recessive allele, homozygous, heterozygous, and co-dominance Recognize that genes and environment both play a role in determining a person's traits, especially complex traits a. DNA polymorphism b. The likelihood of an observable effect on a trait c. Characteristic d. Gene variant that encodes an observable difference in some individuals e. Theoretically possible outcome of a particular genotype f. The set of characteristics in an individual g. The set of alleles in an individual Personal Genome Project Study Guide Part II: Gene Transmission Lesson 4: Gene Expression and Personal Traits Nearly all cells in the human body contain 46 chromosomes. There are 2 copies of each of the 22 autosomal chromosomes, and 2 sex chromosomes. Women have 2 copies of the X chromosome, the female sex chromosome, whereas men have one X chromosome and one Y chromosome, the male sex chromosome. There are hundreds to thousands of genes on each chromosome. Because there are 2 copies of the autosomal chromosomes, there are two copies of each gene present on them. If the two gene copies are the same allelic form, the person is said to be homozygous for that gene. If there are different alleles present, the person is said to be heterozygous for that gene. For example, everyone has 2 copies of the PTC gene (the gene for tasting the bitter compound PTC). There are 2 different alleles of this gene, the taster allele and the non-taster allele. You might be homozygous for the PTC gene (have 2 of the same alleles) or you might be heterozygous for the PTC gene (have one of each kind of allele). Personal Genome Project Study Guide Part II: Gene Transmission Lesson 4: Gene Expression and Personal Traits When a cell has two sets of chromosomes, it is diploid. Humans cells are generally diploid. When a cell has only one set of chromosomes, it is haploid. Sperm and egg cells are normally haploid. During fertilization, a sperm cell and an egg cell fuse, leading to a diploid embryo. Each parent contributes one of the two sets of chromosomes. Personal Genome Project Study Guide Part II: Gene Transmission Lesson 4: Gene Expression and Personal Traits In diploid cells, each of the two copies of a particular gene can produce a protein. If there are two different alleles present, two slightly different proteins will be made that may influence the development of traits differently. Alleles can be categorized as dominant, recessive, or co-dominant. Dominant alleles produce their observable trait, even when a different allele is also present. Recessive alleles produce their observable trait only when no other differing allele is present. That is, the recessive trait can only be observed when both alleles are the same (homozygous). For example, the PTC taster allele is dominant, whereas the PTC non-taster allele is recessive. If you have two copies of the taster allele (homozygous dominant), or if you are heterozygous taster/non-taster, you taste PTC as a bitter. If you are homozygous recessive (non-taster/non-taster), you do not taste PTC as bitter. Personal Genome Project Study Guide Part II: Gene Transmission Lesson 4: Gene Expression and Personal Traits Co-dominant alleles produce their observable trait in combination with differing alleles. Co-dominantly expressed traits may seem like a blend of different traits. The A and B blood group alleles are examples of codominant alleles. If you have one A allele and one B allele (A/B heterozygous), your blood group type will be AB. The O allele is recessive. If you have one A allele and one O allele (A/O heterozygous), your blood group type will be A. Only if you are homozygous recessive O/O will you have O type blood. Personal Genome Project Study Guide Part II: Gene Transmission Lesson 4: Gene Expression and Personal Traits The genetics of traits such as PTC tasting or ABO blood group type are fairly easy to explain because they are influenced by single genes with few alleles. They are monogenic traits. Most human traits are complex because they are influenced by multiple genes, some with several alleles. Traits such as eye color and height are polygenic, complex traits. All of the different genes and alleles that contribute to these traits are not yet known. Geneticists are making steady progress toward understanding how polygenic traits are produced. Genetic diseases and genetic disease susceptibilities that are monogenic can be categorized as dominant, co-dominant, or recessive. For example, Huntington's disease is a monogenic dominant trait. Sickle cell disease is a monogenic co-dominant trait. Cystic fibrosis is a monogenic recessive trait. Many genetic disease susceptibilities are complex, polygenic traits. Inherited susceptibility to cancer or cardiovascular disease can be monogenic or polygenic. In addition, environmental factors greatly influence the risk of developing some diseases. Personal Genome Project Study Guide Part II: Gene Transmission Lesson 4: Gene Expression and Personal Traits Practice Test Question 1: A haploid cell has A. Autosomal chromosomes only B. Two copies of autosomal chromosomes and one sex chromosome C. Sex chromosomes only D. One copy of each autosomal chromosome and one sex chromosome Question 2: Most cells in the human body A. Have 2 copies of each autosomal chromosome and no sex chromosomes B. Have one copy of each autosomal chromosome and no sex chromosome C. Have 2 copies of each autosomal chromosome and two sex chromosomes D. Have 2 copies of each autosomal chromosome and one sex chromosomes Question 3: If you are heterozygous for a gene that has one recessive and one dominant allele, your body is most likely to A. Develop the dominant trait B. Develop a partial version of the dominant trait C. Develop the recessive trait and dominant trait D. Develop the recessive trait Question 4: A polygenic trait is produced by A. A gene that has multiple alleles B. A gene that is present as multiple copies in the genome C. Contributions from multiple different genes D. A gene that is influenced by multiple environmental factors Question 5 - 10: For human blood group types, A and B are codominant alleles whereas O is recessive. Match each genotype to its corresponding phenotype (on the right). Question 5: A/A Question 6: B/B Question 7: O/O Question 8: A/O Question 9: A/B Question 10: B/O Submit Reset Personal Genome Project Study Guide Part II: Gene Transmission Lesson 5: Meiosis Upon completion of this lesson, you will be able to: Distinguish meiosis from mitosis Recognize that meiosis results in the formation of genetically different gametes via independent a. b. c. d. A B O A/B assortment and recombination Relate the following terms to the process of fertilization and heredity: meiosis, mitosis, recombination, autosome, and sex chromosome Recall the number of autosomes and sex chromosomes in sperm, egg, and other cell types Personal Genome Project Study Guide Part II: Gene Transmission Lesson 5: Meiosis To grow tissue and renew cells, existing cells divide by mitosis. The steps of mitosis are: 1. Growth in cell size 2. DNA replication. The chromosomes duplicate themselves so that instead of two copies of every gene per cell (the normal diploid condition), there are 4 copies of every gene. 3. The cell's nucleus dissolves, and the chromosomes distribute themselves into two identical diploid sets at opposite sides of the cell. 4. Two new nuclei form around the sets of chromosomes. 5. The cell splits into two cells, each with its own nucleus and each with a diploid set of chromosomes. Mitosis produces genetically identical cells. Cells in the human body divide by mitosis. The only exception occurs during the production of sperm and egg cells. These cells are produced by meiosis. Personal Genome Project Study Guide Part II: Gene Transmission Lesson 5: Meiosis Sperm and egg cells are produced by meiosis. The steps of meiosis are: 1. Growth in cell size 2. DNA replication. The chromosomes duplicate themselves so that instead of two copies of every gene per cell (the normal diploid condition), there are 4 copies of every gene. 3. The cell's nucleus dissolves and the chromosomes align themselves so that homologous pairs of chromosomes can exchange bits of DNA. 4. The chromosomes distribute into 2 sets of chromosomes at opposite sides of the cell. 5. Two new nuclei form around the sets of chromosomes. 6. The cell splits into two cells, each with its own nucleus and each with two copies of every gene. 7. The cells split again, this time without any new DNA replication. The resulting cells have only one copy of every gene. The differences between meiosis described in steps 3 and 7. Personal Genome Project Study Guide Part II: Gene Transmission Lesson 5: Meiosis During the first cell division in meiosis, two chromosomes of a homologous pair may exchange segments in the manner shown in the diagram, producing new genetic variations in the chromosomes of sperm and egg. The exchange of DNA between chromosomes is called crossing-over and recombination. Recombination produces new genetic variation ensuring that each person is genetically unique (with the exception of identical twins). Personal Genome Project Study Guide and mitosis are Part II: Gene Transmission Lesson 5: Meiosis Comparison of meiosis and mitosis 1. Meiosis produces haploid sperm or egg cells, whereas mitosis produces diploid cells. 