Download Here - Personal Genome Project Study Guide

Personal Genome Project Study Guide
Welcome to the Personal Genome Project Study
Guide Website
Here you will find lessons and practice tests to help
you pass the Personal Genome Project (PGP) entrance
exam. The PGP is a project from Harvard Medical
School.
In 2001, the Human Genome Project published a
working draft of the human genome sequence, thus
providing unprecedented advances in our knowledge of
how a human works.
The PGP makes sequencing personal. Just like the
personal computer brought information technology to
individuals, the PGP brings DNA sequencing to
individuals. To enroll in the project, participants must
pass an entrance exam. The Alan and Priscilla
Oppenheimer Foundation developed the Personal
Genome Project Study Guide to help people pass the
exam.
Personal Genome Project Study Guide
The Personal Genome Project (PGP) is a project from
Harvard Medical School that is sequencing key pieces
of the DNA of its volunteers and publishing the results
with extensive information about the volunteers' traits
and medical history.
The data are being made available on the Internet so
that researchers can test hypotheses about the
relationships among genes, traits, and environment.
Harvard hopes to enroll 100,000 participants from the
general public in the project.
To enroll, participants must pass an entrance exam
that tests basic genetics literacy, informed consent
expertise, and knowledge about the rights and
responsibilities of human research subjects.
Personal Genome Project Study Guide
The goal of this study guide is for you to pass the
PGP entrance exam so that you can give truly
informed consent to participate in the PGP.
The entrance exam has six major topics. The study
guide has a part for each of those topics. Click on a
part button to the left to study the topics. Each part
has one or more lessons and practice tests.
It is recommended that you study the parts in order,
but that's not absolutely necessary. If you already
know some of the subjects, for example, you could
skip ahead.
Personal Genome Project Study Guide
Question: Where do I take the actual PGP entrance
exam?
Answer: Information about registering for the actual
exam is available here.
Question: What is the passing score for the entrance
exam?
Answer: As of this writing, the passing score is
100%.
Question: Where can I find more information about
the policies and procedures of the PGP?
Answer: More information is available here.
Question:How many questions does the entrance
exam have?
Answer: About 60
Question: What types of questions are on the
entrance exam?
Answer: Multiple-choice, matching, and true/false.
Most of the multiple-choice questions are the classic
type that you probably remember from school where
you had to select one correct answer out of choices A,
B, C, and D. In some of the multiple-choice questions,
however, you may be asked to select multiple correct
answers.
Question: Why do I have to take an exam to
participate in the PGP?
Answer: The PGP takes informed consent very
seriously and believes that an exam is the best way
to ensure that you have the knowledge necessary to
understand the benefits and risks associated with
participating in the project.
Question: I missed a question on a PGP Study Guide
practice test, but I think I should have gotten it right.
Where can I send feedback regarding the study guide?
Answer: You can send feedback to pgpstudy at
oppenheimerfoundation dot org.
Personal Genome Project Study Guide
For questions about the study guide, or to send feedback
about the study guide, please send email to:
pgpstudy at oppenheimerfoundation dot org
For questions about the PGP, please send email to:
general at personalgenomes dot org
For questions about the Alan and Priscilla Oppenheimer
Foundation, please send email to:
info at oppenheimerfoundation dot org
Personal Genome Project Study Guide
The Personal Genome Project Study Guide was
developed by a set of dedicated professionals on
behalf of the Alan and Priscilla Oppenheimer
Foundation.
The Foundation would like to thank the Personal
Genome Project of Harvard Medical School, and
especially Jason Bobe, for the opportunity to work on
the project. The Foundation would also like to thank
Kathleen Page, Joan O. Weiss, Grace Richter, Linda
Sturgeon, and many others who provided valuable
advice and support.
All writing Copyright (c) 2009 Alan and Priscilla
Oppenheimer Foundation
Personal Genome Project Study Guide
Kathleen Page, Ph.D., is the author of the bulk of the
lessons in the Study Guide. Dr. Page earned her B.A.
in 1978 from the Department of Biochemistry,
University of California, Berkeley; her M.A. in 1981
from the Department of Biological Sciences, University
of California, Santa Barbara; and her Ph.D. in 1988
from
the
Department
of
Microbiology
and
Immunology, University of California, Los Angeles.
Dr. Page's current research interests involve the
isolation and identification of bacteria associated with
environmentally-damaging acid mine drainage.
Personal Genome Project Study Guide
Joan Oppenheimer Weiss, M.S.W., is the author of the
Genetics and Society lessons.
Ms. Weiss was the founder of the Genetic Alliance and
is co-author of "Starting and Sustaining Genetic
Support Groups", The Johns Hopkins University Press,
1996.
Personal Genome Project Study Guide
Priscilla Oppenheimer is the Executive Editor for the Study
Guide and the author of the Project Literacy lessons.
Ms. Oppenheimer works in the computer networking field as
a consultant and instructor, and is the author and coauthor of five books on computer networking.
Ms. Oppenheimer earned her M.S. in Information Science
in 1980 from the University of Michigan and is intrigued by
DNA because it's information technology for nature.
Personal Genome Project Study Guide
Grace Y. Richter, Ph.D., edited and reviewed the lessons
and practice tests. Dr. Richter earned her B.A. in Biology in
1986 from Reed College and her Ph.D. in Biology in 1995
from Oregon State University. She currently works for Life
Technologies in Eugene, Oregon.
Personal Genome Project Study Guide
Linda Sturgeon was the Website Designer and
Computer Programmer for
the Study Guide. Ms.
Sturgeon earned her B.S. in Computer Science in
2007 from Southern Oregon University.
Ms. Sturgeon has over 20 years experience working in
the
3D
animation/special
effects (games/film),
multimedia, publishing, and advertising industries. She
is the owner of Sturgeon Advertising, located in
Southern Oregon.
Personal Genome Project Study Guide
Part I: Genetic Material
Personal Genome Project Study Guide
Part I: Genetic Material
Lesson 1: Introduction to Cells, DNA, and Genes
Upon completion of this lesson, you will be able to:
Recall that genetic information is stored in DNA
Explain that different cell types have different
functions because different genes are active in
different cells
Recall that DNA resides in every cell's nucleus
Recall that some DNA resides in a cell's
mitochondria
Explain the relationships among DNA, genes,
and chromosomes
Explain, in general terms, that genes play a role
in determining traits and inherited diseases
Personal Genome Project Study Guide
Part I: Genetic Material
Lesson 1: Introduction to Cells, DNA, and Genes
The human body consists of trillions of cells. How do
those cells know what function to carry out for your
body?
Each cell has programs encoded in its DNA. The
programs are sets of genes that become activated in
different cell types (such as muscle cells versus
nerve cells). These programs are permanently
embedded in cells, but their activity can be turned
up or down according to a person's age, lifestyle,
and environment. The programmed information in
genes is so critical that slight changes in genes can
lead to inherited diseases, or make us more inclined
to develop some diseases.
Personal Genome Project Study Guide
Part I: Genetic Material
Muscle cell
Lesson 1: Introduction to Cells, DNA, and
Genes
Different sets of genes are active in different cell
types. Although your muscle cells and nerve cells
contain the same DNA sequences, they activate
different sets of genes to give them different
functions. Each cell type runs different programs.
Muscle cells activate the genes needed to make
muscle fibers. Nerve cells activate the genes
needed to make neurotransmitters and connections
with other nerve cells.
Nerve cell
Personal Genome Project Study Guide
Part I: Genetic Material
Lesson 1: Introduction to Cells, DNA, and Genes
Different sets of genes are active during different
times of a person's life. The human body develops
from the time of fertilization to old age. The changes
that occur in our bodies as we develop are often due
to changes in gene activities that are regulated by our
stage
of
development.
This
is
known as
developmental gene regulation. Different sets of
genes are turned on and off as we develop and age.
For the most part, the genes themselves remain
constant.
Personal Genome Project Study Guide
Part I: Genetic Material
Lesson 1: Introduction to Cells, DNA, and Genes
Sets of genes encode cellular programs, also called cellular activities. Genes are made of DNA. DNA is the
abbreviation for the chemical deoxyribonucleic acid. DNA is a very long molecule. It looks like two strands
wrapped around each other, resembling a twisted ladder or double helix. DNA is coiled into chromosomes,
found in the nucleus of every cell. There is also a little bit of DNA in another part of cells, organelles called
mitochondria.
Personal Genome Project Study Guide
Part I: Genetic Material
Lesson 1: Introduction to Cells, DNA, and
Genes
Mitochondria are tiny, almost cell-like structures in
the cytoplasm of cells.
Mitochondria produce
energy for cell functions. They have a small
amount of DNA in the form of mitochondrial genes.
Only a tiny fraction of human DNA is found in
mitochondria. Mitochondrial DNA is transmitted
only from mother to child, because the child only
inherits its
mother's and
not
its father's
mitochondria. Mutations in the mitochondrial DNA
sequence can be used to determine maternal
lineage.
Personal Genome Project Study Guide
Part I: Genetic Material
Lesson 1: Introduction to Cells, DNA, and
Genes
The vast majority of a cell's DNA is within the
nucleus, a large compartment that contains
chromosomes and enzymes needed for the function
of DNA as a cellular blueprint. In the nucleus, DNA
can be copied into more DNA or copied into RNA, a
molecule
that
carries
DNA's
programmed
information outside the nucleus for the purpose of
making the proteins needed for cellular activities.
Each gene is a section of DNA that has the
information needed to make a protein.
Personal Genome Project Study Guide
Part I: Genetic Material
Lesson 1: Introduction to Cells, DNA, and Genes
Genes play a role in human disease. Some diseases
are caused by a mutation (an alteration) in the DNA
sequence of a single gene. In these cases a single
protein is altered, and that is enough to cause
disease. Some diseases are caused by infection or
damaging environments.
Many diseases have
complex causes that involve multiple genetic
mutations and/or environmental factors. Muscular
dystrophy is an example of a disease caused by a
mutation in a single gene. Asthma is an example of
a disease with complex causation.
Personal Genome Project Study Guide
Part I: Genetic Material
Lesson 1: Introduction to Cells, DNA, and Genes
Muscular dystrophy, a muscle-wasting disorder, is
caused by mutations in the DMD gene. The DMD
gene codes for a protein called dystrophin that is
necessary for muscle cells to maintain their shape.
When this protein is missing, muscle cells literally
burst as material from outside the cell membrane
leaks in, raising cell pressure. Mutations in the DMD
gene can cause Duchenne muscular dystrophy or its
milder form, Becker muscular dystrophy. People
who are born with muscular dystrophy experience
gradual, severe muscle loss and become unable to
walk by age 10. Sequencing the DMD gene can
reveal who will develop muscular dystrophy.
Striated muscle
Personal Genome Project Study Guide
Part I: Genetic Material
Lesson 1: Introduction to Cells, DNA, and Genes
Asthma is caused by a complex set of genes and
environmental factors. Asthma is a chronic lung
disease that causes a person's airways to tighten
and inflame when exposed to different irritants or
triggers.
