Download Article On the Complexity of Chloroplast RNA

On the Complexity of Chloroplast RNA Metabolism: psaA
Trans-splicing Can be Bypassed in Chlamydomonas
Linnka Lefebvre-Legendre,1 Livia Merendino,y,z,§,ô,1 Cristian Rivier,1 and Michel Goldschmidt-Clermont*,1
1
Department of Botany and Plant Biology and Department of Molecular Biology, University of Geneva, Geneva, Switzerland
Present address: Laboratoire de Physiologie Cellulaire & Vegetale, UMR 5168, CNRS, Grenoble, France
z
Present address: LPCV, Univ. Grenoble Alpes, Grenoble, France
§
Present address: LPCV, CEA, DSV, iRTSV, Grenoble, France
ô
Present address: LPCV, USC1359, INRA, Grenoble, France
*Corresponding author: E-mail: [email protected].
Associate editor: Stephen Wright
y
Abstract
In the chloroplast, the posttranscriptional steps of gene expression are remarkably complex. RNA maturation and
translation rely on a large cohort of nucleus-encoded proteins that act specifically on a single target transcript or a
small set of targets. For example in the chloroplast of Chlamydomonas, trans-splicing of the two split introns of psaA
requires at least 14 nucleus-encoded proteins. To investigate the functional significance of this complex trans-splicing
pathway, we have introduced an intron-less copy of psaA in the chloroplast genomes of three mutants deficient in transsplicing and of the wild type. We find that the intron-less psaA gene rescues the mutant phenotypes. The growth of
strains with the intron-less psaA is indistinguishable from the wild type under the set of different experimental conditions
that were investigated. Thus, the trans-splicing factors do not appear to have any other essential function and transsplicing of psaA can be bypassed. We discuss how these observations support the hypothesis that complex RNA metabolism in the chloroplast may in part be the result of a nonadaptive evolutionary ratchet. Genetic drift may lead to the
accumulation of chloroplast mutations and the recruitment of compensatory nuclear suppressors from large preexisting
pools of genes encoding RNA-binding proteins.
Key words: chloroplast, RNA processing, splicing, constructive neutral evolution, Chlamydomonas, synthetic biology.
Introduction
organelles and their hosts, so that, for example, the PPR family
counts hundreds of members in land plants but less than a
dozen in Chlamydomonas (Johnson et al. 2010; Tourasse et al.
2013). Conversely, the OPR protein family contains more than
40 members in Chlamydomonas but only one in higher plants
(Rahire et al. 2012; Kleinknecht et al. 2014).
Chloroplast gene expression includes a remarkably complex set of posttranscriptional steps. Polycistronic transcripts
are cleaved by endonucleases and trimmed by exonucleases
(Barkan and Goldschmidt-Clermont 2000; Eberhard et al.
2008; Stern et al. 2010). The resulting transcripts are protected
by 30 -hairpin-loops or by specific proteins that can bind at
the 50 - or 30 -end and inhibit the progression of exonucleases
(Drager et al. 1998; Nickelsen et al. 1999; Vaistij, GoldschmidtClermont, et al. 2000; Pfalz et al. 2009; Barkan 2011; Ghulam
et al. 2013; Loizeau et al. 2014). Introns belonging to group I or
group II are removed and the exons are spliced, usually “in cis”
(from a single precursor) but sometimes “in trans” (from independent transcripts) (Glanz and Kuck 2009; de Longevialle
et al. 2010; Stern et al. 2010; Barkan 2011). Furthermore,
specific C residues are edited to U in the plastid mRNAs of
many plants, although not in liverworts (Marchantiidae) or
chlorophyte algae such as Chlamydomonas (Stern et al. 2010).
Editing can create a start codon for translation or change the
primary sequence of the encoded protein. At each of these
ß The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please
e-mail: [email protected]
Mol. Biol. Evol. 31(10):2697–2707 doi:10.1093/molbev/msu215 Advance Access publication July 22, 2014
2697
Article
The plastid is an essential organelle of photosynthetic eukaryotes, where vital processes such as photosynthesis and biosynthesis of important metabolites take place. The plastid is
governed by two separate genomes, in the nucleus and in the
organelle. During the course of evolution, many genes from
the ancestral cyanobacterial endosymbiont of the plastid
have been transferred to the nucleus or have been lost.
Consequently, only about a hundred proteins are encoded
in the plastid genome, and most of the plastid proteome is
nucleus-encoded and imported.
The genomes of mitochondria, which are endosymbiotic
descendants of proteobacteria, have followed a similar evolutionary path. Mitochondrial genomes typically contain even
fewer genes, and mitochondria also import the majority of
their proteome (Millar et al. 2005). During evolution, new
genes have been recruited to participate in organelle biogenesis. Most prominent amongst them are the members of
helical-repeat protein families such as the PPR proteins
(pentatrico peptide repeat) in vascular plants or the OPR
(octatrico peptide repeat) proteins in Chlamydomonas
(Schmitz-Linneweber and Small 2008; Eberhard et al. 2011;
Rahire et al. 2012; Barkan and Small 2014; Hammani et al.
2014). Some of these families have vastly expanded in different lineages of the Viridiplantae during the coevolution of the
Lefebvre-Legendre et al. . doi:10.1093/molbev/msu215
steps, large numbers of nucleus-encoded proteins intervene,
most of which are strikingly specific for single transcripts or
small subsets of plastid transcripts. Translation of the plastid
mRNAs also requires the action of specific proteins that bind
the 50 -untranslated region (50 -UTR) (Barkan 2011; Lyska et al.
2013). Specific assembly factors finally intervene in the assembly of the protein subunits, together with their cofactors and
pigments, into large multimolecular complexes (Lyska et al.
2013).