2. Meiosis requires two cell divisions, whereas mitosis requires one cell division. 3. During the first cell division of meiosis, the chromosomes duplicate and then pair up so that recombination between homologous chromosomes can occur. This creates new versions of chromosomes that are hybrids of the original maternal and paternal chromosomes. 4. The second cell division of meiosis occurs without any additional chromosome duplication such that the resulting cells only have one of each chromosome. 5. The haploid cells produced by meiosis are genetically unique. Personal Genome Project Study Guide Part II: Gene Transmission Lesson 5: Meiosis Each egg or sperm has half of the DNA of the person who produced it. They all have one copy of each of the 22 autosomes and one sex chromosome. But each of these haploid cells is genetically unique because: 1. The 22 autosomes that they contain are a random mixture of chromosomes from the father and mother of the person who produced the sperm or egg. Some who produced the sperm or egg. Some of the cells have more chromosomes from the mother, some have more chromosomes from the father. This is the concept of independent assortment of chromosomes during meiosis. 2. Crossing over and recombination during meiosis generates new chromosomal variants in every sperm and egg. When a sperm and egg fuse, the resulting embryo will have 44 autosomes and 2 sex chromosomes. Half the DNA is from the father and half the DNA is from the mother. Personal Genome Project Study Guide Part II: Gene Transmission Lesson 5: Meiosis During fertilization, one sperm and one egg fuse to form a diploid embryo. The fertilized egg contains one of each of the 22 autosomal chromosomes (autosomes) from each parent, one X chromosome from the mother and an X or a Y chromosome from the father. Each sperm cell has either an X or a Y chromosome. All eggs have a single X chromosome. Individuals who receive an X chromosome from their father become girls. Individuals who receive a Y chromosome become boys. Boys always receive their X chromosome from their mother. Personal Genome Project Study Guide Part II: Gene Transmission Lesson 5: Meiosis Practice Test Question 1: A single round of mitosis produces ____ cells and a single round of meiosis produces _____ cells. A. 4/4 B. 2/4 C. 4/2 D. 4/8 Question 2: Which of the following occurs during the first cell division of meiosis but does not occur during mitosis? A. The nucleus dissolves. B. The DNA replicates. C. Pairs of chromosomes exchange DNA. D. Flagella appear. Question 3: The genetic makeup of any person is such that A. 23 of their chromosomes are from their mother and 23 of their chromosomes are from their father. B. 22 of their chromosomes are from their mother, 22 of their chromosomes are from their father, and their sex chromosome is randomly contributed. C. A random number of chromosomes are from each parent with a total of 46 chromosomes present in each cell. D. The sex chromosomes are from the father and the autosomes are from the mother. Question 4: Males have an X and a Y chromosome. They always get their X chromosome from their mother and their Y chromosome from their father. A. True B. False Question 5: Females have two X chromosomes and A. One is always from their mother and one is always from their father. B. Both X chromosomes are from their mother. C. Random chance determines if one or both X chromosomes are from their mother. Submit Reset Personal Genome Project Study Guide Part II: Gene Transmission Lesson 6: Heredity Upon completion of this lesson, you will be able to: Determine the likelihood that a child will inherit an autosomal dominant trait from one parent, and how that differs from the likelihood of inheriting an autosomal recessive trait Explain what it means to be a carrier of a trait Explain what an X-linked disease is, and why Xlinked diseases are more common in males Explain why the likelihood of inheriting a complex, polygenic trait is not currently possible to calculate Personal Genome Project Study Guide Part II: Gene Transmission Lesson 6: Heredity The diagram displays the chromosomes present in a male. There are two of each autosomal chromosome and two different sex chromosomes. There are two copies of every autosomal gene and one copy of each sex-linked gene. Because one of each type of chromosome came from each parent, there are likely to be different alleles present for many of the genes on the autosomes. The alleles may be dominant, recessive, or co-dominant. Dominant and co-dominant alleles produce observable traits when only one copy of the allele is present. Recessive alleles only produce traits when no dominant alleles are also present. Personal Genome Project Study Guide Part II: Gene Transmission Lesson 6: Heredity A dominant trait that is encoded by a single gene (monogenic trait) is passed on to offspring according to the rules of Mendelian genetics. For example, if the father of a family has elevated blood cholesterol even when he follows a very strict diet and does not eat any cholesterol-containing foods, he very likely has a "hypercholesterolemia" allele for a gene called LDL-R. The allele is dominant, so he has the trait even though he also has a normal LDL-R allele. On average, the father will pass the hypercholesterolemia allele and the high-cholesterol trait on to half his children as shown in the diagram. Because the gene is autosomal (located on an autosome, not a sex chromosome), his daughters and sons are equally likely to inherit the trait. By random chance, none, all, or some of his offspring will inherit the trait, but the probability of passing on this trait, for each child, is 50%. Personal Genome Project Study Guide Part II: Gene Transmission Lesson 6: Heredity A recessive trait that is encoded by a single gene (monogenic trait) is also passed on to offspring according to the rules of Mendelian genetics. For example, if the father and mother of a family each have a cystic fibrosis allele and a normal allele for the CFTR gene, they are not affected by the disease cystic fibrosis, but they are both genetic carriers of the disease. The allele is recessive, so the presence of a normal allele prevents the disease. On average, each parent will pass the cystic fibrosis allele on to half of his or her children as shown in the diagram. There is a 50% probability that a child will receive one normal and one cystic fibrosis allele. These children will not have cystic fibrosis, but they will be genetic carriers. There is a 25% probability that a child will receive two normal alleles. These children will not have cystic fibrosis or be carriers. There is a 25% probability that a child will receive two cystic fibrosis alleles. These children will develop cystic fibrosis. Personal Genome Project Study Guide Part II: Gene Transmission Lesson 6: Heredity In males, the sex chromosomes are present as a single copy of each. This means that recessive traits that are encoded on the X chromosome are much more likely to appear in males than females. These are called X-linked traits. There are over 1000 genes on the X chromosome. They encode information needed for traits in both males and females. X-linked genes are responsible for diseases such as hemophilia, red-green color blindness, muscular dystrophy, and fragile-X syndrome. Males get these diseases far more often than females because they are recessive traits. Females get X-linked diseases when they inherit 2 recessive alleles from their parents. Females who have one recessive X-linked disease allele are carriers. They are not affected by the disease but they can pass the trait on to their sons. Inheritance of common hemophilia, an X-linked recessive disorder Personal Genome Project Study Guide Part II: Gene Transmission Lesson 6: Heredity If a man has an X-linked recessive disorder and his mate does not carry the allele for it, 100% of their daughters will be carriers. None of their sons will inherit the allele. Males always get their X chromosome from their mothers. Only females receive an X chromosome from their fathers (in addition to the one they receive from their mothers). If a woman is a carrier of an X-linked recessive allele for a disorder and her mate does not have it, their sons will have a 50% probability of inheriting the disorder. None of their daughters will have it, but they will have a 50% probability of being carriers. X-linked dominant disorders are extremely rare, as are Y-linked disorders. The Y chromosome encodes only 89 functional genes, mostly involved in masculine