Asthma is complicated because it is affected by the
environment a person lives in and mutations in at
least five different genes. People with asthma have
different kinds of mutations in these genes. Asthma
runs in families, but because of its complex nature
it is not yet possible to predict who will develop the
disease. DNA sequencing can only reveal who might
be at increased risk, and even then, the risk factor
cannot yet be calculated. This disease is caused by
both genetic and environmental factors.
Personal Genome Project Study Guide
Part I: Genetic Material
Lesson 1: Introduction to Cells, DNA, and Genes
The video and animation from the National Human Genome Research Institute (NHGRI) called "Our Molecular
Selves" is a great introduction to the role our genome plays in shaping who we are. The NHGRI, which is part
of the U.S. National Institutes of Health (NIH), developed the Human Genome Project in collaboration with the
U.S. Department of Energy. The video can be viewed at http://www.genome.gov/25520211.
Personal Genome Project Study Guide
Part I: Genetic Material
Lesson 1: Introduction to Cells, DNA, and Genes
Practice Test
Question 1:
Genes have __________ that act(s) as a
blueprint for the making of __________ .
A. A chromosome/cellular activities
B. DNA codes/protein
C. Cellular activities/chromosomes
D. DNA/chromosomes
Question 2:
The human body has many different cell
types. Nearly all cell types in the same
individual have the same __________ .
A. Proteins
B. Cellular activities
C. Functions
D. DNA sequences
Question 3:
As we grow and mature, our genes
__________ .
A. Disintegrate
B. May increase or decrease their level
of expression or activity
C. Gradually decrease their level of
expression
D. Gradually turn into protein
Question 4:
Mitochondria are
A. The structure that houses the
chromosomes
B. The structure that produces
energy for cells
C. A type of DNA
D. Proteins
Question 5:
Which statement about genes and human
disease is most accurate?
A. Knowing the DNA sequence of all
your genes is sufficient information
to predict the occurrence of
any genetic disease.
B. Genetic diseases are most reliably
predicted by family history rather
than DNA testing.
C. Whereas some genetic diseases
can be predicted based on the
presence of a particular gene
sequence, other genetic diseases
are too complex to be predictable
at this time.
D. Environmental factors have more
influence than gene sequence on
disease occurrence.
Submit
Reset
Personal Genome Project Study Guide
Part I: Genetic Material
Lesson 2: The Structure of DNA
Upon completion of this lesson, you will be able to:
Recognize the DNA double helix structure and its
main components
Match vocabulary words to their definitions,
including DNA, double helix, nucleotide, base
pair, gene, intergenic region, genome, and
chromosome
Estimate the amount of genetic material in a
typical human cell in terms of the number of
base pairs, genes, and chromosomes
Estimate the level of similarity in the DNA of
humans
Personal Genome Project Study Guide
Part I: Genetic Material
Lesson 2: The Structure of DNA
The information in DNA is stored as a code made of four chemical
bases: adenine (A), guanine (G), cytosine (C), and thymine (T). This
system of encoding information is very similar to the way a sequence of
letters encodes a meaningful sentence.
A single strand of DNA is made of the bases (or letters) A, C, G, and T:
ATGCTCGAATAAATGTGAATTTGA
The letters make a code for the building blocks of proteins. You can
think of these as words:
ATG CTC GAA TAA ATG TGA ATT TGA
The words combine in a long string to make the code for complete
proteins. You can think of these as sentences:
<ATG CTC GAA TAA GCC CAT CCC TGA> <ATG TGA AAA TGT GGG ATT
TGA>
These "sentences" are protein-coding DNA sequences called genes.
Genes are the blueprint for cellular production of proteins. Proteins are
required for the structure, function, and regulation of the body's cells,
tissues, and organs.
Personal Genome Project Study Guide
Part I: Genetic Material
Lesson 2: The Structure of DNA
The DNA duplex molecule, also called the double
helix, consists of two strands that wind around
each other. The strands are held together by
chemical attraction of the bases that DNA is made
of. A bonds to T and G bonds to C. The bases are
linked together to form long strands by a
"backbone" chemical structure. The DNA bases and
backbone twist around to make a duplex spiral.
The backbone structure is shown in orange and
yellow.
The bases are shown as sticks and the backbone
structure is shown as ribbons.
Personal Genome Project Study Guide
Part I: Genetic Material
Lesson 2: The Structure of DNA
The association of DNA bases on two
strands, A:T and C:G, is called base pairing.
The two strands of DNA are complementary.
Knowing the base sequence of one strand
automatically provides the sequence of the
other strand. The duplex DNA of the human
genome consists of about 3 billion base
pairs, and about 99.9 percent of those bases
are the same in all people.
Personal Genome Project Study Guide
Part I: Genetic Material
Lesson 2: The Structure of DNA
Individual DNA bases are also called nucleotides.
Technically speaking, a nucleotide is a DNA base plus
its backbone segment. The terms base and nucleotide
are often used interchangeably. For example, an
alteration (mutation) in DNA sequence can be called a
base substitution or a nucleotide substitution.
Adenine base, the letter "A" in DNA sequences
Adenine nucleotide, the letter "A" in DNA sequences
plus its backbone segment
Personal Genome Project Study Guide
Part I: Genetic Material
Lesson 2: The Structure of DNA
The human genome has 3 billion base pairs
(equivalent to 6 billion bases total). The
genome
is
divided
into
22
regular
(autosomal) chromosomes, two different
kinds of sex chromosomes (X and Y), and a
tiny amount of DNA that resides in
mitochondria
(see
Lesson
1).
The
chromosomes vary in size and in the number
of genes they encode. The Y chromosome is
the smallest, with about 50 million base pairs
and 200 genes. Chromosome 1 is the
largest, with about 240 million base pairs and
3000 genes. The total number of genes in
the human genome is estimated at 20,00025,000.
Personal Genome Project Study Guide
Part I: Genetic Material
Lesson 2: The Structure of DNA
Women have, normally, two copies of every
chromosome except the Y chromosome.
Women do not have the Y chromosome. Men
have, normally, two copies of every regular
(autosomal) chromosome and only one copy
each of the X and Y chromosomes. Humans
have a total of 46 chromosomes inside nearly
all of their cells. There are 22 paired
autosomal chromosomes and a pair of sex
chromosomes,
making
23
pairs
of
chromosomes. Because the genes are the
same
on
each
pair
of
autosomal
chromosomes, we have a backup copy of most
of our genes.
Each different kind of chromosome is colored differently in
this diagram of the chromosomes found in a woman. The
two X chromosomes (pink) are in the lower right corner.
Personal Genome Project Study Guide
Part I: Genetic Material
Lesson 2: The Structure of DNA
Only some of the DNA in chromosomes encodes genes. Most of the DNA sequences in the human genome
are seemingly useless because they do not contain any information needed to produce proteins. These
noncoding DNA sequences are interspersed between coding sequences (genes) and are called intergenic
regions.
Personal Genome Project Study Guide
Part I: Genetic Material
Lesson 2: The Structure of DNA
Lesson 2: The Structure of DNA
For a more in-depth look at chromosome structure watch the
video "Chromosome 11 flyover" narrated by Doug Thomas.
http://www.dnalc.org/ddnalc/resources/chr11a.html
Personal Genome Project Study Guide
Part I: Genetic Material
Lesson 2: The Structure of DNA
Practice Test
Question 1-11:
Type in the letter of the most appropriate
phrase (on the right) to match the terms
below
1. Double helix
2. Gene
3. Intergenic region
4. Autosomal chromosomes
5. X and Y chromosomes
6. Base pairs
7. Nucleotide
8. Genome
9. Nucleus
10. Mitochondria
11. Protein
Question 12:
About how many genes are in the
human genome?
Question 13:
Does most of the DNA in the
human genome code for protein?
(Y/N)
Question 14:
How many chromosomes
does a typical human cell have,
in total?
Question 15:
Which human chromosome is
absent in females?
a.
b.
c.
d.
e.
f.
g.
h.
i.
j.
k.
DNA that encodes a protein
Product of gene expression
House(s) most of the cell's DNA
House(s) a small fraction of the
cell's DNA
All of the cell's DNA
Duplex DNA
DNA not involved in coding for
protein
Sex chromosomes
Present as matched pairs in both
men and women
A base plus backbone structure
3 billion in the human genome
Question 16:
What percentage of base pairs are
the same in every person? Provide
your answer with one number after
the decimal point. (Example: 15.9)
Submit
Reset
Personal Genome Project Study Guide
Part I: Genetic Material
Lesson 3: DNA's Role in Determining Your Traits
Upon completion of this lesson, you will be able to:
Recognize that both genes and environment play
a role in defining a person's traits
Recall that most human DNA sequence variation
is in the form of single nucleotide polymorphisms
(SNPs)
Explain the relationship among genes, alleles,
genotypes, and phenotypes
Explain that variations in DNA sequence result in
different versions of genes within the human
population
Match vocabulary words to their definitions,
including trait, allele, genotype, phenotype,
single nucleotide polymorphism (SNP), genetic
potential, and penetrance
Personal Genome Project Study Guide
Part I: Genetic Material
Lesson 3: DNA's Role in Determining Your Traits
The genome sequence of each person is unique, with
the exception of identical twins. Although the
frequency of base pair substitutions between
different individuals is only 0.1%, obvious differences
in physical traits are seen from person to person. A
trait is an observable characteristic of a person, such
as height or temperament. Genes encode proteins
that direct the cells in our body to develop certain
traits. The environment we live in also influences
the development of traits. For example, your DNA
may encode proteins that allow you to grow tall, but
poor nutrition, certain infections, and traumatic
accidents may prevent you from ever becoming tall.
Personal Genome Project Study Guide
Part I: Genetic Material
Lesson 3: DNA's Role in Determining Your Traits
A typical human gene has about 1000 base pairs
that code for one protein. On average, we expect
that one of the base pairs in any gene would vary in
at least 1% of people. This kind of variation is
called a single nucleotide polymorphism or SNP for
short.
"Poly" means many and "morphism" means form. A
polymorphic DNA sequence is a sequence that has
more than one form in different people. A SNP is a
location along a genomic sequence that varies from
person to person. SNPs are responsible for many of
the different traits we observe among people. You
inherit your SNPs from your parents. Everyone has
thousands of SNPs, but they are not found in all
genes.
Personal Genome Project Study Guide
Part I: Genetic Material
Lesson 3: DNA's Role in Determining Your Traits
When a particular gene occurs in slightly different
forms (sequences) in some people, the gene is said
to be polymorphic. Most gene polymorphisms do not
produce new traits, although some of them do. For
example, the gene that encodes the ABO blood type
trait is polymorphic; it has several SNPs and over
180 sequence variants. But all variants can be
classified into the 3 groups, A, B, and O. In this
example, there are 3 blood group traits. The trait is
determined by a single gene that has SNPs. The SNP
variants are classified into 3 different classes of
alleles. An allele is a variant form of a gene that
produces variation in a trait. Most human genes
have a single known allele; the traits they produce
appear the same in everyone.