Some aspects of chloroplast gene expression reflect the
endosymbiotic bacterial origin of the organelle, such as the
structure of its 70 S ribosomes or the nature of the plastidencoded polymerase which is of eubacterial origin. Other
traits of plastid gene expression contrast with features of
the ancestral prokaryote. For example plastid genes with similar functions, such as those encoding the subunits of the
photosystems, are often scattered in different transcription
units, in contrast to the organization of the prokaryotic
genome based on operons of coregulated genes clustered in
the same transcription unit. Operons are apparently not
replaced by posttranscriptional regulons in the chloroplast,
on the contrary expression of different subunits of the same
complex often depends on different nucleus-encoded proteins. This can be illustrated with the example of the photosystem II subunits encoded in the Chlamydomonas
chloroplast. Mutations of TBC1 or TBC2 affect the translation
of psbC with no apparent effect on translation of the other
subunits (Rochaix et al. 1989; Auchincloss et al. 2002).
Likewise, the stability of psbD mRNA is specifically lost in
mutants of Nac2, a TPR protein that protects the 50 -end of
the transcript, with no apparent effect on the levels of psbA,
psbB, or psbC mRNAs (Kuchka et al. 1989). Conversely for
MBB1, which is strictly required for mRNA stability of the
polycistronic transcription unit comprising both psbB/T
and psbH, the mbb1 null mutation has no effect on the
mRNAs for other photosystem II (PSII) subunits which are
transcribed separately (Monod et al. 1992).
Trans-splicing of psaA in the Chlamydomonas chloroplast
is a paradigmatic example of the large number and strict
substrate specificities of the nucleus-encoded proteins involved in posttranscriptional steps of gene expression in the
organelle. The psaA gene is split in three separate exons scattered in distant loci of the plastid genome (K€uck et al. 1987).
The exons are transcribed separately and are flanked by sequences that can assemble to form the conserved structures
found in other group II introns. A fourth locus, tscA, encodes a
short noncoding RNA that is required to complete the structure of intron 1 (Goldschmidt-Clermont et al. 1991). Two
steps of splicing “in trans” are required to form the mature
psaA mRNA (Choquet et al. 1988). This type of trans-splicing
occurs in the plastids and mitochondria of many organisms
and in a variety of different genes (Glanz and Kuck 2009). For
example, psaA is trans-spliced in Chlamydomonas but is an
intron-less gene in higher plant plastids, and conversely rps12
is trans-spliced in higher plants but not in Chlamydomonas.
Genetic analysis of PSI-deficient Chlamydomonas mutants
has revealed that at least 14 nuclear loci are required for
trans-splicing of psaA (Goldschmidt-Clermont et al. 1990).
2698
MBE
Most of these genes are required specifically for splicing of
only one of the two split introns. At least seven genes are
essential for trans-splicing of the first intron, some of which
are necessary for processing of tscA from a polycistronic precursor (Hahn et al. 1998; Rivier 2000; Balczun et al. 2005; Glanz
et al. 2012). Five loci are required for trans-splicing of the
second intron (Perron et al. 1999), and two are involved in
splicing of both the introns (Merendino et al. 2006).
There may be multiple reasons for the remarkable complexity of chloroplast RNA metabolism. One is the need for
regulation in response to developmental or environmental
changes, in coordination with nuclear gene expression. An
example is provided in Chlamydomonas by two proteins required for petA expression, Mca1 and Tca1, whose accumulation is reduced under conditions of nitrogen deprivation
when the cytochrome b6f complex is down-regulated
(Raynaud et al. 2007; Wei et al. 2014). Another source of
complexity may stem from the need to precisely regulate
the intricate assembly of the photosynthetic complexes
which are composed of many subunits and numerous cofactors and pigments. In a mechanism that is thought to ensure
the stoichiometric production of the different chloroplast
subunits, negative feedback regulation is exerted by unassembled subunits on the translation of their cognate
mRNAs (Choquet and Wollman 2002, 2009). These negative
feedback loops, dubbed control by epistasy of synthesis, regulate the assembly of all the photosynthetic complexes in
Chlamydomonas and also seem to govern the assembly of
Rubisco in tobacco plastids (Wostrikoff and Stern 2007).
Another source of complexity in RNA metabolism may be
“debugging the chloroplast genetic program” (Maier et al.
2008), a possibility that we like to call the “spoiled kid hypothesis”. In this view, mutations accumulate over time in the
chloroplast genome, compensated by suppressor mutations
in the nucleus, driving an evolutionary ratchet. Such suppressors may be essential for optimal chloroplast function to
ensure photosynthesis and other important metabolic pathways of the plastid. Their evolutionary fixation may be facilitated because the plastids are sexually isolated due to their
uniparental inheritance. When a plastid mutation severely
affects RNA metabolism, the theory of constructive neutral
evolution (CNE) proposes that suppression may involve a
preexisting nucleus-encoded factor which restores adequate
gene expression, and allows a step towards “irremediable
complexity” (Gray et al. 2010; Lukes et al. 2011). The whims
of the plastid—the “spoiled kid”—are thus compensated by a
liberal nuclear genome. In the long term, this might allow the
occurrence and persistence of apparently futile steps of gene
expression, such as RNA editing or trans-splicing.
To address the complexity of plastid RNA metabolism,
Chlamydomonas is an ideal system because it offers a large
set of nuclear mutants affected in chloroplast gene expression, together with the possibility to manipulate the chloroplast genome by transformation. We sought to determine
whether trans-splicing of psaA in the Chlamydomonas chloroplast, with the numerous nucleus-encoded proteins required in this process, plays an essential function. To
address this question, we turned to a simple implementation
By-pass of psaA Trans-splicing . doi:10.1093/molbev/msu215
MBE
FIG. 1. Chloroplast bypass or nuclear rescue of trans-splicing mutants. The chloroplast is shown on the right (green) with a schematic representation of
the psaA trans-splicing pathway. The three exons of psaA (e1, e2, and e3) and the noncoding tscA RNA map to four separate loci on the chloroplast
genome (not to scale). They are transcribed separately and the four RNAs assemble to form the conserved structures of two group II introns, which are
spliced “in trans” to produce the mature psaA mRNA. In the nucleus (blue) at least 14 loci (only RAA1 is shown here as an example) encode proteins
that are imported in the chloroplast where they are required for trans-splicing of psaA. A mutation in any of these genes (red crosses and red dotted
arrow) prevents the maturation of psaA mRNA. To try to bypass the nuclear mutation and the trans-splicing pathway (bypass, shown in brown on the
right), an intron-less copy of psaA (psaA-i) is introduced at the exon3 locus by chloroplast transformation. Nearly-isogenic lines are obtained by
rescuing the nuclear mutation with a genomic fragment containing a WT copy of the mutant gene (rescue, shown in pink on the left).
of the concepts of synthetic biology. We constructed an
intron-less version of the psaA gene, and introduced it by
chloroplast transformation in different nuclear mutants deficient in psaA trans-splicing or in the wild type (WT) (fig. 1).