characteristics and fertility. Personal Genome Project Study Guide X Y XX g irls are XX, boys are XY X Y XX g irls are XX or XX, boys are XY or XY Part II: Gene Transmission Lesson 6: Heredity Many human traits are influenced by more than one gene. In addition, environmental factors such as lifestyle, infectious diseases, and accidents influence traits. Traits that are the result of multiple genetic and environmental factors are called complex traits. The inheritance of complex traits cannot be predicted according to the rules of Mendelian genetics. As outlined below, geneticists do not yet understand all of the variables involved in complex traits. The number of different genes that contribute to complex traits is difficult to determine. For example, at least four genes are likely to be involved in skin color, but there may be more. The relative contribution of each gene and each allelic variant to the expression of a trait is usually unknown. Environmental factors regulate the activity of some genes. For example, exposure to sunlight causes skin pigment-producing cells to increase gene expression, leading to increased pigment production and darker skin. Some environmental factors have a greater influence on trait development than genes do. For example, although there is a genetic component to obesity, amount of food intake is the most important factor that controls the development of obesity. Personal Genome Project Study Guide Part II: Gene Transmission Lesson 6: Heredity Practice Test Question 1: What is the likelihood that a monogenic, autosomal dominant trait will appear in a child whose mother does not carry the trait and a father who is heterozygous for the trait? A. 25% B. 50% C. 75% D. 100% E. 0% Question 2: What is the likelihood that a monogenic, autosomal recessive trait will appear in a child whose mother does not carry the trait and a father who is a heterozygous carrier? A. 25% B. 50% C. 75% D. 100% E. 0% Question 3: What is the likelihood that the son of a man who is not color-blind and a woman who carries an allele for red-green color blindness (an X-linked recessive disorder) will be colorblind? A. 25% B. 50% C. 75% D. 100% E. 0% Question 4: If a woman who carries an allele for red-green color blindness and a man who is red-green color-blind have a daughter, what is the likelihood that she will be color-blind? A. 25% B. 50% C. 75% D. 100% E. 0% Question 5: If both parents are obese (a complex trait), what is the likelihood that their child will be obese? A. 100% B. 50% C. Cannot be calculated Submit Reset Personal Genome Project Study Guide Part III: Gene Expression Personal Genome Project Study Guide Part III: Gene Expression Lesson 7: Coding for Proteins Upon completion of this lesson, you will be able to: Recall that genes store information in a threeletter code Define the terms transcription, translation, and protein, and explain the relationships among these terms Explain why proteins are important to the functioning of the human body Recognize that the action of several proteins is often required to produce an observable trait Recall that genes code for proteins, and that mRNA functions as a copy of a gene's sequence and codes for proteins Distinguish between a genome and an exome Personal Genome Project Study Guide Part III: Gene Expression Lesson 7: Coding for Proteins DNA encodes information using groups of three bases called codons. There are 4 different bases in DNA: A, C, G, and T. These bases can be combined into 4 3 , or 64, different triplets. Each triplet codon codes for an amino acid. Amino acids are the building blocks of proteins. All proteins are made by stringing amino acids together into long chains. There are 20 different amino acids. Although there are 64 possible codons, many code for the same amino acid. Personal Genome Project Study Guide Part III: Gene Expression Lesson 7: Coding for Proteins Proteins are a class of molecules that carry out a tremendous variety of functions in cells. Proteins are made as linear chains of amino acid that fold into specific shapes. Proteins build physical structures in cells. For example they are the primary components of our muscle fibers, skin, and hair. Proteins direct the formation of our skeletons and other body features during our development. Many hormones are proteins. In addition, the synthesis of non-protein hormones is directed by proteins. Proteins function as enzymes that carry out chemical conversions of all sorts of molecules. For example, enzymatic proteins are responsible for converting the food we eat into energy or fat. Cells make thousands of different kinds of proteins. The development of normal traits requires the proper functioning of many different proteins. Personal Genome Project Study Guide Part III: Gene Expression Lesson 7: Coding for Proteins Some traits result when a single protein is defective. An example is a specific type of dwarfism called achondroplasia. When a gene called FGFR3 is mutated, a codon changes and an altered protein is made. This defective protein causes less than the normal amount of cartilage and bone growth, leading to very short stature. Normal human height, on the other hand, is a complex trait that is influenced by the protein products of several different genes, including several growth factor genes, growth factor receptor genes, sex hormone genes, bone proportion genes, and genes that regulate development. A continuous range of normal human height is observed because the DNA sequences of these genes vary among people, leading to greater or lesser function of each of the different proteins. Geneticists estimate that height is primarily determined by our genes, but environmental influences, especially nutrition, also affect height. Personal Genome Project Study Guide Part III: Gene Expression Lesson 7: Coding for Proteins The process of making a protein using the code found in DNA can be divided into two steps, transcription and translation. Transcription is the conversion of the DNA code into an mRNA code. mRNA is a molecule similar to DNA except that it is single-stranded rather than double-stranded and it uses a base called "U" where DNA uses "A". Transcription is the synthesis of an mRNA molecule that is complementary in sequence to the DNA being used as the template. Translation is the synthesis of protein using mRNA as a template. Personal Genome Project Study Guide Part III: Gene Expression Lesson 7: Coding for Proteins DNA stays inside the nucleus of cells (except during mitosis and meiosis). mRNA is made in the nucleus and then travels to the cytoplasm of the cell where it binds to a structure called a ribosome that conducts the process of protein synthesis based on the sequence of codons in mRNA. The basics of transcription and translation are reviewed in the video "Our Molecular Selves" from the National Institutes of Health. More advanced animations of the processes of transcription and translation can be viewed at the Molecular and Cell Biology Learning Site: Transcription animation and Translation animation. Personal Genome Project Study Guide Part III: Gene Expression Lesson 7: Coding for Proteins Only a small fraction of the DNA in chromosomes encodes proteins. Most of the DNA sequences in the human genome seemingly do not contain any information needed to produce proteins. Noncoding DNA sequences that are interspersed between genes are called intergenic regions. Personal Genome Project Study Guide Part III: Gene Expression Lesson 7: Coding for Proteins Non-protein-coding DNA sequences that are interspersed within genes are called introns. Introns are transcribed into mRNA along with coding sequences, but must be removed before the mRNA can be used for protein synthesis. Intron removal from mRNA Exons are protein-coding DNA sequences within genes. The newly coined term exome refers to the protein-coding DNA sequences of the genome. The exome constitutes about 1.5% of the human genome. Because the exome contains all the protein information about the genome, it is considered the most important and most interpretable part of the genome. Whereas 3 billion bases must be sequenced to yield a complete genome sequence, only about 45 million bases need to be sequenced to yield a person's exome. Introns and exons in genes Personal Genome Project Study Guide Part III: Gene Expression Lesson 7: Coding for Proteins Although knowledge about one's personal exome sequence is now within reach, the effects of most DNA sequence variation are still not known. One of the goals of the Personal Genome Project is to develop tools to interpret exome sequence information and correlate variant sequences with related personal medical and biological information. Personal Genome Project Study Guide Part III: Gene Expression Lesson 7: Coding for Proteins Practice Test Question 1: How many DNA base pairs are needed to encode a protein that is 20 amino acids long? A. 20 B. 40 C. 60 D. 80 E. More than 100 Question 2: The process of using mRNA as a template to produce a protein is known as A. Transcription B. Translation C. Translocation D. Intron Question 3: The function of proteins is A. To build cellular structures B. To act as hormones C. To mediate chemical conversions D. All of the above Question 4: The variation seen in a complex trait such as height A. Is not due to variations in genetic make-up B. Is partly explained by DNA sequence variations in several different genes C. Can be entirely explained by variations in growth hormone genes D. Is explained by variation in amounts of structural proteins produced in different people Question 5: Variations in the DNA sequences of intergenic regions do not affect the sequence of amino acids in proteins. A. True B. False Question 6: If all the exome sequence variation present in an individual were determined, most of the individual's disease risks would be revealed. A. True B. False Submit Reset Personal Genome Project Study Guide Part IV: Gene Regulation Personal Genome Project Study Guide Part IV: Gene Regulation Lesson 8: Controlling Protein-Coding Genes Upon completion of this lesson, you will be able to: Define gene regulation Recognize that alterations in gene regulation can influence the development of traits and disease Explain that the expression of any particular gene may be influenced by other genes and by the environment Interpret information from genetic tests Personal Genome Project Study Guide Part IV: Gene Regulation Lesson 8: Controlling Protein-Coding Genes The term gene regulation refers to the process of increasing or decreasing the production of protein products from genes. To begin gene expression, mRNA is produced from genes (recall that this process is called transcription). mRNA is then translated into protein in the cytoplasm. By increasing the amount of mRNA that is produced from any particular gene, the amount of that particular protein product can be increased. Most genes are regulated by turning transcription on or off, and by subtle increases or decreases in transcription. Personal Genome Project Study Guide Part IV: Gene Regulation Lesson 8: Controlling Protein-Coding Genes The expression of many genes remains completely inhibited in most cell types. The DNA in human cells includes over 20,000 genes, but only a subset of these genes are transcribed in any particular cell type. Different cell types express different sets of genes, meaning that they transcribe some genes into mRNA, and not others. Different cell types have very different sets of proteins in them, causing them them to look and function very differently. Furthermore, cells regularly turn gene expression up or down, depending on cellular needs and environmental signals. Human brain Cells Human blood cells Personal Genome Project Study Guide Part IV: Gene Regulation Lesson 8: Controlling Protein-Coding Genes Cells regulate the level of expression of each gene so that the correct amount of protein will be made. Defects in gene regulation cause too little or too much of a particular protein to be made. Defects in gene regulation can affect traits. For example, if you make too little hemoglobin, you will have the trait of anemia. Hemoglobin Personal Genome Project Study Guide Part IV: Gene Regulation Lesson 8: Controlling Protein-Coding Genes The four main causes of gene regulation defects are: 1. Mutations in the DNA sequence near the start point of gene transcription. 2. Mutations in genes that code for proteins that regulate transcription. 3. Mutations that duplicate or delete genes so that the number of copies of a particular gene changes. 4. Exposure to environmental factors that alter normal patterns of gene expression. Personal Genome Project Study Guide Part IV: Gene Regulation Lesson 8: Controlling Protein-Coding Genes Environmental factors can influence gene regulation. For example, when someone becomes infected with a wart virus, the wart virus directs changes in gene transcription that cause the infected cells to grow into a wart. Another example of an environmental influence on gene regulation is stress. Long-term stressful experiences increase the levels of a hormone called cortisol. Cortisol is a gene regulator that increases the expression of several genes, leading to long-term changes in physiology . Personal Genome Project Study Guide Part IV: Gene Regulation Lesson 8: Controlling Protein-Coding Genes It is important to remember that traits can be influenced by alterations in coding sequences and by alterations in gene regulation. In addition, some traits are influenced by a single gene and others are polygenic. Another complicating factor is that the penetrance (the likelihood that a particular allele will actually produce a particular trait) of genetic mutations is often far less than 100%. A DNA test mutations is often far less than 100%. Some environmental factors affect gene regulation and other environmental factors directly affect the development of traits. Personal Genome Project Study Guide Part IV: Gene Regulation Lesson 8: Controlling Protein-Coding Genes Gene regulation plays a role in the interpretation of molecular genetic tests. Because several complex factors affect genes and traits, it is often difficult to predict the likelihood of developing a genetic disease, even when a complete DNA sequence is obtained from all the genes known to influence the disease. However, by taking into consideration all available genetic and environmental information, a medical professional should be able to state if a person is at low risk, average risk, high risk, or very high risk for genetic disease development. Personal Genome Project Study Guide Part IV: Gene Regulation Lesson 8: Controlling Protein-Coding Genes Practice Test Question 1: An increase in gene expression means A. There will be more DNA in the gene. B. The trait associated with the gene will be increasingly obvious. C. There will be more of the protein that is encoded by the gene. D. The likelihood of inheriting the trait will be increased. Question 2: The human body has many different types of cells A. And many types of genomes. B. And each cell type has different genes turned off or on. C. And each cell type is the result of environmental gene regulation. D. All of the above are correct. Question 3: In what way(s) can gene expression be altered? A. A mutation prevents the transcription of a gene. The rod of Asclepius, a symbol for medicine transcription of a gene. Factors in the environment influence gene expression. C. A chromosomal duplication increases gene copy number. D. All of these are ways that gene expression can be altered. Question 4: After complete exome sequencing and analysis, an individual was found to have seven recessive mutations known to cause seven different diseases. The individual was heterozygous for all seven genes; the other alleles were normal. This means that A. The individual has the seven genetic diseases. B. Because the mutations are recessive, none of the diseases is likely to develop. C. There is a high likelihood that at least some of the diseases will develop. D. The diseases can be avoided only if a healthy lifestyle is adopted. Question 5: Several different mutations in the LDL receptor gene are dominant-acting and known to be associated with development of high blood cholesterol and heart disease. If a person has one of these disease-associated mutations A. They will not be at risk for the disease if they have a healthy diet. B. They are at increased risk for the disease but can reduce their risk if they have a healthy diet. C. Regardless of their diet, they will get the disease. D. They are not at risk for the disease unless they do not also have a normal allele. B. Submit Reset Personal Genome Project Study Guide Part V: Genetics and Society Personal Genome Project Study Guide Part V: Genetics and Society Lesson 9: The Benefits of Applying Genetic Technology to Health Care Upon completion of this lesson, you will be able to: List the benefits of genetic testing Differentiate benefits that are available now from ones that are still predicted for the future Distinguish media hype from the truth about genetic technology Personal Genome Project Study Guide Part V: Genetics and Society Lesson 9: The Benefits of Applying Genetic Technology to Health Care As things stand now, the benefits of genetic testing are limited. However, a genetic test may provide people with information that can help them with both their reproductive decisions and health behaviors. Because environment affects genetic expression, a genetic test may also alert individuals to a need to change diet, lifestyle, or physical surroundings. Genetic testing can identify individuals or groups who are at increased risk of disease. Genetic testing can discover whether people have an increased risk of having a child with some types of genetic disorders. There is also genetic testing for the developing fetus to find out if