Personal Genome Project Study Guide
Part I: Genetic Material
Lesson 3: DNA's Role in Determining Your Traits
Biomedical researchers are still in the early stages of
learning about SNPs. Although most SNPs do not
produce noticeable physical changes in people, some
SNPs predispose people to particular diseases. Our
understanding of the relationships between SNPs and
traits is certain to increase greatly over the next few
years.
SNPs = Polymorphisms
Genes have many
polymorphisms but few
alleles.
Variant alleles cause variant
traits.
Personal Genome Project Study Guide
Part I: Genetic Material
Lesson 3: DNA's Role in Determining Your
Traits
Interestingly, genes were known to have allelic
variation long before any DNA sequences were
determined. This is because some traits were
known to vary according to rules of gene
inheritance, such as the color of petals in the pea
plant, as shown in the graphic on the right.
Geneticists often use the terms "genotype" and
"phenotype" when referring to alleles and traits.
Genotype is defined as the alleles present in
an individual's genome.
Phenotype is defined as the traits present in
an individual.
Personal Genome Project Study Guide
Part I: Genetic Material
Lesson 3: DNA's Role in Determining Your Traits
Penetrance is defined as the percentage of
individuals carrying a particular allele who also
express the particular trait associated with that
allele. For example, 95% of people who have the
allele for Huntington's disease actually develop the
trait (the disease) known as Huntington's. Other
genes have alleles with high penetrance as well. An
example is the ability to taste the bitter compound
PTC. There are two alleles for the PTC gene, taster
and non-taster. The taster allele shows almost 100%
penetrance. This means that almost everyone who
has the taster allele has the trait of being able to
taste the compound PTC as bitter.
Many genes have alleles with low penetrance. An
example is the HLA gene allele DR4. 20% of people
who have the DR4 allele develop rheumatoid arthritis
as they age.
Personal Genome Project Study Guide
Part I: Genetic Material
Lesson 3: DNA's Role in Determining Your
Traits
Because most traits are influenced by several genes
and environmental factors, it is not possible to
predict all the traits that will develop in an
individual, even when the person's genotype is
known. In addition, the low penetrance of many
alleles means that only a low percentage of people
with any particular allele will have the associated
trait.
The term genetic potential is used to describe the
information in a person's genome (their genotype)
that could produce particular traits if environmental
factors were favorable for the development of those
traits. For example, if a person has the DR4 allele,
they have the genetic potential to develop
rheumatoid arthritis, but other factors in addition to
that allele must come into play before the disease
will occur. Most of us have the genetic potential to
produce strong muscles and a lean body, but those
traits typically do not appear unless a fitness
program and diet regime are followed.
Another common way of describing the influence of
alleles on traits is to determine the risk that a
particular allele has on development of a particular
disease. For example, about 2% of adults over age
50 have rheumatoid arthritis. About 20% of people
over age 50 with the DR4 allele have rheumatoid
arthritis. Although most people with DR4 do not get
rheumatoid arthritis, if you have DR4, you are ten
times more likely to get the disease than if you do
not have DR4.
Personal Genome Project Study Guide
Part I: Genetic Material
Lesson 3: DNA's Role in Determining Your Traits
Practice Test
Question 1:
All genes have ______
A. At least one allele
B. Multiple alleles
C. SNPs
D. Genotypes
Question 2:
The existence of multiple alleles of a particular
gene
A. Always results in mutation of the
genome
B. Indicates that multiple phenotypes
may be possible
C. Indicates a high SNP frequency in
the gene
D. Increases the penetrance of the
alleles
Question 3:
The higher the penetrance of an allele
A. The more common it is among
people
B.
The more variation it has in its
sequence
C. The more likely it is to result in a
variant trait
D. The more likely it is to result in a
favorable trait
Question 4:
Type in the letter of the most appropriate
phrase (on the right) to match the terms
below
1. Trait
2. Allele
3. Genotype
4. Phenotype
5. SNP
6. Genetic potential
7. Penetrance
Submit
Reset
Personal Genome Project Study Guide
Part II: Gene Transmission
Personal Genome Project Study Guide
Part II: Gene Transmission
Lesson 4: Gene Expression and Personal Traits
Upon completion of this lesson, you will be able to:
Recall that humans have two copies of most
genes, except for those found on the sex
chromosomes
Define the terms diploid, haploid, multigenic
trait, dominant allele, recessive allele,
homozygous, heterozygous, and co-dominance
Recognize that genes and environment both play
a role in determining a person's traits, especially
complex traits
a. DNA polymorphism
b. The likelihood of an observable
effect on a trait
c. Characteristic
d. Gene variant that encodes an
observable difference in
some individuals
e. Theoretically possible outcome
of a particular genotype
f. The set of characteristics in
an individual
g. The set of alleles in an
individual
Personal Genome Project Study Guide
Part II: Gene Transmission
Lesson 4: Gene Expression and Personal Traits
Nearly all cells in the human body contain 46
chromosomes. There are 2 copies of each of the 22
autosomal chromosomes, and 2 sex chromosomes.
Women have 2 copies of the X chromosome, the
female sex chromosome, whereas men have one X
chromosome and one Y chromosome, the male sex
chromosome. There are hundreds to thousands of
genes on each chromosome. Because there are 2
copies of the autosomal chromosomes, there are
two copies of each gene present on them. If the
two gene copies are the same allelic form, the
person is said to be homozygous for that gene. If
there are different alleles present, the person is said
to be heterozygous for that gene. For example,
everyone has 2 copies of the PTC gene (the gene for
tasting the bitter compound PTC). There are 2
different alleles of this gene, the taster allele and
the non-taster allele. You might be homozygous for
the PTC gene (have 2 of the same alleles) or you
might be heterozygous for the PTC gene (have one
of each kind of allele).
Personal Genome Project Study Guide
Part II: Gene Transmission
Lesson 4: Gene Expression and Personal Traits
When a cell has two sets of chromosomes, it is
diploid. Humans cells are generally diploid. When a
cell has only one set of chromosomes, it is haploid.
Sperm and egg cells are normally haploid. During
fertilization, a sperm cell and an egg cell fuse,
leading to a diploid embryo.
Each parent
contributes one of the two sets of chromosomes.
Personal Genome Project Study Guide
Part II: Gene Transmission
Lesson 4: Gene Expression and Personal Traits
In diploid cells, each of the two copies of a
particular gene can produce a protein. If there are
two different alleles present, two slightly different
proteins will be made that may influence the
development of traits differently. Alleles can be
categorized as dominant, recessive, or co-dominant.
Dominant alleles produce their observable trait, even
when a different allele is also present.
Recessive alleles produce their observable trait only
when no other differing allele is present. That is,
the recessive trait can only be observed when both
alleles are the same (homozygous).
For example, the PTC taster allele is dominant,
whereas the PTC non-taster allele is recessive. If
you have two copies of the taster allele
(homozygous dominant), or if you are heterozygous
taster/non-taster, you taste PTC as a bitter. If you
are homozygous recessive (non-taster/non-taster),
you do not taste PTC as bitter.
Personal Genome Project Study Guide
Part II: Gene Transmission
Lesson 4: Gene Expression and Personal Traits
Co-dominant alleles produce their observable trait in
combination with differing alleles. Co-dominantly
expressed traits may seem like a blend of different
traits.
The A and B blood group alleles are examples of codominant alleles. If you have one A allele and one
B allele (A/B heterozygous), your blood group type
will be AB. The O allele is recessive. If you have
one A allele and one O allele (A/O heterozygous),
your blood group type will be A. Only if you are
homozygous recessive O/O will you have O type
blood.
Personal Genome Project Study Guide
Part II: Gene Transmission
Lesson 4: Gene Expression and Personal Traits
The genetics of traits such as PTC tasting or ABO
blood group type are fairly easy to explain because
they are influenced by single genes with few
alleles. They are monogenic traits. Most human
traits are complex because they are influenced by
multiple genes, some with several alleles. Traits
such as eye color and height are polygenic, complex
traits. All of the different genes and alleles that
contribute to these traits are not yet known.
Geneticists are making steady progress toward
understanding how polygenic traits are produced.
Genetic diseases and genetic disease susceptibilities
that are monogenic can be categorized as
dominant, co-dominant, or recessive. For example,
Huntington's disease is a monogenic dominant trait.
Sickle cell disease is a monogenic co-dominant
trait. Cystic fibrosis is a monogenic recessive trait.
Many genetic disease susceptibilities are complex,
polygenic traits. Inherited susceptibility to cancer or
cardiovascular disease can be monogenic or
polygenic.
In addition, environmental factors
greatly influence the risk of developing some
diseases.
Personal Genome Project Study Guide
Part II: Gene Transmission
Lesson 4: Gene Expression and Personal Traits
Practice Test
Question 1:
A haploid cell has
A. Autosomal chromosomes only
B. Two copies of autosomal
chromosomes and one sex
chromosome
C. Sex chromosomes only
D. One copy of each autosomal
chromosome and one sex
chromosome
Question 2:
Most cells in the human body
A. Have 2 copies of each autosomal
chromosome and no sex
chromosomes
B. Have one copy of each autosomal
chromosome and no sex
chromosome
C. Have 2 copies of each autosomal
chromosome and two sex
chromosomes
D. Have 2 copies of each autosomal
chromosome and one sex
chromosomes
Question 3:
If you are heterozygous for a gene that has
one recessive and one dominant allele, your
body is most likely to
A. Develop the dominant trait
B. Develop a partial version of the
dominant trait
C. Develop the recessive trait and
dominant trait
D. Develop the recessive trait
Question 4:
A polygenic trait is produced by
A. A gene that has multiple alleles
B. A gene that is present as multiple
copies in the genome
C. Contributions from multiple
different genes
D. A gene that is influenced by
multiple environmental factors
Question 5 - 10:
For human blood group types, A and B are codominant alleles whereas O is recessive. Match
each genotype to its corresponding phenotype
(on the right).
Question 5:
A/A
Question 6:
B/B
Question 7:
O/O
Question 8:
A/O
Question 9:
A/B
Question 10:
B/O
Submit
Reset
Personal Genome Project Study Guide
Part II: Gene Transmission
Lesson 5: Meiosis
Upon completion of this lesson, you will be able to:
Distinguish meiosis from mitosis
Recognize that meiosis results in the formation
of genetically different gametes via independent
a.
b.
c.
d.
A
B
O
A/B
assortment and recombination
Relate the following terms to the process of
fertilization and heredity: meiosis, mitosis,
recombination, autosome, and sex chromosome
Recall the number of autosomes and sex
chromosomes in sperm, egg, and other cell
types
Personal Genome Project Study Guide
Part II: Gene Transmission
Lesson 5: Meiosis
To grow tissue and renew cells, existing cells divide
by mitosis. The steps of mitosis are:
1. Growth in cell size
2. DNA replication. The chromosomes duplicate
themselves so that instead of two copies of
every gene per cell (the normal diploid
condition), there are 4 copies of every gene.