We report that the intron-less gene rescued photoautotrophic growth of the mutants, and that the transformed lines
had no significant growth phenotype under a variety of laboratory conditions that were tested. These observations support the hypothesis that the complexity of chloroplast RNA
metabolism may in part be due to nonadaptative evolutionary processes.
Results
Chlamydomonas Chloroplast Transformants with
Intron-less psaA
We assembled a vector for chloroplast transformation (psaAi) that contains an intron-less version of the psaA gene
(supplementary fig. S1A, Supplementary Material online). In
this vector exons 1, 2, and 3 of psaA were fused and placed
under the control of the psaA-ex1 promoter/50 -UTR. The
flanking sequences in the vector were chosen such that
after chloroplast transformation and homologous recombination, the intron-less gene would replace the resident psaA
exon3. A selectable marker (aadA), that confers resistance to
spectinomycin, was placed downstream of the psaA-ex3 sequence (Goldschmidt-Clermont 1991). This vector was used
to transform Chlamydomonas WT cells, as well as the raa1,
raa2, and raa3 mutants, representing the three classes of
trans-splicing mutants (Choquet et al. 1988; GoldschmidtClermont et al. 1990). The raa1 mutant is deficient in
processing of tscA from a polycistronic precursor and in
trans-splicing of both the split introns (Merendino et al.
2006). The raa2 mutant is defective in trans-splicing of
exons 2 and 3, whereas raa3 is affected in trans-splicing of
exons 1 and 2 (Perron et al. 1999; Rivier 2000). The transformants were selected on spectinomycin-containing medium
and subcultured until homoplasmy was achieved. This was
assessed by polymerase chain reaction (PCR) on genomic
DNA (supplementary fig. S1B, Supplementary Material
online), which showed the presence of the intron-less psaA
gene and the absence of any detectable parental genome.
Chlamydomonas is haploid in the vegetative state, and
mutants deficient in photosynthesis may accumulate additional secondary mutations upon prolonged cultivation
(Spreitzer and Ogren 1983; Girard-Bascou et al. 1992). The
psaA trans-splicing mutants are PSI-deficient and hence
nonphotosynthetic, so that any secondary mutations that
would affect photosynthesis might have gone unnoticed because they would not have any further growth phenotype
2699
MBE
Lefebvre-Legendre et al. . doi:10.1093/molbev/msu215
(Girard-Bascou et al. 1992). PSI-deficient mutants are also
sensitive to photodamage, and may acquire secondary mutations that relieve photosensitivity (Spreitzer and Ogren 1983).
Such mutations would change the properties of the mutant
host strains that were transformed with the intron-less psaA
gene. To try to circumvent this problem and allow a valid
comparison of the growth properties of the transgenic lines,
we also derived nearly isogenic lines by transforming the three
splicing mutants with the respective WT genes (RAA1, RAA2,
or RAA3) inserted in the nucleus (fig. 1). The nuclear transformants were selected for photoautotrophic growth on minimal medium. Several lines were isolated for each mutant to
monitor possible variations due to position effects or copy
number of the transformed nuclear gene.
Trans-splicing Mutants Rescued with Intron-less psaA
Have Normal Growth Phenotypes
For each mutant, we compared the growth properties of at
least three lines rescued with the WT copy of the nuclear
gene with those of two lines rescued with the intron-less
psaA-i gene in the chloroplast (fig. 2A, supplementary
figs. S2 and S3, Supplementary Material online). All the
transformants were capable of photoautotrophic growth
on minimal medium and were not sensitive to higher
light intensities, in contrast to the parental splicing mutants which do not grow on minimal medium and are
sensitive to light when grown on acetate-containing
medium. This suggests that expression of PsaA and assembly of PSI are rescued in the three trans-splicing mutants
carrying the intron-less copy of psaA. This was confirmed
by immunoblotting, which showed that they all accumulated PsaA protein in amounts similar to the WT (fig. 3A
and supplementary fig. S4, Supplementary Material online).
RNA blot hybridization further showed that the intron-less
psaA mRNA accumulates in these strains to levels similar
to the trans-spliced mRNA in the corresponding strains
rescued with the respective WT gene (fig. 3B). The accumulation of psaA mRNA was similar to the WT, but did
vary in the different genetic backgrounds. This confirms
the importance of comparing nearly isogenic lines, the
mutant strains bypassed with the intron-less psaA versus
the controls rescued with the WT gene (fig. 1).
As might be expected from these results which showed
that PsaA was present at normal levels, no changes were
detectable in the growth rates of liquid cultures of the
three trans-splicing mutants bypassed with the intron-less
psaA, as compared with the WT or the controls rescued
with the respective nuclear genes (fig. 2B and supplementary
fig. S3, Supplementary Material online). These results show
that trans-splicing can be bypassed and does not have an
essential function. They also suggest that the trans-splicing
factors do not have essential roles other than in psaA maturation under normal growth conditions.
Acclimation to Iron Limitation
In conditions of mixotrophic growth (in acetate-containing
medium in the light), iron deprivation causes dramatic
2700
changes in the photosynthetic electron transfer chain
(Moseley et al. 2002; Terauchi et al. 2010; Hohner et al.
2013). The relative amount of PSI strongly decreases and
the light-harvesting antennae undergo a reorganization that
involves proteolytic processing of Lhca3 (Naumann et al.