the fetus has such a disorder. Preimplantation diagnostic testing of fertilized embryos is used to ascertain which ones are free of a particular genetic disorder that runs in the family (e.g., cystic fibrosis), and thus suitable for transfer to the mother’s womb. Personal Genome Project Study Guide Part V: Genetics and Society Lesson 9: The Benefits of Applying Genetic Technology to Health Care Many genes and gene markers have been identified for both rare and common diseases, including ovarian and breast cancer and Huntington’s disease. Few of these diseases are treatable or curable, although some may be preventable, such as by a mastectomy when the BRCA-1 or BRCA-2 gene for breast cancer is present. Screening of children who are born with birth defects or have developmental delays indicating a possible genetic condition may lead to appropriate treatment that may enable a normal life for the child. For example, if a child is born with PKU, a metabolic disorder caused by an enzyme deficiency, severe mental retardation can be avoided if the child’s intake of phenylalanine is limited. Even when a genetic disorder is not treatable or curable, a genetic test can be beneficial. For genetic disorders such as Huntington’s disease (HD), whose symptoms emerge late in life, the results of genetic testing can provide an opportunity to make important decisions for the future or lead to a sense of relief at not having the gene. Many people elect not to take the HD test because they would rather not know the result. If a parent gets a diagnosis of HD, the parent needs to consider whether to have his or her children (who each have a 50% chance of inheriting the disease) genetically tested. Even though there may not be treatment available for a genetic disorder, genetic testing can lead to increased surveillance and, in one instance, the symptoms may be treatable. One form of cancer, familial polyposis (which involves initially benign polyps in the large bowel), can be treated by removing polyps as they emerge. Some testing also is being done to discover small changes in a person’s DNA that might indicate a slightly increased risk for such common disorders as heart disease, diabetes, and Parkinson’s disease. Personal Genome Project Study Guide Part V: Genetics and Society Lesson 9: The Benefits of Applying Genetic Technology to Health Care An important component of genetic testing that is currently performed is genetic counseling. Genetic counseling is a process whereby a licensed genetic counselor provides information about results of a genetic test, risks of a genetic disorder occurring in the family, available options for decision making and treatment, and appropriate referrals. One can contact the National Society of Genetic Counselors at http://www.nsgc.org to find a local genetic counselor. Genetic counseling will become even more essential as further advances are made in genetic testing and treatment As the technology develops, future genetic testing will result in additional benefits, including the opportunity for people without a known genetic history of disease to find out what diseases they are likely to get. Other future benefits include the individual tailoring of medications and the development of personalized diets and new lifestyles. The discovery of possible genetic variations can lead to new prevention strategies and treatments. The genomic era may see great progress in prevention of illness, by identifying individuals at high risk of developing diseases. Given a patient’s genetic test results, physicians will be able to take measures to prevent illness instead of waiting until symptoms occur. Future genetic research can enhance our understanding of the interaction of genes and environmental factors to cause diseases. As our understanding of the genetic influences on diseases increases, we will be able to identify individuals' risks and develop new, more efficient drugs. Personal Genome Project Study Guide Part V: Genetics and Society Lesson 9: The Benefits of Applying Genetic Technology to Health Care It is often difficult to distinguish accurate reports in the media about new genetic tests from those that are false or misleading. Factual information often is reported by geneticists or professional organizations, such as the American College of Medical Genetics (http://www.acmg.net). Popular media, on the other hand, often presents over-simplified and sensationalized stories about genetic research and the benefits of genetic testing. Personalized medicine to detect people’s individual health risks and tailor therapies has been around for a long time. However, there are now several companies offering personalized genetic testing directly to consumers, although the activity is unregulated, and some companies do not offer genetic counseling or even use certified laboratories to do the testing. Individuals considering the new genetic testing options need to be able to differentiate between fact and fiction and to weigh benefits and risks to themselves and their families. Personal Genome Project Study Guide Part V: Genetics and Society Lesson 9: The Benefits of Applying Genetic Technology to Health Care Practice Test Question 1: Which of the following is a benefit of genetic testing? (select the best answer) A. Learning one's susceptibility to genetic disorders B. Being able to make reproductive decisions based on the results of genetic testing C. Increasing medical surveillance if D. one tests positive for a disorder or disease All of the above Question 2: Which of the following benefits is most likely to come from future genetic tests? (select the best answer) A. Individual tailoring of medications B. Identifying environmental hazards to human development C. Determining one’s social and behavioral attitudes D. Selecting offspring who will have high intelligence Question 3: How does one differentiate media hype about new genetic discoveries from factual information? (select all answers that apply) A. Consider the source of the information. B. C. Seek the help of a professional genetics organization such as the American College of Medical Genetics. Ask friends or relatives for their interpretation. D. Consider whether the information sounds over-simplified or sensationalized. Submit Reset Personal Genome Project Study Guide Part V: Genetics and Society Lesson 10: The Risks of Applying Genetic Technology to Health Care Upon completion of this lesson, you will be able to: List the risks of genetic testing Identify unintended consequences of genetic testing Describe ethical dilemmas in deciding if and when children should have genetic testing Personal Genome Project Study Guide Part V: Genetics and Society Lesson 10: The Risks of Applying Genetic Technology to Health Care Along with the powerful new tools of genomics, there is renewed emphasis on ethical, legal and social implications, especially with recent developments in genetic research and testing. Attention to ethical issues evoked by genetic testing has not kept pace with biotechnological developments. Benefits of genetic testing, discussed in the previous lesson, must be balanced against the risk of genetic discrimination by employers, insurers, schools, and society. The Genetic Information Nondiscrimination Act (GINA) that President Bush signed on May 21, 2008 protects people from genetic discrimination in employment. The law has many shortcomings, though. It does not cover life, disability, and long-term care insurance. It covers just health insurance. In addition, GINA does not apply when a person at risk for a genetic disease develops symptoms of that disease (e.g., breast cancer or Huntington’s disease). Personal Genome Project Study Guide Part V: Genetics and Society Lesson 10: The Risks of Applying Genetic Technology to Health Care Individuals who get genetic testing face many challenges, including the following: Abridgement of the right not to know genetic information Compromised privacy and confidentiality of genetic information Confusion about what the individual may or may not learn from genetic testing results The possibility of close relatives having the same mutated gene, raising the issue of the obligation to inform those relatives of test results False positive or false negative test results Lack of scientific validity of test results A failure to detect environmental influences on the identified gene and other unidentified genes Misinterpretation of test results Discovery of misattributed paternity or adoptions Lack of follow-up counseling Psychological stress after receiving test results False hopes for treatments and cures that do not exist, and unwarranted personal reactions based on the genetic information gleaned from the test results Exploitation by private commercial companies based on the individual’s known genotype (e.g., nutritional companies) Not being informed about family medical history Potential misuse of the individual’s (and family