3. The cell's nucleus dissolves, and the
chromosomes distribute themselves into two
identical diploid sets at opposite sides of the
cell.
4. Two new nuclei form around the sets of
chromosomes.
5. The cell splits into two cells, each with its own
nucleus and each with a diploid set of
chromosomes.
Mitosis produces genetically identical cells. Cells in
the human body divide by mitosis. The only
exception occurs during the production of sperm and
egg cells. These cells are produced by meiosis.
Personal Genome Project Study Guide
Part II: Gene Transmission
Lesson 5: Meiosis
Sperm and egg cells are produced by meiosis. The
steps of meiosis are:
1. Growth in cell size
2. DNA replication. The chromosomes duplicate
themselves so that instead of two copies of
every gene per cell (the normal diploid
condition), there are 4 copies of every gene.
3. The cell's nucleus dissolves and the
chromosomes align themselves so that
homologous pairs of chromosomes can
exchange bits of DNA.
4. The chromosomes distribute into 2 sets of
chromosomes at opposite sides of the cell.
5. Two new nuclei form around the sets of
chromosomes.
6. The cell splits into two cells, each with its
own nucleus and each with two copies of
every gene.
7. The cells split again, this time without any
new DNA replication. The resulting cells have
only one copy of every gene.
The differences between meiosis
described in steps 3 and 7.
Personal Genome Project Study Guide
Part II:
Gene Transmission
Lesson 5: Meiosis
During the first cell division in meiosis,
two chromosomes of a homologous pair
may exchange segments in the manner
shown in the diagram, producing new
genetic variations in the chromosomes
of sperm and egg. The exchange of
DNA between chromosomes is called
crossing-over
and
recombination.
Recombination produces new genetic
variation ensuring that each person is
genetically unique (with the exception of
identical twins).
Personal Genome Project Study Guide
and
mitosis are
Part II: Gene Transmission
Lesson 5: Meiosis
Comparison of meiosis and mitosis
1. Meiosis produces haploid sperm or egg cells,
whereas mitosis produces diploid cells.
2. Meiosis requires two cell divisions, whereas
mitosis requires one cell division.
3. During the first cell division of meiosis, the
chromosomes duplicate and then pair up so
that recombination between homologous
chromosomes can occur. This creates new
versions of chromosomes that are hybrids of
the original maternal and paternal
chromosomes.
4. The second cell division of meiosis occurs
without any additional chromosome
duplication such that the resulting cells only
have one of each chromosome.
5. The haploid cells produced by meiosis are
genetically unique.
Personal Genome Project Study Guide
Part II: Gene Transmission
Lesson 5: Meiosis
Each egg or sperm has half of the DNA of the
person who produced it. They all have one
copy of each of the 22 autosomes and one
sex chromosome. But each of these haploid
cells is genetically unique because:
1. The 22 autosomes that they contain are
a random mixture of chromosomes from
the father and mother of the person
who produced the sperm or egg. Some
who produced the sperm or egg. Some
of the cells have more chromosomes
from the mother, some have more
chromosomes from the father. This is
the concept of independent assortment
of chromosomes during meiosis.
2. Crossing over and recombination during
meiosis generates new chromosomal
variants in every sperm and egg.
When a sperm and egg fuse, the resulting
embryo will have 44 autosomes and 2 sex
chromosomes. Half the DNA is from the
father and half the DNA is from the mother.
Personal Genome Project Study Guide
Part II: Gene Transmission
Lesson 5: Meiosis
During fertilization, one sperm and one egg
fuse to form a diploid embryo. The fertilized
egg contains one of each of the 22 autosomal
chromosomes (autosomes) from each parent,
one X chromosome from the mother and an X
or a Y chromosome from the father. Each
sperm cell has either an X or a Y
chromosome. All eggs have a single X
chromosome.
Individuals who receive an X chromosome
from their father become girls. Individuals
who receive a Y chromosome become boys.
Boys always receive their X chromosome from
their mother.
Personal Genome Project Study Guide
Part II: Gene Transmission
Lesson 5: Meiosis
Practice Test
Question 1:
A single round of mitosis produces ____ cells
and a single round of meiosis produces _____
cells.
A.
4/4
B.
2/4
C.
4/2
D.
4/8
Question 2:
Which of the following occurs during the first
cell division of meiosis but does not occur
during mitosis?
A. The nucleus dissolves.
B. The DNA replicates.
C. Pairs of chromosomes exchange DNA.
D. Flagella appear.
Question 3:
The genetic makeup of any person is such that
A. 23 of their chromosomes are from
their mother and 23 of their
chromosomes are from their father.
B. 22 of their chromosomes are from
their mother, 22 of their
chromosomes are from their father,
and their sex chromosome is
randomly contributed.
C. A random number of chromosomes
are from each parent with a total of
46 chromosomes present in each cell.
D. The sex chromosomes are from the
father and the autosomes are from
the mother.
Question 4:
Males have an X and a Y chromosome. They
always get their X chromosome from their
mother and their Y chromosome from their
father.
A. True
B. False
Question 5:
Females have two X chromosomes and
A. One is always from their mother and
one is always from their father.
B. Both X chromosomes are from their
mother.
C. Random chance determines if one or
both X chromosomes are from their
mother.
Submit
Reset
Personal Genome Project Study Guide
Part II: Gene Transmission
Lesson 6: Heredity
Upon completion of this lesson, you will be able to:
Determine the likelihood that a child will inherit
an autosomal dominant trait from one parent,
and how that differs from the likelihood of
inheriting an autosomal recessive trait
Explain what it means to be a carrier of a trait
Explain what an X-linked disease is, and why Xlinked diseases are more common in males
Explain why the likelihood of inheriting a
complex, polygenic trait is not currently possible
to calculate
Personal Genome Project Study Guide
Part II: Gene Transmission
Lesson 6: Heredity
The diagram displays the chromosomes
present in a male. There are two of each
autosomal chromosome and two different
sex chromosomes. There are two copies of
every autosomal gene and one copy of each
sex-linked gene. Because one of each type
of chromosome came from each parent,
there are likely to be different alleles present
for many of the genes on the autosomes.
The alleles may be dominant, recessive, or
co-dominant. Dominant and co-dominant
alleles produce observable traits when only
one copy of the allele is present. Recessive
alleles only produce traits when no dominant
alleles are also present.
Personal Genome Project Study Guide
Part II: Gene Transmission
Lesson 6: Heredity
A dominant trait that is encoded by a single
gene (monogenic trait) is passed on to
offspring according to the rules of Mendelian
genetics. For example, if the father of a
family has elevated blood cholesterol even
when he follows a very strict diet and does
not eat any cholesterol-containing foods, he
very likely has a "hypercholesterolemia" allele
for a gene called LDL-R. The allele is
dominant, so he has the trait even though he
also has a normal LDL-R allele. On average,
the father will pass the hypercholesterolemia
allele and the high-cholesterol trait on to
half his children as shown in the diagram.
Because the gene is autosomal (located on
an autosome, not a sex chromosome), his
daughters and sons are equally likely to
inherit the trait. By random chance, none,
all, or some of his offspring will inherit the
trait, but the probability of passing on this
trait, for each child, is 50%.
Personal Genome Project Study Guide
Part II: Gene Transmission
Lesson 6: Heredity
A recessive trait that is encoded by a single
gene (monogenic trait) is also passed on to
offspring according to the rules of Mendelian
genetics. For example, if the father and
mother of a family each have a cystic fibrosis
allele and a normal allele for the CFTR gene,
they are not affected by the disease cystic
fibrosis, but they are both genetic carriers of
the disease. The allele is recessive, so the
presence of a normal allele prevents the
disease. On average, each parent will pass
the cystic fibrosis allele on to half of his or
her children as shown in the diagram. There
is a 50% probability that a child will receive
one normal and one cystic fibrosis allele.
These children will not have cystic fibrosis,
but they will be genetic carriers. There is a
25% probability that a child will receive two
normal alleles. These children will not have
cystic fibrosis or be carriers. There is a 25%
probability that a child will receive two cystic
fibrosis alleles. These children will develop
cystic fibrosis.
Personal Genome Project Study Guide
Part II: Gene
Transmission
Lesson 6: Heredity
In males, the sex chromosomes are
present as a single copy of each.
This means that recessive traits that
are encoded on the X chromosome
are much more likely to appear in
males than females. These are called
X-linked traits. There are over 1000
genes on the X chromosome. They
encode information needed for traits
in both males and females. X-linked
genes are responsible for diseases
such as hemophilia, red-green color
blindness, muscular dystrophy, and
fragile-X syndrome. Males get these
diseases far more often than females
because they are recessive traits.
Females get X-linked diseases when
they inherit 2 recessive alleles from
their parents. Females who have
one recessive X-linked disease allele
are carriers. They are not affected
by the disease but they can pass the
trait on to their sons.
Inheritance of common hemophilia, an X-linked recessive disorder
Personal Genome Project Study Guide
Part II: Gene Transmission
Lesson 6: Heredity
If a man has an X-linked recessive disorder
and his mate does not carry the allele for it,
100% of their daughters will be carriers.
None of their sons will inherit the allele.
Males always get their X chromosome from
their mothers. Only females receive an X
chromosome from their fathers (in addition
to the one they receive from their mothers).
If a woman is a carrier of an X-linked
recessive allele for a disorder and her mate
does not have it, their sons will have a 50%
probability of inheriting the disorder. None
of their daughters will have it, but they will
have a 50% probability of being carriers.
X-linked dominant disorders are extremely
rare, as are Y-linked disorders. The Y
chromosome encodes only 89 functional
genes,
mostly
involved
in masculine
characteristics and fertility.
Personal Genome Project Study Guide
​X Y
XX
g​ irls are XX, boys are XY
​X Y
XX
g​ irls are XX or XX,
boys are XY or XY
Part II: Gene Transmission
Lesson 6: Heredity
Many human traits are influenced by more
than one gene. In addition, environmental
factors such as lifestyle, infectious diseases,
and accidents influence traits. Traits that are
the
result
of
multiple
genetic
and
environmental factors are called complex
traits. The inheritance of complex traits
cannot be predicted according to the rules of
Mendelian genetics.
As outlined below,
geneticists do not yet understand all of the
variables involved in complex traits.
The number
of
different
genes that
contribute to complex traits is difficult to
determine. For example, at least four genes
are likely to be involved in skin color, but
there may be more.
The relative contribution of each gene and
each allelic variant to the expression of a
trait is usually unknown.
Environmental factors regulate the activity of
some genes. For example, exposure to
sunlight causes skin pigment-producing cells
to increase gene expression, leading to
increased pigment production and darker
skin.