2005). The effect of iron limitation on PSI was readily confirmed when Chlamydomonas cells were transferred to
medium lacking iron and the PsaA subunit was monitored
by immunoblotting (fig. 4). Within 48 h the amount of PsaA
dropped to low levels, and when iron was restored, PsaA
rapidly reaccumulated to normal amounts. We did not observe any significant difference in the response to iron deprivation or in the recovery after iron restoration, for the mutant
lines with the intron-less psaA-i compared with the WT, or
compared with the mutant lines rescued with the respective
nuclear genes (fig. 4 and supplementary fig. S5,
Supplementary Material online). Thus, trans-splicing does
not appear to play an important role in the acclimation of
the Chlamydomonas cells to iron limitation or in the recovery
upon iron supplementation.
Growth under Competition
The mutant lines rescued with the intron-less psaA gene
seemed to grow at normal rates. However, we considered
the possibility that trans-splicing might offer a growth advantage—or disadvantage—that would only be apparent in conditions of competition. To investigate this possibility a
transgenic line carrying the intron-less psaA-i gene in a
WT nuclear background was compared with a WT control
that expresses psaA by trans-splicing. A WT genetic background was chosen for this sensitive assay to avoid any
unwanted effect of cryptic mutations that may have appeared in the genetic background of the splicing mutants.
The cultures were grown in minimal medium with diurnal
light/dark cycles, conditions where photosynthesis and light
acclimation are expected to play an important role. The cultures were inoculated with an equal mixture of the two genotypes, and they were serially subcultured every week.
During the course of the experiments, the proportions of
the two genotypes were determined by plating on solid
media in the presence or absence of spectinomycin.
Although both genotypes grow on normal medium, only
the strain with the intron-less psaA gene and the linked
aadA selection marker forms colonies on spectinomycin.
We did not observe any apparent selective advantage for
the WT line, where trans-splicing is operating, compared
with the intron-less genotype (fig. 2C). As a control for any
possible effect of the antibiotic resistance marker inserted
downstream of psaA ex3, we also obtained transformants
with the aadA cassette inserted at the same site but lacking
the intron-less psaA gene (aadA-control). When grown in
competition with the WT, this control line did not show
any significant difference. These data indicate that
under the conditions tested, trans-splicing does not confer
a significant growth advantage or disadvantage to the
Chlamydomonas cells.
By-pass of psaA Trans-splicing . doi:10.1093/molbev/msu215
MBE
Acclimation to Higher Temperature or to Oxygen
Limitation
At high temperatures, trans-splicing of psaA is retarded
(Choquet et al. 1988). To investigate whether psaA transsplicing could have an effect on acclimation to elevated temperatures, three Chlamydomonas lines were compared, the
FIG. 3. Accumulation of PsaA protein and psaA mRNA in strains carrying intron-less psaA. (A) Immunoblot analysis of PsaA. Total protein
extracts of the algal lines indicated at the top were separated by SDS–
PAGE, and subjected to immunoblotting with antisera against PsaA and
the D1 protein of photosystem II as a loading control. The algae were
grown in medium containing acetate (TAP) under constant light
(60 mE m2 s1). Further transformants sampled at different timepoints
after subculturing in liquid medium are shown in supplementary figure
S5, Supplementary Material online. (B) RNA blot analysis of psaA
mRNA. Total RNA extracts from the algal lines indicated at the top
were separated by denaturing agarose gel electrophoresis, blotted to
nylon membranes and hybridized with radiolabelled probes for exon 3
of psaA or atpB as a control. The fully spliced psaA mRNA (psaA ex12-3), the unspliced precursor of psaA exon 3, and the atpB mRNA are
indicated on the left. As discussed in the text, in the transformants with
different genetic backgrounds (derived from the WT, raa1, raa2, or
raa3), psaA mRNA accumulates to slightly different levels, but this
does not significantly change the amount of PsaA protein.
FIG. 2. Growth of strains carrying intron-less psaA. (A) Spot tests. Serial
10-fold dilutions of Chlamydomonas cultures were spotted on minimal
medium (HSM) or on medium containing acetate (TAP) and grown
under normal light (60 mE m2 s1) or low light (6 mE m2 s1). The
growth of two independent lines of the raa1 mutant rescued with a
genomic fragment containing the WT RAA1 gene are shown in the first
rows of the top and bottom panels (raa1; RAA1 #1 and raa1; RAA1 #2).
They are compared with two lines of the raa1 mutant carrying the
intron-less psaA construct (raa1/psaA-i #1 and raa1/psaA-i #2),
two WT lines carrying intron-less psaA construct (WT/psaA-i #1
and WT/psaA-i #2), the WT and the raa1 mutant. Spot tests of
further transformants of raa1, raa2, and raa3 are shown in supplementary figure S3, Supplementary Material online. (B) Growth curves. Cell
counts of cultures grown in TAP medium under normal light
FIG. 2. Continued
(60 mE m2 s1). Four independent transformants of raa1 with the genomic WT fragment (raa1; RAA1 #1 to raa1; RAA1 #4) are compared
with two lines of the raa1 mutant carrying the intron-less psaA construct (raa1/psaA-i #1 and raa1/psaA-i #2) and to the WT. Similar
growth curves for transformants of raa2 and raa3 are shown in supplementary figure S4, Supplementary Material online. (C). Growth under
competition. Equal numbers of the WT and WT cells carrying psaA-i
(WT/psaA-i) were mixed and grown in minimal medium (HSM)
under 12 h dark–12 h light (60 mE m2 s1) cycles. Prior to subculturing
in fresh medium every week, the proportion psaA-i cells in the culture
(green lozenges) was determined by plating on media containing spectinomycin (WT/psaA-i cells are antibiotic resistant because of the
aadA selection marker) or on medium lacking antibiotic to count the
total number of cells. As a control, equal numbers of the WT were
mixed with WT cells carrying only the aadA insert (WT/aadA-control)
and were grown and analyzed in parallel (purple squares).
2701
Lefebvre-Legendre et al. . doi:10.1093/molbev/msu215
FIG. 4. Response to iron deprivation. Cells from iron-replete cultures of
the strains indicated on the left were collected by centrifugation, washed
and resuspended in iron-free medium (Fe) at time 0. After 48 h, the
cultures were resupplemented with iron (þFe; 18 mM). Total protein
samples were extracted at the times indicated at the top, subjected to
SDS–PAGE and analyzed by immunoblotting with antisera against PsaA
and the CF1 component of ATP-synthase as a loading control.