members’) genetic information by insurers, employers, schools, government, and society. A genetic diagnosis can affect an entire family, not just the individual who was tested. Personal Genome Project Study Guide Part V: Genetics and Society Lesson 10: The Risks of Applying Genetic Technology to Health Care There are many risks associated with genetic technology for society as well as for individuals. Possible risks for society when genetic testing becomes more common are the following: Lack of regulatory oversight Lack of appropriate authority for genetic decisions, in particular when decisions need to be made on behalf of children and impaired adults Changes in the definition of what is “normal,” e.g., for the deaf and dwarf communities and their right to choose to have children like themselves Potential elimination of those who are not “perfect” Future elimination of “undesirable” traits Limited availability and affordability of testing and treatment for underprivileged individuals Personal Genome Project Study Guide Part V: Genetics and Society Lesson 10: The Risks of Applying Genetic Technology to Health Care Genetic testing of children is a major ethical issue. Minors do not have the opportunity to make decisions for themselves about whether or not to be tested. Sometimes adults want their children tested for the wrong reasons. In 1997, an advisory committee of the National Human Genome Research Institute stated that genetic testing of children for adult-onset diseases should not be undertaken unless a child would gain a direct medical benefit that would be lost if the child waited until adulthood to be tested. It is important for you to weigh both potential risks and benefits before taking a genetic test. By doing so you will be able to make an informed decision for yourself, knowing that your family members also need to be considered. Understanding the psychosocial and ethical implications of genetic testing is essential. Personal Genome Project Study Guide Part V: Genetics and Society Lesson 10: The Risks of Applying Genetic Technology to Health Care Practice Test Question 1: Which of the following is not a risk of genetic testing? A. Compromised privacy and confidentiality of individual genetic information B. Increased medical surveillance if one tests positive for a C. Lack of scientific validity of test results D. Misinterpretation of test results disorder or disease Question 2: What are some of the unintended consequences of genetic testing? A. Discovery of a misattributed B. paternity or adoption Unauthorized publication of results of your genetic tests C. Elimination of newborns with genetic disorders D. All of the above Question 3: Why is genetic testing of children a major ethical dilemma? A. Children are not smart enough to decide whether or not to have genetic testing. B. Children can institute lawsuits against their parents for wrongful birth. C. Children need to assert their right D. for genetic testing. Children who wait until adulthood to be tested might lose the opportunity to gain a direct medical benefit from the testing. Submit Reset Personal Genome Project Study Guide Part VI: Project Literacy Personal Genome Project Study Guide Part VI: Project Literacy Lesson 11: Participating in the Personal Genome Project Upon completion of this lesson, you will be able to: List the major benefits of participating in the PGP List the major risks of participating in the PGP Recognize the policies of the PGP that apply to participants Explain some of the procedures for participating in the PGP Personal Genome Project Study Guide Part VI: Project Literacy Lesson 11: Participating in the Personal Genome Project Harvard Medical School takes informed consent very seriously. As you probably know by now, from reading the other lessons, Harvard expects you to understand basic genetics in order to be accepted into the PGP. Harvard also expects you to understand what it means to be a participant in the project. What are the benefits of participating? What are the risks? What are the policies and procedures? This lesson will focus on these areas and help you prepare to offer truly informed consent. This lesson will also help you answer questions in the PGP entrance exam related to informed consent and the policies and procedures of the project. Personal Genome Project Study Guide Part VI: Project Literacy Lesson 11: Participating in the Personal Genome Project There are many benefits of becoming a PGP participant. Participants will help advance scientific research, help promote the well-being of our species, and learn more about themselves. Because the PGP plans to enroll over 100,000 participants and tie genetic information to medical histories and physical traits, extensive research data will become available. Scientists will be able to mine, analyze, and statistically correlate these data to answer fundamental questions about our basic biology, our history as a species, and our risk of getting diseases. Personal Genome Project Study Guide Part VI: Project Literacy Lesson 11: Participating in the Personal Genome Project One key benefit of participating in the PGP is the opportunity to help researchers learn more about diseases that have a genetic component, including muscular dystrophy, sickle cell anemia, Huntington's disease, diabetes, addictions, obesity, mental illnesses, Down syndrome, and many more. The data that the PGP will gather hold the promise for better diagnosis, therapy, and prevention of these diseases. Although individual participants will not receive clinical data or medical advice, their participation in the project may mean better medical care in the future for thousands of people afflicted with genetic diseases. Personal Genome Project Study Guide Part VI: Project Literacy Lesson 11: Participating in the Personal Genome Project Participation in the PGP may help advance the field of personalized medicine, which in the future could benefit people who suffer from cancer, heart disease, diabetes, and other common diseases. With personalized medicine, information about a patient's genotype or gene expression profile can be used to tailor medical care to the person's needs. Doctors will be able to provide specific therapy or preventative measures that are particularly suited to an individual. Genetic information may also be used to select the right medication and dosage. Personal Genome Project Study Guide Part VI: Project Literacy Lesson 11: Participating in the Personal Genome Project Another benefit of participating in the PGP is personal knowledge. Although the PGP does not expect the results to necessarily have any useful medical purpose for any particular individual, participants will nonetheless learn about their own genetic makeup. Participants may learn about their risk for getting genetic disorders and make lifestyle changes to reduce the risk. PGP researchers may have access to Web-based interpretation tools that can identify genetic variations and associate them with traits or diseases. These data may be made available to PGP participants who can discuss the results with their personal doctors or genetic counselors. Results may also be discussed in online forums or blogs with researchers or other participants. People with shared genetic variations or mutations may wish to contact each other and discuss diseases, traits, or genealogy. Personal Genome Project Study Guide Part VI: Project Literacy Lesson 11: Participating in the Personal Genome Project Individuals also benefit from participating in the PGP from an educational point of view. Some participants plan to volunteer because of intellectual curiosity about personal genomics, biology, computing, or bioinformatics. Professional interests might be another driver for some participants, especially for people whose work may be impacted by genomics, such as health-care workers, policy-makers, and IT professionals. Personal Genome Project Study Guide Part VI: Project Literacy Lesson 11: Participating in the Personal Genome Project Giving truly informed consent to participate in a human-subject research project such as the PGP means understanding the risks associated with participating, not just the benefits. The PGP has every intention of following protocols that are carefully designed to minimize risk. However, participants should recognize that this project is exploring relatively unchartered territories and that there are risks, some that are not well understood. The PGP recommends that you discuss with your family members the risks associated with participating. Personal genomics will have an impact on your privacy. The technology may allow for exposure of your unique genetic "fingerprint." This will have many implications. Consider the implications for the criminal justice system, for example. On the positive side, criminals can be more easily prosecuted and convicted when DNA evidence is available. On the negative side, someone could, in