Some environmental factors have a greater
influence on trait development than genes
do. For example, although there is a genetic
component to obesity, amount of food intake
is the most important factor that controls the
development of obesity.
Personal Genome Project Study Guide
Part II: Gene Transmission
Lesson 6: Heredity
Practice Test
Question 1:
What is the likelihood that a monogenic,
autosomal dominant trait will appear in a child
whose mother does not carry the trait and a
father who is heterozygous for the trait?
A. 25%
B. 50%
C. 75%
D. 100%
E.
0%
Question 2:
What is the likelihood that a monogenic,
autosomal recessive trait will appear in a child
whose mother does not carry the trait and a
father who is a heterozygous carrier?
A. 25%
B. 50%
C. 75%
D. 100%
E.
0%
Question 3:
What is the likelihood that the son of a man
who is not color-blind and a woman who
carries an allele for red-green color blindness
(an X-linked recessive disorder) will be colorblind?
A. 25%
B. 50%
C. 75%
D. 100%
E.
0%
Question 4:
If a woman who carries an allele for red-green
color blindness and a man who is red-green
color-blind have a daughter, what is the
likelihood that she will be color-blind?
A. 25%
B. 50%
C. 75%
D. 100%
E.
0%
Question 5:
If both parents are obese (a complex trait),
what is the likelihood that their child will be
obese?
A. 100%
B. 50%
C. Cannot be calculated
Submit
Reset
Personal Genome Project Study Guide
Part III: Gene Expression
Personal Genome Project Study Guide
Part III: Gene Expression
Lesson 7: Coding for Proteins
Upon completion of this lesson, you will be able to:
Recall that genes store information in a threeletter code
Define the terms transcription, translation, and
protein, and explain the relationships among
these terms
Explain why proteins are important to the
functioning of the human body
Recognize that the action of several proteins is
often required to produce an observable trait
Recall that genes code for proteins, and that
mRNA functions as a copy of a gene's sequence
and codes for proteins
Distinguish between a genome and an exome
Personal Genome Project Study Guide
Part III: Gene Expression
Lesson 7: Coding for Proteins
DNA encodes information using groups of three
bases called codons. There are 4 different bases
in DNA: A, C, G, and T. These bases can be
combined into 4 3 , or 64, different triplets. Each
triplet codon codes for an amino acid. Amino
acids are the building blocks of proteins. All
proteins are made by stringing amino acids
together into long chains. There are 20 different
amino acids. Although there are 64 possible
codons, many code for the same amino acid.
Personal Genome Project Study Guide
Part III: Gene Expression
Lesson 7: Coding for Proteins
Proteins are a class of molecules that carry out a
tremendous variety of functions in cells. Proteins
are made as linear chains of amino acid that fold
into specific shapes.
Proteins build physical
structures in cells. For example they are the
primary components of our muscle fibers, skin, and
hair. Proteins direct the formation of our skeletons
and other body features during our development.
Many hormones are proteins. In addition, the
synthesis of non-protein hormones is directed by
proteins. Proteins function as enzymes that carry
out chemical conversions of all sorts of molecules.
For example, enzymatic proteins are responsible for
converting the food we eat into energy or fat.
Cells make thousands of different kinds of proteins.
The development of normal traits requires the
proper functioning of many different proteins.
Personal Genome Project Study Guide
Part III: Gene Expression
Lesson 7: Coding for Proteins
Some traits result when a single protein is
defective. An example is a specific type of
dwarfism called achondroplasia. When a gene
called FGFR3 is mutated, a codon changes and
an altered protein is made. This defective
protein causes less than the normal amount of
cartilage and bone growth, leading to very
short stature.
Normal human height, on the other hand, is a
complex trait that is influenced by the protein
products of several different genes, including
several growth factor genes, growth factor
receptor genes, sex hormone genes, bone
proportion genes, and genes that regulate
development. A continuous range of normal
human height is observed because the DNA
sequences of these genes vary among people,
leading to greater or lesser function of each of
the different proteins. Geneticists estimate
that height is primarily determined by our
genes, but environmental influences, especially
nutrition, also affect height.
Personal Genome Project Study Guide
Part III: Gene Expression
Lesson 7: Coding for Proteins
The process of making a protein using the code
found in DNA can be divided into two steps,
transcription and translation.
Transcription is the conversion of the DNA code
into an mRNA code. mRNA is a molecule
similar to DNA except that it is single-stranded
rather than double-stranded and it uses a base
called "U" where DNA uses "A".
Transcription is the synthesis of an mRNA
molecule that is complementary in sequence to
the DNA being used as the template.
Translation is the synthesis of protein using
mRNA as a template.
Personal Genome Project Study Guide
Part III: Gene Expression
Lesson 7: Coding for Proteins
DNA stays inside the nucleus of cells (except
during mitosis and meiosis). mRNA is made in
the nucleus and then travels to the cytoplasm
of the cell where it binds to a structure called
a ribosome that conducts the process of
protein synthesis based on the sequence of
codons in mRNA.
The basics of transcription and translation are
reviewed in the video "Our Molecular Selves"
from the National Institutes of Health.
More advanced animations of the processes of
transcription and translation can be viewed at
the Molecular and Cell Biology Learning Site:
Transcription
animation
and
Translation
animation.
Personal Genome Project Study Guide
Part III: Gene Expression
Lesson 7: Coding for Proteins
Only a small fraction of the DNA in chromosomes encodes proteins. Most of the DNA sequences in the human
genome seemingly do not contain any information needed to produce proteins. Noncoding DNA sequences
that are interspersed between genes are called intergenic regions.
Personal Genome Project Study Guide
Part III: Gene Expression
Lesson 7: Coding for Proteins
Non-protein-coding DNA sequences that are
interspersed within genes are called introns.
Introns are transcribed into mRNA along with
coding sequences, but must be removed before
the mRNA can be used for protein synthesis.
Intron removal from mRNA
Exons are protein-coding DNA sequences within
genes.
The newly coined term exome refers to the
protein-coding DNA sequences of the genome.
The exome constitutes about 1.5% of the human
genome. Because the exome contains all the
protein information about the genome, it is
considered
the
most important
and
most
interpretable part of the genome. Whereas 3
billion bases must be sequenced to yield a
complete genome sequence, only about 45 million
bases need to be sequenced to yield a person's
exome.
Introns and exons in genes
Personal Genome Project Study Guide
Part III: Gene Expression
Lesson 7: Coding for Proteins
Although knowledge about one's personal exome
sequence is now within reach, the effects of most
DNA sequence variation are still not known. One of
the goals of the Personal Genome Project is to
develop
tools
to
interpret
exome
sequence
information and correlate variant sequences with
related personal medical and biological information.
Personal Genome Project Study Guide
Part III: Gene Expression
Lesson 7: Coding for Proteins
Practice Test
Question 1:
How many DNA base pairs are needed to
encode a protein that is 20 amino acids long?
A. 20
B. 40
C. 60
D. 80
E. More than 100
Question 2:
The process of using mRNA as a template to
produce a protein is known as
A. Transcription
B. Translation
C. Translocation
D. Intron
Question 3:
The function of proteins is
A. To build cellular structures
B. To act as hormones
C. To mediate chemical conversions
D. All of the above
Question 4:
The variation seen in a complex trait such as
height
A. Is not due to variations in
genetic make-up
B. Is partly explained by DNA
sequence variations in several
different genes
C. Can be entirely explained by
variations in growth hormone genes
D. Is explained by variation in amounts
of structural proteins produced in
different people
Question 5:
Variations in the DNA sequences of intergenic
regions do not affect the sequence of amino
acids in proteins.
A. True
B. False
Question 6:
If all the exome sequence variation present in
an individual were determined, most of the
individual's disease risks would be revealed.
A. True
B. False
Submit
Reset
Personal Genome Project Study Guide
Part IV: Gene Regulation
Personal Genome Project Study Guide
Part IV: Gene Regulation
Lesson 8: Controlling Protein-Coding Genes
Upon completion of this lesson, you will be able to:
Define gene regulation
Recognize that alterations in gene regulation can
influence the development of traits and disease
Explain that the expression of any particular
gene may be influenced by other genes and by
the environment
Interpret information from genetic tests
Personal Genome Project Study Guide
Part IV: Gene Regulation
Lesson 8: Controlling Protein-Coding Genes
The term gene regulation refers to the process of
increasing or decreasing the production of
protein products from genes. To begin gene
expression, mRNA is produced from genes (recall
that this process is called transcription). mRNA is
then translated into protein in the cytoplasm. By
increasing the amount of mRNA that is produced
from any particular gene, the amount of that
particular protein product can be increased. Most
genes are regulated by turning transcription on
or off, and by subtle increases or decreases in
transcription.
Personal Genome Project Study Guide
Part IV: Gene Regulation
Lesson 8: Controlling Protein-Coding Genes
The expression of many genes remains completely
inhibited in most cell types. The DNA in human
cells includes over 20,000 genes, but only a
subset of these genes are transcribed in any
particular cell type. Different cell types express
different sets of genes, meaning that they
transcribe some genes into mRNA, and not
others. Different cell types have very different
sets of proteins in them, causing them them to
look and function very differently. Furthermore,
cells regularly turn gene expression up or down,
depending on cellular needs and environmental
signals.
Human brain Cells
Human blood cells
Personal Genome Project Study Guide
Part IV: Gene Regulation
Lesson 8: Controlling Protein-Coding
Genes
Cells regulate the level of expression of each
gene so that the correct amount of protein will
be made. Defects in gene regulation cause too
little or too much of a particular protein to be
made. Defects in gene regulation can affect
traits. For example, if you make too little
hemoglobin, you will have the trait of anemia.
Hemoglobin
Personal Genome Project Study Guide
Part IV: Gene Regulation
Lesson 8: Controlling Protein-Coding
Genes
The four main causes of gene regulation
defects are:
1. Mutations in the DNA sequence near the
start point of gene transcription.
2. Mutations in genes that code for proteins
that regulate transcription.
3. Mutations that duplicate or delete genes
so that the number of copies of a
particular gene changes.
4. Exposure to environmental factors that
alter normal patterns of gene expression.
Personal Genome Project Study Guide
Part IV: Gene Regulation
Lesson 8: Controlling Protein-Coding
Genes
Environmental factors can influence gene
regulation.
For example, when someone
becomes infected with a wart virus, the wart
virus directs changes in gene transcription that
cause the infected cells to grow into a wart.
Another example of an environmental influence
on gene regulation is stress.
Long-term
stressful experiences increase the levels of a
hormone called cortisol. Cortisol is a gene
regulator that increases the expression of
several genes, leading to long-term changes in
physiology .
Personal Genome Project Study Guide
Part IV: Gene Regulation
Lesson 8: Controlling Protein-Coding Genes
It is important to remember that traits can be
influenced by alterations in coding sequences and
by alterations in gene regulation. In addition,
some traits are influenced by a single gene and
others are polygenic.