WT, a line carrying the intron-less psaA-i in the WT background and a line with only the aadA marker as a control.
Serial dilutions of cultures grown at 25 C were spotted on
plates containing acetate-containing medium or minimal
medium, and transferred to 32 C. No differences in the plating efficiency or growth of the two lines compared with the
WT could be observed (supplementary fig. S6, Supplementary
Material online), indicating that trans-splicing does not significantly influence the acclimation to the higher temperature
or growth at the elevated temperature.
Acclimation to growth under low oxygen conditions was
also tested in a similar set of experiments. The two lines and
the WT were spotted on acetate medium or on minimal
medium, and then sealed in anaerobiosis bags (supplementary fig. S6, Supplementary Material online). No differences in
their plating efficiency or growth compared with the WT
were observed.
Discussion
The Trans-Splicing Pathway of psaA Maturation Can
be Bypassed
In the chloroplast genome of Chlamydomonas cells, the psaA
gene contains two fragmented introns that are spliced “in
trans.” By replacing trans-spliced psaA with an intron-less
version in the chloroplast genome, we were able to rescue
the photosynthetic deficiency of three mutants defective in
psaA trans-splicing. The three mutants are representative of
the three classes of phenotypes, blocked in splicing of either
intron 1 (raa3, class C), intron 2 (raa2, class A), or both the
introns (raa1, class B). Unlike the parental strains which are
PSI-deficient and cannot grow on minimal medium, the three
mutants rescued with the intron-less psaA gene showed
normal photoautotrophic growth. These results indicate
that these trans-splicing factors do not have any other
roles that would be essential for the viability of the
Chlamydomonas cells under the conditions that were
tested. In preliminary experiments, we previously observed
that several other nuclear mutants defective in trans-splicing
could also be rescued with the intron-less psaA gene (Rivier
2000). Why the psaA introns have not been lost during
2702
MBE
evolution as could be engineered in the intron-less psaA
strain is a matter of speculation, it is possible that their loss
could be hindered by the split organization of the transspliced introns.
Immunoblot analysis showed that the rescued strains accumulate WT levels of PsaA protein. To account for any effect
of additional mutations that might have appeared in the
background of the trans-splicing mutants, we created a set
of nearly isogenic control lines where psaA trans-splicing was
restored by transformation with the corresponding WT
nuclear gene. The importance of using these controls was
apparent when the amounts of psaA mRNA were compared
by RNA blot hybridization. The levels of the mature mRNA
were similar in the nearly isogenic strains rescued with the
intron-less psaA gene compared with the strains rescued with
the respective WT nuclear gene; however, the amount
seemed to vary in the different genetic backgrounds of the
three original mutants. It thus appears that the regulation of
PsaA accumulation at the translational or posttranslational
levels must compensate for these small differences in mRNA
abundance, as was previously observed for many chloroplast
mRNAs in Chlamydomonas (Eberhard et al. 2002). As psaA
mRNA is apparently not limiting for PsaA accumulation, it
should probably not be expected that the bypass of transsplicing confers a growth advantange. Our results also indicate that the psaA trans-splicing pathway does not play an
essential role because it can be bypassed by providing an
intron-less version of the gene. This is particularly striking
because psaA trans-splicing involves four different chloroplast
transcripts and a least 14 nucleus-encoded proteins in
Chlamydomons (Choquet et al. 1988; GoldschmidtClermont et al. 1990, 1991). For splicing “in cis,” a similar
observation was made for the introns in the psbA and rrnL
genes of Chlamydomonas, and for the two introns of ycf3 in
the tobacco chloroplast, which could be deleted and replaced
with an intron-less version of the respective genes without
any apparent effect on the phenotype (Johanningmeier and
Heiss 1993; Minagawa and Crofts 1994; Holloway and Herrin
1998; Petersen et al. 2011). This is also reminiscent of the
introns in the mitochondria of the yeast Saccharomyces
cerevisiae, which can be removed without apparent consequences on cell viability (Seraphin et al. 1987). These observations fit with the hypothesis that group I and group II
introns originated as selfish transposable retroelements, capable of inserting in the genome with little phenotypic consequence as they splice out precisely from the RNA product
(Lambowitz and Zimmerly 2004). That splicing of these introns in the chloroplast requires nucleus-encoded factors
implies that the ancestral self-splicing ribozymes have degenerated and become dependent on gene products of their
hosts (Barkan 2011). In the case of psaA trans-splicing,
these nucleus-encoded factors are particularly numerous as
at least 14 have been identified originally and it is not known
whether those that were identified more recently with biochemical or genetic approaches are included in this set or
represent additional components (Goldschmidt-Clermont
et al. 1990; Glanz and Kuck 2009; Glanz et al. 2012; Jacobs
et al. 2013).
By-pass of psaA Trans-splicing . doi:10.1093/molbev/msu215
The question thus arises, whether trans-splicing has
evolved to serve functions that might be beneficial to the
chloroplast or the host cell, in particular for the regulation
of gene expression and the assembly of PSI. We investigated
this possibility by testing the potential role of the trans-splicing pathway in the acclimation of Chlamydomonas to various
environmental conditions. As psaA encodes a major subunit
of PSI, light intensity is an important external factor, in particular because PSI mutants are highly sensitive to light even
though they are grown auxotrophically on medium containing acetate. No difference was observed in the growth of the
lines with the intron-less psaA compared with the controls
under different light intensities, in the presence or absence of
acetate. To test this with more sensitivity, cells with the
intron-less psaA were grown in competition with WT cells
for 4 weeks, but no significant competitive advantage or disadvantage was observed. The lines with intron-less psaA also
grew like the controls upon a shift to elevated temperatures
or to anoxic conditions. Under iron limitation in mixotrophic
cultures, the abundance of PSI centers is strongly down-regulated but quickly restored when iron is resupplied (Moseley
et al. 2002; Hohner et al. 2013). Similar to the controls, the
lines with intron-less psaA down-regulated the amount of PSI
in response to iron limitation and quickly restored PSI levels
when it was again available. The environmental conditions
that we examined constitute a diverse spectrum and we did
not identify any conditions where bypassing of psaA transsplicing had detectable consequences for growth. It cannot be
ruled that under another stress condition, or under a combination of different stresses, a phenotype might still become
apparent. We nevertheless conclude that the psaA transsplicing pathway is largely dispensable.