theory, make synthetic DNA corresponding to your DNA and plant it at a crime scene, thus falsely incriminating you. Your DNA could also infer unexpected paternity or your relationship to a criminal or historic figure of dubious fame. Personal Genome Project Study Guide Part VI: Project Literacy Lesson 11: Participating in the Personal Genome Project PGP results will be published on publicly accessible websites. Although the PGP plans to implement standard security measures for the websites, the PGP does not guarantee that your personal data will remain confidential or that you can maintain your anonymity. When you consider that your PGP results will document your genome, hair and eye color, height, facial features, and unique medical conditions, it becomes clear that the PGP must warn participants that promises of anonymity are neither realistic nor ethical. Even when strong security measures are in force, breaches happen. Hackers could gain access to your personal data; computers could get stolen; researchers or participants could unintentionally expose data that reveal more personal information than they intended. In addition, computer forensics experts can sometimes retrieve data that have been deleted from computer hard drives. So, even if you request that all your data be removed from the project databases, it is impossible to confirm that the data were fully removed. Because of these issues, the PGP cannot promise permanent confidentiality or anonymity. To participate, you should be comfortable with this fact. See this website from Harvard Medical School for information about scenarios where anonymity can be compromised: http://arep.med.harvard.edu/PGP/Anon.htm Personal Genome Project Study Guide Part VI: Project Literacy Lesson 11: Participating in the Personal Genome Project Another risk associated with personal genomics is that an insurance company could refuse to cover you if your DNA shows that you have a genetic propensity for a disease, or an employer could refuse to hire you because providing health benefits could be too expensive. Genetic discrimination is against the law in the United States since President George W. Bush signed into law the Genetics Information Nondiscrimination Act (GINA) in May 2008. The law doesn't cover life, disability, or long-term care insurance, however, and has other shortcomings according to some bioethics experts. Plus, it's unrealistic to think that genetic discrimination won't occur, simply because it's against the law. Personal Genome Project Study Guide Part VI: Project Literacy Lesson 11: Participating in the Personal Genome Project When considering whether to participate in the PGP, you should keep in mind that mistakes happen. The sequencing results, or the data that are posted on websites, could contain errors. The psychological impact of errors could be significant. If the project or some third party (possibly erroneously) claims that you have a predisposition to a debilitating disease, you shouldn't overreact. You should consult a physician or a licensed genetic counselor. As a participant in the PGP, you could learn that you are at risk for getting a disease that has no cure or treatment options. How will this affect you psychologically? How will it affect your relatives? Should you tell your children, your siblings, your parents? Do you by any chance have an identical twin? What will you tell him or her? (If you have a living identical twin, by the way, the PGP requires that the twin provide consent for your participation in the project.) Personal Genome Project Study Guide Part VI: Project Literacy Lesson 11: Participating in the Personal Genome Project In addition to understanding the benefits and risks associated with participating in the PGP, in order to pass the entrance exam you will need to answer a few See the article by Mark A. Rothstein called "Keeping Your Genes Private" in the September 2008 issue of Scientific American for more information regarding laws related to genetic privacy. questions related to policies and procedures for the project. The best place to learn up-to-date information on these topics is the PGP site itself (http://www.personalgenomes.org), but this lesson discusses a few important points here. The current plan is that PGP participants will need to follow these steps to participate: 1. Agree online to a "mini consent" form in order to get started on the PGP entrance exam. This form will ask for your name, year of birth, and email address. It will also explain that your participation is voluntary and you may refuse to participate or discontinue participation at any time. 2. Pass the PGP entrance exam. (This study guide will help you with that!) 3. Agree online to the actual consent form for participation in the research study. This is a relatively long form where you will confirm that you understand the purpose of the research and the possible risks and benefits of participating. You will also agree that a PGP researcher may decide to end your participation in the study at any time. Personal Genome Project Study Guide Part VI: Project Literacy Lesson 11: Participating in the Personal Genome Project To participate in the PGP, you will be asked to electronically complete a traits questionnaire concerning such topics as your current medications, medical history, allergies, and vital signs. The full list of personal information required for enrollment will be available at the project website. In addition to the traits questionnaire, you will be asked to specify the amount you would like to pledge to the project. Donations are encouraged but not required. If you are selected to continue to the next stage, you will be asked to submit a tissue sample such as hair and/or saliva. Scientists will perform DNA sequencing on the tissue samples and use them to study biological characteristics, DNA, RNA (gene expression), physical traits, and the presence and characteristics of micro-organisms in the specimen sample. Scientists may also attempt to create a living tissue sample known as a cell line. Cell lines provide a renewable supply of your cells and DNA. Personal Genome Project Study Guide Part VI: Project Literacy Lesson 11: Participating in the Personal Genome Project Practice Test Question 1: The PGP will give you medical advice. A. True B. False Question 2: A benefit of participating in the PGP is the opportunity to help advance research on diseases that have a genetic component. A. True B. False Question 3: You should discuss your project participation with your immediate family. A. True B. False Question 4: Unlike many commercial personal genomics ventures, the PGP will not require a tissue sample. A. True B. False Question 5: To participate in the PGP, you will be asked to electronically complete a traits questionnaire. A. True B. False Question 6: The PGP guarantees that your private data will not be exposed to anyone who is not associated with the project. A. True B. False Question 7: The medical ramifications of your genetic variations could be discussed in online forums related to the PGP. A. True B. False Question 8: Participation in the PGP is entirely voluntary and you can discontinue participation at any time. A. True B. False Question 9: A PGP researcher could terminate your participation in the study. A. True B. False Question 10: If you discontinue your participation in the PGP, your data will be securely erased and guaranteed to be unavailable in the future. A. True B. False Question 11: To participate in the PGP, you should accept that your genome and trait data will be published on a publicly accessible website that does not guarantee your anonymity. A. True B. False Question 12: If your PGP results indicate that you have a predisposition for a life-threatening disease, you should immediately schedule surgery and/or start a course of medication. A. True B. False Question 13: Why do you want to participate in the PGP? For you personally, what are the benefits of participating that interest you most? Which risks concern you the most? (This question won't be graded.) Submit Reset Personal Genome Project Study Guide Part VI: Project Literacy Lesson 12: Human Subjects Research Upon completion of this lesson, you will be able to: Define "informed consent" Explain the importance of the Belmont Report List the three ethical principles espoused in the Belmont Report Describe what the Belmont Report says about the application of the three ethical principles to conducting research with human subjects Explain the protections provided by a Certificate of Confidentiality Personal Genome Project Study Guide Part VI: Project Literacy Lesson 12: Human Subjects Research Informed consent is a process whereby individuals assess their willingness to voluntarily participate in a research project, based on their understanding of the purpose of the project. Participants analyze the risks and benefits of participation, and the policies and procedures of the project that will affect participants, and then sign an informed consent form. The informed consent process shouldn't be just a one-time event, however. It should be an ongoing discourse that lets an individual assess whether to participate, before the research begins, and whether to continue to participate, as the research progresses. For the PGP, the informed consent process involves these activities: 1. 