Another
complicating
factor
is
that
the
penetrance (the likelihood that a particular allele
will actually produce a particular trait) of genetic
mutations is often far less than 100%.
A DNA test
mutations is often far less than 100%.
Some
environmental
factors
affect
gene
regulation and other environmental factors
directly affect the development of traits.
Personal Genome Project Study Guide
Part IV: Gene Regulation
Lesson 8: Controlling Protein-Coding
Genes
Gene
regulation
plays
a
role
in the
interpretation of molecular genetic tests.
Because several complex factors affect genes
and traits, it is often difficult to predict the
likelihood of developing a genetic disease, even
when a complete DNA sequence is obtained
from all the genes known to influence the
disease. However, by taking into consideration
all available genetic
and
environmental
information, a medical professional should be
able to state if a person is at low risk, average
risk, high risk, or very high risk for genetic
disease development.
Personal Genome Project Study Guide
Part IV: Gene Regulation
Lesson 8: Controlling Protein-Coding Genes
Practice Test
Question 1:
An increase in gene expression means
A. There will be more DNA in the gene.
B. The trait associated with the gene
will be increasingly obvious.
C. There will be more of the protein
that is encoded by the gene.
D. The likelihood of inheriting the
trait will be increased.
Question 2:
The human body has many different types of
cells
A. And many types of genomes.
B. And each cell type has different
genes turned off or on.
C. And each cell type is the result of
environmental gene regulation.
D. All of the above are correct.
Question 3:
In what way(s) can gene expression be
altered?
A. A mutation prevents the
transcription of a gene.
The rod of Asclepius, a symbol for medicine
transcription of a gene.
Factors in the environment influence
gene expression.
C. A chromosomal duplication increases
gene copy number.
D. All of these are ways that gene
expression can be altered.
Question 4:
After complete exome sequencing and
analysis, an individual was found to have
seven recessive mutations known to cause
seven different diseases. The individual was
heterozygous for all seven genes; the other
alleles were normal. This means that
A. The individual has the seven genetic
diseases.
B. Because the mutations are
recessive, none of the diseases is
likely to develop.
C. There is a high likelihood that at
least some of the diseases will
develop.
D. The diseases can be avoided only if
a healthy lifestyle is adopted.
Question 5:
Several different mutations in the LDL receptor
gene are dominant-acting and known to be
associated with development of high blood
cholesterol and heart disease. If a person has
one of these disease-associated mutations
A. They will not be at risk for the
disease if they have a healthy diet.
B. They are at increased risk for the
disease but can reduce their risk if
they have a healthy diet.
C. Regardless of their diet, they will
get the disease.
D. They are not at risk for the disease
unless they do not also have a
normal allele.
B.
Submit
Reset
Personal Genome Project Study Guide
Part V: Genetics and Society
Personal Genome Project Study Guide
Part V: Genetics and Society
Lesson 9: The Benefits of Applying Genetic Technology to
Health Care
Upon completion of this lesson, you will be able to:
List the benefits of genetic testing
Differentiate benefits that are available now from ones
that are still predicted for the future
Distinguish media hype from the truth about genetic
technology
Personal Genome Project Study Guide
Part V: Genetics and Society
Lesson 9: The Benefits of Applying Genetic Technology
to Health Care
As things stand now, the benefits of genetic testing are
limited. However, a genetic test may provide people with
information that can help them with both their reproductive
decisions and health behaviors. Because environment
affects genetic expression, a genetic test may also alert
individuals to a need to change diet, lifestyle, or physical
surroundings. Genetic testing can identify individuals or
groups who are at increased risk of disease.
Genetic testing can discover whether people have an
increased risk of having a child with some types of genetic
disorders. There is also genetic testing for the developing
fetus to find out if the fetus has such a disorder. Preimplantation diagnostic testing of fertilized embryos is used
to ascertain which ones are free of a particular genetic
disorder that runs in the family (e.g., cystic fibrosis), and
thus suitable for transfer to the mother’s womb.
Personal Genome Project Study Guide
Part V: Genetics and Society
Lesson 9: The Benefits of Applying Genetic Technology
to Health Care
Many genes and gene markers have been identified for
both rare and common diseases, including ovarian and
breast cancer and Huntington’s disease. Few of these
diseases are treatable or curable, although some may be
preventable, such as by a mastectomy when the BRCA-1 or
BRCA-2 gene for breast cancer is present. Screening of
children who are born with birth defects or have
developmental delays indicating a possible genetic condition
may lead to appropriate treatment that may enable a
normal life for the child. For example, if a child is born with
PKU, a metabolic disorder caused by an enzyme deficiency,
severe mental retardation can be avoided if the child’s
intake of phenylalanine is limited.
Even when a genetic disorder is not treatable or curable, a
genetic test can be beneficial. For genetic disorders such as
Huntington’s disease (HD), whose symptoms emerge late in
life, the results of genetic testing can provide an
opportunity to make important decisions for the future or
lead to a sense of relief at not having the gene. Many
people elect not to take the HD test because they would
rather not know the result. If a parent gets a diagnosis of
HD, the parent needs to consider whether to have his or
her children (who each have a 50% chance of inheriting the
disease) genetically tested.
Even though there may not be treatment available for a
genetic disorder, genetic testing can lead to increased
surveillance and, in one instance, the symptoms may be
treatable. One form of cancer, familial polyposis (which
involves initially benign polyps in the large bowel), can be
treated by removing polyps as they emerge. Some testing
also is being done to discover small changes in a person’s
DNA that might indicate a slightly increased risk for such
common disorders as heart disease, diabetes, and
Parkinson’s disease.
Personal Genome Project Study Guide
Part V: Genetics and Society
Lesson 9: The Benefits of Applying Genetic Technology
to Health Care
An important component of genetic testing that is currently
performed is genetic counseling. Genetic counseling is a
process whereby a licensed genetic counselor provides
information about results of a genetic test, risks of a
genetic disorder occurring in the family, available options
for decision making and treatment, and appropriate
referrals. One can contact the National Society of Genetic
Counselors at http://www.nsgc.org to find a local genetic
counselor. Genetic counseling will become even more
essential as further advances are made in genetic testing
and treatment
As the technology develops, future genetic testing will
result in additional benefits, including the opportunity for
people without a known genetic history of disease to find
out what diseases they are likely to get. Other future
benefits include the individual tailoring of medications and
the development of personalized diets and new lifestyles.
The discovery of possible genetic variations can lead to new
prevention strategies and treatments. The genomic era may
see great progress in prevention of illness, by identifying
individuals at high risk of developing diseases. Given a
patient’s genetic test results, physicians will be able to take
measures to prevent illness instead of waiting until
symptoms occur. Future genetic research can enhance our
understanding
of
the
interaction
of
genes and
environmental
factors
to
cause
diseases.
As our
understanding of the genetic influences on diseases
increases, we will be able to identify individuals' risks and
develop new, more efficient drugs.
Personal Genome Project Study Guide
Part V: Genetics and Society
Lesson 9: The Benefits of Applying Genetic Technology
to Health Care
It is often difficult to distinguish accurate reports in the
media about new genetic tests from those that are false or
misleading.
Factual information often is reported by
geneticists or professional organizations, such as the
American
College
of
Medical
Genetics
(http://www.acmg.net). Popular media, on the other hand,
often presents over-simplified and sensationalized stories
about genetic research and the benefits of genetic testing.
Personalized medicine to detect people’s individual health
risks and tailor therapies has been around for a long time.
However, there are now several companies offering
personalized genetic testing directly to consumers, although
the activity is unregulated, and some companies do not
offer genetic counseling or even use certified laboratories to
do the testing.
Individuals considering the new genetic testing options
need to be able to differentiate between fact and fiction
and to weigh benefits and risks to themselves and their
families.
Personal Genome Project Study Guide
Part V: Genetics and Society
Lesson 9: The Benefits of Applying Genetic
Technology to Health Care
Practice Test
Question 1:
Which of the following is a benefit of genetic
testing?
(select the best answer)
A. Learning one's susceptibility to
genetic disorders
B. Being able to make
reproductive decisions based on
the results of genetic testing
C. Increasing medical surveillance if
D.
one tests positive for a disorder or
disease
All of the above
Question 2:
Which of the following benefits is most likely
to come from future genetic tests?
(select the best answer)
A. Individual tailoring of medications
B.
Identifying environmental hazards
to human development
C.
Determining one’s social and
behavioral attitudes
D.
Selecting offspring who will have
high intelligence
Question 3:
How does one differentiate media hype about
new genetic discoveries from factual
information?
(select all answers that apply)
A. Consider the source of the
information.
B.
C.
Seek the help of a professional
genetics organization such as the
American College of Medical Genetics.
Ask friends or relatives for their
interpretation.
D.
Consider whether the information
sounds over-simplified or
sensationalized.
Submit
Reset
Personal Genome Project Study Guide
Part V: Genetics and Society
Lesson 10: The Risks of Applying Genetic Technology to
Health Care
Upon completion of this lesson, you will be able to:
List the risks of genetic testing
Identify unintended consequences of genetic testing
Describe ethical dilemmas in deciding if and when
children should have genetic testing
Personal Genome Project Study Guide
Part V: Genetics and Society
Lesson 10: The Risks of Applying Genetic Technology to
Health Care
Along with the powerful new tools of genomics, there is
renewed emphasis on ethical, legal and social implications,
especially with recent developments in genetic research and
testing. Attention to ethical issues evoked by genetic testing
has not kept pace with biotechnological developments.
Benefits of genetic testing, discussed in the previous lesson,
must be balanced against the risk of genetic discrimination by
employers, insurers, schools, and society. The Genetic
Information Nondiscrimination Act (GINA) that President Bush
signed on May 21, 2008 protects people from genetic
discrimination
in
employment.
The
law
has many
shortcomings, though. It does not cover life, disability, and
long-term care insurance. It covers just health insurance. In
addition, GINA does not apply when a person at risk for a
genetic disease develops symptoms of that disease (e.g.,
breast cancer or Huntington’s disease).
Personal Genome Project Study Guide
Part V: Genetics and Society
Lesson 10: The Risks of Applying Genetic Technology to
Health Care
Individuals who get genetic testing face many challenges,
including the following:
Abridgement of the right not to know genetic
information
Compromised privacy and confidentiality of genetic
information
Confusion about what the individual may or may not
learn from genetic testing results
The possibility of close relatives having the same
mutated gene, raising the issue of the obligation to
inform those relatives of test results
False positive or false negative test results
Lack of scientific validity of test results
A failure to detect environmental influences on the
identified gene and other unidentified genes
Misinterpretation of test results
Discovery of misattributed paternity or adoptions
Lack of follow-up counseling
Psychological stress after receiving test results
False hopes for treatments and cures that do not exist,
and unwarranted personal reactions based on the
genetic information gleaned from the test results
Exploitation by private commercial companies based on
the individual’s known genotype (e.g., nutritional
companies)
Not being informed about family medical history
Potential misuse of the individual’s (and family
members’) genetic information by insurers, employers,
schools, government, and society. A genetic diagnosis
can affect an entire family, not just the individual who
was tested.