Evolution of Complex RNA Metabolism in the
Chloroplast
Posttranscriptional RNA editing provides another striking example of complex but apparently futile RNA metabolism.
Numerous C residues in plant chloroplast and mitochondrial
transcripts are converted to U residues, a process which requires a large cohort of site-specific editing factors (Shikanai
and Fujii 2013). In principle, the need for editing could be
circumvented by mutating the C residues to U at the DNA
level. There is only very limited evidence that editing plays any
regulatory role (Peeters and Hanson 2002; Stern et al. 2010;
Shikanai and Fujii 2013). Cybrids with the nuclear genome of
Atropa belladonna (deadly nightshade) and the plastome of
Nicotiana tabacum (tobacco) have an albino phenotype. This
was ascribed to defective editing of a site in the plastid atpA
mRNA, which is specific to the tobacco chloroplast and for
which an editing factor is missing in the nightshade nuclear
genome (Schmitz-Linneweber et al. 2005). A mutation of
C-to-T in the tobacco chloroplast DNA that bypassed editing
at this site had no apparent phenotypic consequence in tobacco. Furthermore, the mutation rescued the albino phenotype in the Atropa cybrids. These observations can be
interpreted in the context of the coevolution of the plastid
and the nucleus to suggest that when the plastid is placed in a
MBE
different nuclear background, chloroplast mutations may be
revealed due to the lack of the corresponding nuclear suppressors. The role of nucleus-chloroplast genome incompatibility in speciation is well recognized (Greiner et al. 2011).
If the complexity of chloroplast RNA maturation does not
reflect essential functions, the possibility has to be considered
that it has evolved as consequence of an evolutionary ratchet
whereby mutations in the chloroplast are suppressed by mutations in the nuclear genome. In this view, the nucleusencoded factors are required for debugging the chloroplast
genetic program (Maier et al. 2008). Such an evolutionary drift
could be favored by the sexual isolation of the plastids, due to
their uniparental mode of inheritance in many plant species.
This evolutionary pathway requires that the mutations in the
organelle have low fitness cost to the organism when they
arise, otherwise the mutants would be lost from the population. One possibility is that the individual chloroplast mutations could have rather minor consequences, but this is
contradicted by the strong phenotypes of some mutations
that cause the loss of nucleus-encoded trans-splicing or editing factors. The theory of CNE provides a more plausible
alternative, namely that the nuclear suppressors may actually
preexist the mutation that they eventually suppress and are
thus easy to recruit (Covello and Gray 1993; Lynch 2007; Gray
et al. 2010; Lukes et al. 2011; Lynch et al. 2011). The CNE
theory explains how this type of transgenomic suppression
mechanism could be part of a “drive toward irremediable
complexity”. A pool of potential preexisting suppressors for
chloroplast mutations could be constituted by proteins that
have functions in RNA metabolism and can be co-opted for
the new task. An early example for the CNE theory was provided by the mitochondrial group I introns of Neurospora
that require a tyrosyl tRNA synthetase as splicing factor
(Akins and Lambowitz 1987; Gray et al. 2010). In
Chlamydomonas, a typical example is the Raa2 protein
which is a member of the family of pseudouridine synthases
but does not require this enzymatic activity to play its role in
psaA trans-splicing (Perron et al. 1999). Likewise, the maize
chloroplast splicing factor CRS2 shows strong sequence similarity to tRNA hydrolases, and RNC1 belongs to the family of
RNase III but has lost this enzymatic activity (Jenkins and
Barkan 2001; Watkins et al. 2007).
Another large pool of preexisting genetic suppressors of
chloroplast mutations could be constituted by the numerous
members of the helical repeat families of RNA-binding proteins, such as the PPR proteins (Tourasse et al. 2013; Barkan
and Small 2014), TPR/HAT proteins (tetratricopeptide
repeat/half a TPR), (Boudreau et al. 2000; Vaistij, Boudreau,
et al. 2000; Hammani et al. 2014) or OPR proteins (Eberhard
et al. 2011; Rahire et al. 2012). The paradigmatic PPR family in
higher plants contains 450–600 members with characteristic
degenerate repeats of a 35 amino-acid sequence. Each repeat
module binds one base of the RNA target through a few
amino-acid residues which play a critical role in sequencespecific recognition (Barkan et al. 2012; Ke et al. 2013; Yagi
et al. 2013; Yin et al. 2013). Members of the PPR protein family
are known to act in the chloroplast as editing factors, as
facilitators of intron splicing, as blockers of exonuclease
2703
MBE
Lefebvre-Legendre et al. . doi:10.1093/molbev/msu215
progression or as translation factors (Barkan 2011; Shikanai
and Fujii 2013; Barkan and Small 2014). Such a wide pool
could facilitate the evolutionary recruitment of RNA-binding
proteins capable of suppressing new mutations that arise in
chloroplast RNA. Their specificity could further evolve
through changes in the few critical residues that govern sequence recognition. Similarly, the psaA trans-splicing factor
Raa1 belongs to the family of OPR proteins that are predicted
to form a structural scaffold similar to the PPR repeats and to
bind RNA specifically (Merendino et al. 2006; Rahire et al.
2012).
In conclusion, our results show that the complex psaA
trans-splicing pathway, with its numerous nucleus-encoded
factors, can be bypassed in the chloroplast of
Chlamydomonas under a variety of growth conditions that
were tested. These results bring new experimental support for
the theory of CNE to explain certain aspects of the complexity
of chloroplast RNA metabolism.