2. 3. 4. Education (that's why you're going through this study guide!) Assessment (that's why you'll take the PGP entrance exam) Consent (the signing of the actual PGP consent form) Continued reassessment of willingness to participate Personal Genome Project Study Guide Part VI: Project Literacy Lesson 12: Human Subjects Research Scientific research generates many social benefits. As already discussed in this study guide, PGP research could help alleviate human suffering from genetic diseases, increase our knowledge of human biology and history, and enable medical practices that are personalized to a person's genetic profile. Scientific research also poses many troubling ethical questions, however. Abuses of human subjects in biomedical experiments, especially during World War II, drew public attention to the question of how scientific and medical research can be conducted in an ethical fashion. In 1947, 22 Nazi doctors and SS officers were convicted of war crimes, including participating in and consenting to using concentration camp inmates as guinea pigs in medical experiments. Personal Genome Project Study Guide Part VI: Project Literacy Lesson 12: Human Subjects Research In the 1970s, a renewed focus was put on ethics in scientific and medical research when the public became aware of the deterioration of ethics that occurred during the Tuskegee Study of Untreated Syphilis in the Black Man, conducted between 1932 and 1972. As part of this study, 399 poor and Some of the Tuskegee Study clinicians and 1972. As part of this study, 399 poor and (mostly) illiterate African American sharecroppers were studied to observe the natural progression of syphilis when left untreated. Enrollees in the study weren't informed of their diagnosis, nor told that they could get treatment, even though by 1947 penicillin had become a standard treatment for syphilis. Personal Genome Project Study Guide Part VI: Project Literacy Lesson 12: Human Subjects Research In reaction to the Tuskegee Study and other concerns, the National Research Act was signed into U.S. law on July 12, 1974. This law created the National Commission for the Protection of Human Subjects of Biomedical and Behavioral Research. One of the commission's goals was to identify the basic ethical principles that should form the foundation of biomedical and behavioral research involving human subjects. After nearly five years of discussion and collaboration, the commission published a report in the Federal Register. This report became known as the Belmont Report. The report espoused the following three principles: 1. Respect for persons: protecting the autonomy of all people and treating them with courtesy and respect, and allowing for informed consent 2. Beneficence: maximizing benefits for the research project while minimizing risks to the research subjects 3. Justice: ensuring that reasonable, nonexploitative, and well-considered procedures are administered fairly Personal Genome Project Study Guide Part VI: Project Literacy Lesson 12: Human Subjects Research One important application of the three ethical principles in the Belmont Report is making sure that human subjects give informed consent. According to the report, respect for people requires that subjects, to the degree that they are capable, must be given the opportunity to choose what shall or shall not happen to them. The research project should establish specified items for disclosure to assure that subjects are given sufficient information to make this choice. The manner and context in which information is conveyed must foster comprehension. Information should be presented in an organized fashion, allowing enough time for consideration and questioning. In addition, subjects should understand the benefits, the range of risk, and the voluntary nature of participation. Personal Genome Project Study Guide Part VI: Project Literacy Lesson 12: Human Subjects Research Another important aspect of human subject research is protecting the privacy of subjects even when there are legal demands to do otherwise. A Certificate of Confidentiality helps researchers protect the privacy of subjects from compulsory legal demands (e.g., court orders and subpoenas) that seek the names or other identifying characteristics of research subjects. Certificates of Confidentiality fall under the auspices of Section 301(d) of the U.S. Public Health Service Act, 42 U.S.C. 241(d), in which the Secretary of Health and Human Services is allowed to authorize people engaged in biomedical or other research to protect the privacy of individuals who are the subjects of that research. According to this act, people authorized to protect the privacy of research subjects may not be compelled in any federal, state, or local civil, criminal, administrative, legislative, or other proceedings to identify a subject by name or other identifying characteristic. Personal Genome Project Study Guide Part VI: Project Literacy Lesson 12: Human Subjects Research Although a Certificate of Confidentiality protects researchers and subjects from compelled disclosure, it does not prevent all disclosures. A Certificate of Confidentiality doesn't prevent a researcher from voluntarily disclosing information for various reasons. It also doesn't prevent a subject from voluntarily disclosing information. In addition, a Certificate of Confidentiality doesn't prevent a researcher from disclosing information if the researcher thinks subjects are in danger of harming themselves or others, for example in cases of child abuse. Some states have laws that mandate the reporting of evidence of child abuse. A Certificate doesn't prevent a researcher from complying with such a law. Personal Genome Project Study Guide Part VI: Project Literacy Lesson 12: Participating in the Personal Genome Project Practice Test Question 1: Informed consent is (select the best answer) A. A written agreement that permits a researcher to inform a potential participant about the goals of a research project, along with the benefits, risks, policies, and procedures of the project B. Written proof, often in the form of an entrance exam, that a participant is truly educated about a project C. A binding contract between a researcher and research subject that includes information about how to cancel the agreement should either party decide to terminate the contract D. A process whereby a human subject analyzes a research project and then provides confirmation that he or she is informed about the project's goals, benefits, risks, policies, and procedures, and consents to them Question 2: Which of the following is one of the three ethical principles set forth in the Belmont Report? (select the best answer) A. Beneficence, which guarantees scholarships to potential participants who can't afford the fee B. Equality, which ensures that human subjects are a mix of genders and races C. Respect for people so that their autonomy is protected D. Justice so that participants have a way to report any ethical abuses to federal authorities Question 3: Which of the following does a Certificate of Confidentiality prevent? (select the best answer) A. Compelled disclosure of identifying characteristics of a research subject B. Compelled disclosure of identifying characteristics of a research scientist C. Compelled disclosure of child abuse in the case where a state has a mandatory reporting law D. All of the above Question 4: Which of the following is an important application of the three ethical principles in the Belmont Report? (select the best answer) A. Making sure that human subjects give informed consent B. Fair compensation for participating C. Providing treatment for diseases discovered as part of the human subject research D. Disclosure of any corporations that provide funding for the project Question 5: The informed consent process for the PGP involves a set of activities. Which of the following is not one of the activities? (select the best answer) A. Getting educated B. Passing an entrance exam C. Signing a consent form D. Going to an approved medical center to provide tissue samples Question 6: Which of the following does the Belmont Report state are applications of the primary ethical principles? (select all answers that apply) A. Participants should not be compensated B. An agreement to participate constitutes valid consent only if it is given voluntarily C. Participants should give informed and comprehending consent to participate D. Researchers should not reveal identifying characteristics of human subjects Submit Reset