Personal Genome Project Study Guide
Part V: Genetics and Society
Lesson 10: The Risks of Applying Genetic Technology to
Health Care
There are many risks associated with genetic technology for
society as well as for individuals. Possible risks for society
when genetic testing becomes more common are the
following:
Lack of regulatory oversight
Lack of appropriate authority for genetic decisions, in
particular when decisions need to be made on behalf
of children and impaired adults
Changes in the definition of what is “normal,” e.g., for
the deaf and dwarf communities and their right to
choose to have children like themselves
Potential elimination of those who are not “perfect”
Future elimination of “undesirable” traits
Limited availability and affordability of testing and
treatment for underprivileged individuals
Personal Genome Project Study Guide
Part V: Genetics and Society
Lesson 10: The Risks of Applying Genetic Technology to
Health Care
Genetic testing of children is a major ethical issue. Minors do
not have the opportunity to make decisions for themselves
about whether or not to be tested. Sometimes adults want
their children tested for the wrong reasons. In 1997, an
advisory committee of the National Human Genome
Research Institute stated that genetic testing of children for
adult-onset diseases should not be undertaken unless a child
would gain a direct medical benefit that would be lost if the
child waited until adulthood to be tested.
It is important for you to weigh both potential risks and
benefits before taking a genetic test. By doing so you will be
able to make an informed decision for yourself, knowing
that your family members also need to be considered.
Understanding the psychosocial and ethical implications of
genetic testing is essential.
Personal Genome Project Study Guide
Part V: Genetics and Society
Lesson 10: The Risks of Applying Genetic
Technology to Health Care
Practice Test
Question 1:
Which of the following is not a risk of genetic
testing?
A. Compromised privacy and
confidentiality of individual genetic
information
B.
Increased medical surveillance
if one tests positive for a
C.
Lack of scientific validity
of test results
D.
Misinterpretation of test results
disorder or disease
Question 2:
What are some of the unintended
consequences of genetic testing?
A. Discovery of a misattributed
B.
paternity or adoption
Unauthorized publication of results
of your genetic tests
C.
Elimination of newborns
with genetic disorders
D.
All of the above
Question 3:
Why is genetic testing of children a major
ethical dilemma?
A. Children are not smart enough to
decide whether or not to have
genetic testing.
B.
Children can institute lawsuits
against their parents for
wrongful birth.
C.
Children need to assert their right
D.
for genetic testing.
Children who wait until adulthood to
be tested might lose the opportunity
to gain a direct medical benefit from
the testing.
Submit
Reset
Personal Genome Project Study Guide
Part VI: Project Literacy
Personal Genome Project Study Guide
Part VI: Project Literacy
Lesson 11: Participating in the Personal Genome
Project
Upon completion of this lesson, you will be able to:
List the major benefits of participating in the PGP
List the major risks of participating in the PGP
Recognize the policies of the PGP that apply to
participants
Explain some of the procedures for participating
in the PGP
Personal Genome Project Study Guide
Part VI: Project Literacy
Lesson 11: Participating in the Personal
Genome Project
Harvard Medical School takes informed consent very
seriously. As you probably know by now, from
reading the other lessons, Harvard expects you to
understand basic genetics in order to be accepted
into the PGP. Harvard also expects you to
understand what it means to be a participant in the
project. What are the benefits of participating?
What are the risks? What are the policies and
procedures? This lesson will focus on these areas
and help you prepare to offer truly informed
consent. This lesson will also help you answer
questions in the PGP entrance exam related to
informed consent and the policies and procedures of
the project.
Personal Genome Project Study Guide
Part VI: Project Literacy
Lesson 11: Participating in the Personal
Genome Project
There are many benefits of becoming a PGP
participant. Participants will help advance scientific
research, help promote the well-being of our
species, and learn more about themselves. Because
the PGP plans to enroll over 100,000 participants
and tie genetic information to medical histories and
physical traits, extensive research data will become
available. Scientists will be able to mine, analyze,
and statistically correlate these data to answer
fundamental questions about our basic biology, our
history as a species, and our risk of getting
diseases.
Personal Genome Project Study Guide
Part VI: Project Literacy
Lesson 11: Participating in the Personal Genome
Project
One key benefit of participating in the PGP is the
opportunity to help researchers learn more about
diseases that have a genetic component, including
muscular dystrophy, sickle cell anemia, Huntington's
disease, diabetes, addictions, obesity, mental
illnesses, Down syndrome, and many more. The
data that the PGP will gather hold the promise for
better diagnosis, therapy, and prevention of these
diseases. Although individual participants will not
receive clinical data or medical advice, their
participation in the project may mean better medical
care in the future for thousands of people afflicted
with genetic diseases.
Personal Genome Project Study Guide
Part VI: Project Literacy
Lesson 11: Participating in the Personal Genome
Project
Participation in the PGP may help advance the field
of personalized medicine, which in the future could
benefit people who suffer from cancer, heart disease,
diabetes, and other common diseases. With
personalized medicine, information about a patient's
genotype or gene expression profile can be used to
tailor medical care to the person's needs. Doctors
will be able to provide specific therapy or
preventative measures that are particularly suited to
an individual. Genetic information may also be used
to select the right medication and dosage.
Personal Genome Project Study Guide
Part VI: Project Literacy
Lesson 11: Participating in the Personal Genome
Project
Another benefit of participating in the PGP is personal
knowledge. Although the PGP does not expect the
results to necessarily have any useful medical
purpose for any particular individual, participants will
nonetheless learn about their own genetic makeup.
Participants may learn about their risk for getting
genetic disorders and make lifestyle changes to
reduce the risk.
PGP researchers may have access to Web-based
interpretation
tools
that
can identify genetic
variations and associate them with traits or diseases.
These data may be made available to PGP
participants who can discuss the results with their
personal doctors or genetic counselors. Results may
also be discussed in online forums or blogs with
researchers or other participants. People with shared
genetic variations or mutations may wish to contact
each other and discuss diseases, traits, or genealogy.
Personal Genome Project Study Guide
Part VI: Project Literacy
Lesson 11: Participating in the Personal Genome
Project
Individuals also benefit from participating in the PGP
from an educational point of view. Some participants
plan to volunteer because of intellectual curiosity
about personal genomics, biology, computing, or
bioinformatics. Professional interests might be
another driver for some participants, especially for
people whose work may be impacted by genomics,
such as health-care workers, policy-makers, and IT
professionals.
Personal Genome Project Study Guide
Part VI: Project Literacy
Lesson 11: Participating in the Personal Genome
Project
Giving truly informed consent to participate in a
human-subject research project such as the PGP
means understanding the risks associated with
participating, not just the benefits. The PGP has
every intention of following protocols that are
carefully designed to minimize risk. However,
participants should recognize that this project is
exploring relatively unchartered territories and that
there are risks, some that are not well understood.
The PGP recommends that you discuss with your
family
members
the
risks
associated
with
participating.
Personal genomics will have an impact on your
privacy. The technology may allow for exposure of
your unique genetic "fingerprint." This will have
many implications. Consider the implications for the
criminal justice system, for example. On the positive
side, criminals can be more easily prosecuted and
convicted when DNA evidence is available. On the
negative side, someone could, in theory, make
synthetic DNA corresponding to your DNA and plant
it at a crime scene, thus falsely incriminating you.
Your DNA could also infer unexpected paternity or
your relationship to a criminal or historic figure of
dubious fame.
Personal Genome Project Study Guide
Part VI: Project Literacy
Lesson 11: Participating in the Personal Genome
Project
PGP results will be published on publicly accessible
websites. Although the PGP plans to implement standard
security measures for the websites, the PGP does not
guarantee that your personal data will remain
confidential or that you can maintain your anonymity.
When you consider that your PGP results will document
your genome, hair and eye color, height, facial features,
and unique medical conditions, it becomes clear that the
PGP must warn participants that promises of anonymity
are neither realistic nor ethical.
Even when strong security measures are in force,
breaches happen. Hackers could gain access to your
personal data; computers could get stolen; researchers
or participants could unintentionally expose data that
reveal more personal information than they intended. In
addition, computer forensics experts can sometimes
retrieve data that have been deleted from computer
hard drives. So, even if you request that all your data
be removed from the project databases, it is impossible
to confirm that the data were fully removed.
Because of these issues, the PGP cannot promise
permanent confidentiality or anonymity. To participate,
you should be comfortable with this fact.
See this website from Harvard Medical School for
information about scenarios where anonymity can
be compromised:
http://arep.med.harvard.edu/PGP/Anon.htm
Personal Genome Project Study Guide
Part VI: Project Literacy
Lesson 11: Participating in the Personal Genome
Project
Another risk associated with personal genomics is that
an insurance company could refuse to cover you if your
DNA shows that you have a genetic propensity for a
disease, or an employer could refuse to hire you
because providing health benefits could be too
expensive. Genetic discrimination is against the law in
the United States since President George W. Bush signed
into law the Genetics Information Nondiscrimination Act
(GINA) in May 2008. The law doesn't cover life,
disability, or long-term care insurance, however, and has
other shortcomings according to some bioethics experts.
Plus, it's unrealistic to think that genetic discrimination
won't occur, simply because it's against the law.
Personal Genome Project Study Guide
Part VI: Project Literacy
Lesson 11: Participating in the Personal Genome
Project
When considering whether to participate in the PGP, you
should keep in mind that mistakes happen. The
sequencing results, or the data that are posted on
websites, could contain errors. The psychological impact
of errors could be significant. If the project or some
third party (possibly erroneously) claims that you have a
predisposition to a debilitating disease, you shouldn't
overreact. You should consult a physician or a licensed
genetic counselor.
As a participant in the PGP, you could learn that you are
at risk for getting a disease that has no cure or
treatment
options.
How
will
this
affect
you
psychologically? How will it affect your relatives? Should
you tell your children, your siblings, your parents? Do
you by any chance have an identical twin? What will you
tell him or her? (If you have a living identical twin, by
the way, the PGP requires that the twin provide consent
for your participation in the project.)
Personal Genome Project Study Guide
Part VI: Project Literacy
Lesson 11: Participating in the Personal Genome
Project
In addition to understanding the benefits and risks
associated with participating in the PGP, in order to pass
the entrance exam you will need to answer a few
See the article by Mark A. Rothstein called
"Keeping Your Genes Private" in the September
2008 issue of Scientific American for more
information regarding laws related to genetic
privacy.
questions related to policies and procedures for the
project. The best place to learn up-to-date information
on
these
topics
is
the
PGP
site
itself
(http://www.personalgenomes.org), but
this lesson
discusses a few important points here.
The current plan is that PGP participants will need to
follow these steps to participate:
1. Agree online to a "mini consent" form in order to get
started on the PGP entrance exam. This form will ask for
your name, year of birth, and email address. It will also
explain that your participation is voluntary and you may
refuse to participate or discontinue participation at any
time.