Materials and Methods
Chlamydomonas Cultures
The Chlamydomonas reinhardtii WT and the mutant strains
L137H (raa1) (Merendino et al. 2006), L136F (raa2) (Perron
et al. 1999), and M18 (raa3) (Rivier et al. 2001) were grown in
Tris-acetate-phosphate medium (TAP) or in high salt minimal
medium (HSM) (Rochaix et al. 1988) to densities of
1–2 106 cells/ml in the dark or under fluorescent lights
(60 E m2 s1) at 25 C.
For growth tests, 10 l of cell culture at 2 106 cells/ml
were spotted with 1:10 serial dilutions on agar plates and
grown under 6 or 60 E m2 s1 light as indicated. To test
the effect of a shift to anaerobiosis, immediately after spotting
the plates were inserted in Anaearocult P plastic bags containing Anaerocult C mini reagent (Merck).
For growth curves, cultures in stationary phase were diluted 50-fold in fresh medium and cell density was monitored
by counting using a Neubauer ultraplane hemacytometer or
by measuring optical density at 750 nm (with OD750 0.075
corresponding to 0.5 106 cells ml 1 in our conditions).
For competition experiments, the cells were grown in
HSM with 12-h-light/12-h-dark cycles (60 E m2 s1). Two
independent cultures were grown in parallel in a volume of
20 ml, in one culture 0.5 107 WT cells were mixed to 0.5 107
WT (psaA-i) cells, in the other 0.5 107 WT cells were mixed
to 0.5 107 WT (psaA-i) cells. At weekly intervals 200 ml aliquots of a 250-fold dilution of these mixed cultures were
spotted on TAP plates and on TAP plates supplemented
with 100 g/ml spectinomycin. At the same times the cultures were diluted into fresh HSM medium at a density of
0.5 106 cells ml 1.
Iron Deprivation
For growth under iron limitation, glassware was treated with
50-mM ethylenediaminetetraacetic acid (EDTA) pH 8 and
washed with milliQ water. TAP-Fe was prepared with trace
elements lacking Fe. For supplementation, Fe was added at
2704
18 mM from a stock solution of 50-mM FeSO4 chelated with
134-mM EDTA
Chlamydomonas cells from cultures at 2 106 cells/ ml
were harvested by centrifugation and resuspended in TAPFe at 0.5 106 cells/ml. After 24 h and 48 h, cells were diluted
in TAP-Fe to 0.5 106 cells/ml. After the dilution at 48 h, Fe
was supplemented to 18 uM. Samples for immunoblot analyses were taken from cultures at 2 106 cells/ ml at different
timepoints.
Transformation Vectors
The plasmid psaA-i (pOS200, supplementary fig. 1,
Supplementary Material online) was assembled by first cloning the HindIII fragment containing psaA exon1 (483 bp) in
Bluescript SK(þ) to yield pEx1. The HincII fragment from
pKR150 containing part of exon3 (Redding et al. 1998) was
cloned in pEx1 digested with HincII and NaeI, yielding
pEx1Ex3. A cDNA of psaA obtained by RT-PCR was digested
with ScaI (in ex1) and NcoI (in ex3) and inserted in pEx1Ex3
digested with the same enzymes to yield pEx123. The EcoRVBstXI fragment from pEx123 (promoter of ex1-ex1:ex2:ex3
fragment) was inserted in pKR150 (Redding et al. 1998) digested with AflII (blunted) and BstXI.
The aadA-control plasmid (pOS200) is derived from
psaA-i (pOS200) by digestion with StuI and AleI and
religation, removing the promoter of exon 1 as well as
exons 1 and 2.
The cosmids used to complement the mutants are from
an ordered cosmid library (Zhang et al. 1994; Perron et al.
1999; Rivier et al. 2001; Merendino et al. 2006).
Transformation
Chlamydomonas cells were transformed by Helium-gun bombardment with cosmids containing nuclear genomic DNA or
chloroplast transformation vectors psaA-i (pOS200) or
pOS200 (see above). Nuclear transformants were selected
on HSM plates for photoautotrophic growth; chloroplast
transformants were selected on TAP plates supplemented
with 100 g/ ml spectinomycin (pOS200 and pOS200).
They were grown under illumination (60 E m2 s1), subcultured several times to obtain homoplasmic strains and genotyped by PCR as follows.
Genotyping
Homoplasmicity of the chloroplast insertions was determined
by PCR (supplementary figs. S1 and S2, Supplementary
Material online) on total DNA extracts (Cao et al. 2009)
using the following protocol: 5 min at 95 C/40 cycles
(1 min at 95 C, 1 min at 54–60 C [depending on the Tm
of the oligos], 1 min at 72 C)/7 C.
The absence of the parental genome (where psaA exon3 is
flanked by the 30 -part of split intron 2 rather than exon2) is
revealed with the primers “psaA ex3 50 -UTR for” (gtgaaaattgcatgcacggctcttaag) and “psaA ex3 rev” (ggagcagctttgtggtagtggaac) (Tm 60 C) that give a PCR1 product of 290 bp with
WT DNA and 850 bp with transformed DNA. For psaA-i
(pOS200) transformants, the presence of the intron-less psaA
MBE
By-pass of psaA Trans-splicing . doi:10.1093/molbev/msu215
gene is revealed with the primers “psaAfor1” (atgacaattagtactccagagcg) and “psaArev1” (accaacgtgaccttcacc)
(Tm 54 C) that give a PCR product of 1,000 bp (PCR2) consisting of exon 1, exon 2, and a part of exon 3.
For aadA-control pOS200 transformants, the primers
“Prom cyt rev” (gcatgactagttattcctatgacactc) and “exon3for”
(Tm54 C) (cacgtgctttaagtattactcaagg) give a PCR product of
476 bp in the presence of the WT genome. The primers
“pOS200 for2” (gcatgcaaaaagtagcattacgtaaag) and “aadA
Prom seq” (ggaagccgaagtttccaaaaggtc) give a PCR product
(Tm 58 C) of 1,127 bp in the presence of transformed
genome.
RNA Analysis
Chlamydomonas cells from 50-ml cultures (2 106 cells/ ml)
were harvested by centrifugation and washed once with 10 ml
of 20 mM Tris pH 7.9, and the pellets were stored at 70 C.