2. Pass the PGP entrance exam. (This study guide will
help you with that!)
3. Agree online to the actual consent form for
participation in the research study. This is a relatively
long form where you will confirm that you understand
the purpose of the research and the possible risks and
benefits of participating. You will also agree that a PGP
researcher may decide to end your participation in the
study at any time.
Personal Genome Project Study Guide
Part VI: Project Literacy
Lesson 11: Participating in the Personal Genome
Project
To participate in the PGP, you will be asked to
electronically complete a traits questionnaire concerning
such topics as your current medications, medical history,
allergies, and vital signs. The full list of personal
information required for enrollment will be available at
the project website.
In addition to the traits questionnaire, you will be asked
to specify the amount you would like to pledge to the
project. Donations are encouraged but not required. If
you are selected to continue to the next stage, you will
be asked to submit a tissue sample such as hair and/or
saliva.
Scientists will perform DNA sequencing on the tissue
samples and use them to study biological characteristics,
DNA, RNA (gene expression), physical traits, and the
presence and characteristics of micro-organisms in the
specimen sample. Scientists may also attempt to create
a living tissue sample known as a cell line. Cell lines
provide a renewable supply of your cells and DNA.
Personal Genome Project Study Guide
Part VI: Project Literacy
Lesson 11: Participating in the Personal Genome
Project
Practice Test
Question 1:
The PGP will give you medical advice.
A. True
B. False
Question 2:
A benefit of participating in the PGP is the
opportunity to help advance research on
diseases that have a genetic component.
A. True
B. False
Question 3:
You should discuss your project participation
with your immediate family.
A. True
B. False
Question 4:
Unlike many commercial personal genomics
ventures, the PGP will not require a tissue
sample.
A. True
B. False
Question 5:
To participate in the PGP, you will be asked to
electronically complete a traits questionnaire.
A. True
B. False
Question 6:
The PGP guarantees that your private data will
not be exposed to anyone who is not
associated with the project.
A. True
B. False
Question 7:
The medical ramifications of your genetic
variations could be discussed in online forums
related to the PGP.
A. True
B. False
Question 8:
Participation in the PGP is entirely voluntary
and you can discontinue participation at any
time.
A. True
B. False
Question 9:
A PGP researcher could terminate your
participation in the study.
A. True
B. False
Question 10:
If you discontinue your participation in the
PGP, your data will be securely erased and
guaranteed to be unavailable in the future.
A. True
B. False
Question 11:
To participate in the PGP, you should accept
that your genome and trait data will be
published on a publicly accessible website that
does not guarantee your anonymity.
A. True
B. False
Question 12:
If your PGP results indicate that you have a
predisposition for a life-threatening disease,
you should immediately schedule surgery
and/or start a course of medication.
A. True
B. False
Question 13:
Why do you want to participate in the PGP?
For you personally, what are the benefits of
participating that interest you most? Which
risks concern you the most? (This question
won't be graded.)
Submit
Reset
Personal Genome Project Study Guide
Part VI: Project Literacy
Lesson 12: Human Subjects Research
Upon completion of this lesson, you will be able to:
Define "informed consent"
Explain the importance of the Belmont Report
List the three ethical principles espoused in the
Belmont Report
Describe what the Belmont Report says about
the application of the three ethical principles to
conducting research with human subjects
Explain the protections provided by a Certificate
of Confidentiality
Personal Genome Project Study Guide
Part VI: Project Literacy
Lesson 12: Human Subjects Research
Informed consent is a process whereby individuals assess their willingness to voluntarily participate in a
research project, based on their understanding of the purpose of the project. Participants analyze the risks
and benefits of participation, and the policies and procedures of the project that will affect participants, and
then sign an informed consent form. The informed consent process shouldn't be just a one-time event,
however. It should be an ongoing discourse that lets an individual assess whether to participate, before the
research begins, and whether to continue to participate, as the research progresses.
For the PGP, the informed consent process involves these activities:
1.
2.
3.
4.
Education (that's why you're going through this study guide!)
Assessment (that's why you'll take the PGP entrance exam)
Consent (the signing of the actual PGP consent form)
Continued reassessment of willingness to participate
Personal Genome Project Study Guide
Part VI: Project Literacy
Lesson 12: Human Subjects Research
Scientific research generates many social benefits.
As already discussed in this study guide, PGP
research could help alleviate human suffering from
genetic diseases, increase our knowledge of human
biology and history, and enable medical practices
that are personalized to a person's genetic profile.
Scientific research also poses many troubling ethical
questions, however. Abuses of human subjects in
biomedical experiments, especially during World
War II, drew public attention to the question of how
scientific and medical research can be conducted in
an ethical fashion.
In 1947, 22 Nazi doctors and SS officers were
convicted of war crimes, including participating in and
consenting to using concentration camp inmates as
guinea pigs in medical experiments.
Personal Genome Project Study Guide
Part VI: Project Literacy
Lesson 12: Human Subjects Research
In the 1970s, a renewed focus was put on ethics in
scientific and medical research when the public
became aware of the deterioration of ethics that
occurred during the Tuskegee Study of Untreated
Syphilis in the Black Man, conducted between 1932
and 1972. As part of this study, 399 poor and
Some of the Tuskegee Study clinicians
and 1972. As part of this study, 399 poor and
(mostly) illiterate African American sharecroppers
were studied to observe the natural progression of
syphilis when left untreated. Enrollees in the study
weren't informed of their diagnosis, nor told that
they could get treatment, even though by 1947
penicillin had become a standard treatment for
syphilis.
Personal Genome Project Study Guide
Part VI: Project Literacy
Lesson 12: Human Subjects Research
In reaction to the Tuskegee Study and other
concerns, the National Research Act was signed into
U.S. law on July 12, 1974. This law created the
National Commission for the Protection of Human
Subjects of Biomedical and Behavioral Research. One
of the commission's goals was to identify the basic
ethical principles that should form the foundation of
biomedical and behavioral research involving human
subjects. After nearly five years of discussion and
collaboration, the commission published a report in
the Federal Register. This report became known as
the Belmont Report. The report espoused the
following three principles:
1. Respect for persons: protecting the autonomy
of all people and treating them with courtesy
and respect, and allowing for informed consent
2. Beneficence: maximizing benefits for the
research project while minimizing risks to the
research subjects
3. Justice:
ensuring
that
reasonable, nonexploitative, and well-considered procedures
are administered fairly
Personal Genome Project Study Guide
Part VI: Project Literacy
Lesson 12: Human Subjects Research
One important application of the three ethical
principles in the Belmont Report is making sure that
human subjects give informed consent. According to
the report, respect for people requires that subjects,
to the degree that they are capable, must be given
the opportunity to choose what shall or shall not
happen to them. The research project should establish
specified items for disclosure to assure that subjects
are given sufficient information to make this choice.
The manner and context in which information is
conveyed must foster comprehension. Information
should be presented in an organized fashion, allowing
enough time for consideration and questioning. In
addition, subjects should understand the benefits, the
range of risk, and the voluntary nature of
participation.
Personal Genome Project Study Guide
Part VI: Project Literacy
Lesson 12: Human Subjects Research
Another important aspect of human subject research
is protecting the privacy of subjects even when
there are legal demands to do otherwise. A
Certificate of Confidentiality helps researchers
protect the privacy of subjects from compulsory
legal demands (e.g., court orders and subpoenas)
that
seek the
names
or other identifying
characteristics of research subjects.
Certificates of Confidentiality fall under the auspices
of Section 301(d) of the U.S. Public Health Service
Act, 42 U.S.C. 241(d), in which the Secretary of
Health and Human Services is allowed to authorize
people engaged in biomedical or other research to
protect the privacy of individuals who are the
subjects of that research. According to this act,
people authorized to protect the privacy of research
subjects may not be compelled in any federal, state,
or local civil, criminal, administrative, legislative, or
other proceedings to identify a subject by name or
other identifying characteristic.
Personal Genome Project Study Guide
Part VI: Project Literacy
Lesson 12: Human Subjects Research
Although a Certificate of Confidentiality protects
researchers and subjects from compelled disclosure, it
does not prevent all disclosures. A Certificate of
Confidentiality doesn't prevent a researcher from
voluntarily disclosing information for various reasons.
It also doesn't prevent a subject from voluntarily
disclosing information.
In addition, a Certificate of Confidentiality doesn't
prevent a researcher from disclosing information if the
researcher thinks subjects are in danger of harming
themselves or others, for example in cases of child
abuse. Some states have laws that mandate the
reporting of evidence of child abuse. A Certificate
doesn't prevent a researcher from complying with such
a law.
Personal Genome Project Study Guide
Part VI: Project Literacy
Lesson 12: Participating in the Personal Genome
Project
Practice Test
Question 1:
Informed consent is
(select the best answer)
A. A written agreement that permits a
researcher to inform a potential
participant about the goals of a
research project, along with the
benefits, risks, policies, and
procedures of the project
B. Written proof, often in the form of
an entrance exam, that a participant
is truly educated about a project
C. A binding contract between a
researcher and research subject that
includes information about how to
cancel the agreement should either
party decide to terminate the
contract
D. A process whereby a human subject
analyzes a research project and then
provides confirmation that he or she
is informed about the project's
goals, benefits, risks, policies, and
procedures, and consents to them
Question 2:
Which of the following is one of the three
ethical principles set forth in the Belmont
Report?
(select the best answer)
A. Beneficence, which guarantees
scholarships to potential
participants who can't afford the fee
B. Equality, which ensures that human
subjects are a mix of genders and
races
C. Respect for people so that their
autonomy is protected
D. Justice so that participants have a
way to report any ethical abuses to
federal authorities
Question 3:
Which of the following does a Certificate of
Confidentiality prevent?
(select the best answer)
A. Compelled disclosure of identifying
characteristics of a research subject
B. Compelled disclosure of identifying
characteristics of a research
scientist
C. Compelled disclosure of child
abuse in the case where a
state has a mandatory reporting law
D. All of the above
Question 4:
Which of the following is an important
application of the three ethical principles in the
Belmont Report?
(select the best answer)
A. Making sure that human subjects
give informed consent
B. Fair compensation for participating
C. Providing treatment for diseases
discovered as part of the human
subject research
D. Disclosure of any corporations that
provide funding for the project
Question 5:
The informed consent process for the PGP
involves a set of activities. Which of the
following is not one of the activities?
(select the best answer)
A. Getting educated
B. Passing an entrance exam
C. Signing a consent form
D. Going to an approved medical center
to provide tissue samples
Question 6:
Which of the following does the Belmont
Report state are applications of the primary
ethical principles?
(select all answers that apply)
A. Participants should not be
compensated
B. An agreement to participate
constitutes valid consent only if it
is given voluntarily
C. Participants should give informed
and comprehending consent to
participate
D. Researchers should not reveal
identifying characteristics of human
subjects
Submit
Reset