For RNA extraction, 5 ml of Tri Reagent (Sigma-Aldrich,
Chemie, Buchs, Switzerland) and 500 l of glass beads
(G8772; Sigma-Aldrich) were added to the frozen pellets,
and the suspensions were vigorously agitated for 2 min. The
homogenates were split into 5 Phase Lock Gel tubes (5 PRIME,
Hamburg, Germany). 400 l of chloroform was added followed by thorough mixing. After 10-min centrifugation at
14,000 g at 4 C, 200 l of chloroform was added followed
by thorough mixing. After 10 -min centrifugation at
14,000 g at 4 C, the RNA was precipitated from the aqueous phase with 1-ml isopropanol, collected by centrifugation
and washed with 70% ethanol. Total RNA (5 g) was analysed
by formaldehyde agarose gel electrophoresis, transfer to
Nylon membranes and hybridization using probes labeled
with 32P-dATP by random priming (Ausubel et al. 1998).
Protein Analysis
Chlamydomonas cells (5 ml, 2 106 cells/ ml) were collected
by centrifugation, washed with water, and resuspended in
lysis buffer (100 mM Tris–HCl pH 6.8, 4% SDS, 20 mM
EDTA, protease inhibitor cocktail [Sigma-Aldrich]). After
30 min at room temperature, cell debris were removed by
centrifugation, and total proteins were analysed by SDS–
PAGE (12% acrylamide) and immunoblotting. Labeling of
the membranes with antisera against PsaA (subunit PSI),
CF1 (subcomplex of chloroplast ATP synthase), D1 (PsbA
subunit of PSII), or DnaJ was carried out at room temperature
in 1 Tris-Buffered Saline (50-mM Tris–HCl pH 7.6, 150-mM
NaCl), 0.1% Tween 20 and 5% nonfat powder milk. After
washing the membranes, the antibodies were revealed with
a peroxidase-linked secondary antibody (Promega, Amriswil,
Switzerland) and visualized by enhanced chemiluminescence.
Supplementary Material
Supplementary figures S1–S6 are available at Molecular
Biology and Evolution online (http://www.mbe.oxfordjour
nals.org/).
Acknowledgments
This work was supported by the Swiss National Science
Foundation (grants 31003A_146300 and 3100A0-117712).
The authors thank Jean-David Rochaix and Geoffrey Fucile
for their comments on the manuscript, and Nicolas Roggli for
preparing the figures.
References
Akins RA, Lambowitz AM. 1987. A protein required for splicing group I
introns in Neurospora mitochondria is mitochondrial tyrosyl-tRNA
synthetase or a derivative thereof. Cell 50:331–345.
Auchincloss AH, Zerges W, Perron K, Girard-Bascou J, Rochaix JD. 2002.
Characterization of Tbc2, a nucleus-encoded factor specifically required for translation of the chloroplast psbC mRNA in
Chlamydomonas reinhardtii. J Cell Biol. 157:953–962.
Ausubel FA, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA,
Struhl K. 1998. Current protocols in molecular biology. New York:
John Wiley & Sons.
Balczun C, Bunse A, Hahn D, Bennoun P, Nickelsen J, Kuck U. 2005. Two
adjacent nuclear genes are required for functional complementation
of a chloroplast trans-splicing mutant from Chlamydomonas reinhardtii. Plant J. 43:636–648.
Barkan A. 2011. Expression of plastid genes: organelle-specific elaborations on a prokaryotic scaffold. Plant Physiol. 155:1520–1532.
Barkan A, Goldschmidt-Clermont M. 2000. Participation of nuclear
genes in chloroplast gene expression. Biochimie 82:559–572.
Barkan A, Rojas M, Fujii S, Yap A, Chong YS, Bond CS, Small I. 2012.
A combinatorial amino acid code for RNA recognition by pentatricopeptide repeat proteins. PLoS Genet. 8:e1002910.
Barkan A, Small I. 2014. Pentatricopeptide repeat proteins in plants.
Annu Rev Plant Biol. 65:415–442.
Boudreau E, Nickelsen J, Lemaire SD, Ossenbuhl F, Rochaix JD. 2000. The
Nac2 gene of Chlamydomonas encodes a chloroplast TPR-like protein involved in psbD mRNA stability. EMBO J. 19:3366–3376.
Cao M, Fu Y, Guo Y, Pan J. 2009. Chlamydomonas (Chlorophyceae)
colony PCR. Protoplasma 235:107–110.
Choquet Y, Goldschmidt-Clermont M, Girard-Bascou J, Kuck U,
Bennoun P, Rochaix JD. 1988. Mutant phenotypes support a
trans-splicing mechanism for the expression of the tripartite psaA
gene in the C. reinhardtii chloroplast. Cell 52:903–913.
Choquet Y, Wollman FA. 2002. Translational regulations as specific traits
of chloroplast gene expression. FEBS Lett. 529:39–42.
Choquet Y, Wollman FA. 2009. The CES process. In: Stern D, Harris EH,
editors. The Chlamydomonas sourcebook: organellar and metabolic
processes. Oxford: Academic Press. p. 1027–1064.
Covello PS, Gray MW. 1993. On the evolution of RNA editing. Trends
Genet. 9:265–268.
de Longevialle AF, Small ID, Lurin C. 2010. Nuclearly encoded splicing
factors implicated in RNA splicing in higher plant organelles. Mol
Plant. 3:691–705.
Drager RG, Girard-Bascou J, Choquet Y, Kindle KL, Stern DB. 1998. In
vivo evidence for 5’– 4 3’ exoribonuclease degradation of an unstable chloroplast mRNA. Plant J. 13:85–96.
Eberhard S, Drapier D, Wollman FA. 2002. Searching limiting steps in the
expression of chloroplast-encoded proteins: relations between gene
copy number, transcription, transcript abundance and translation
rate in the chloroplast of Chlamydomonas reinhardtii. Plant J. 31:
149–160.
Eberhard S, Finazzi G, Wollman FA. 2008. The dynamics of photosynthesis. Ann Rev Genet. 42:463–515.
Eberhard S, Loiselay C, Drapier D, Bujaldon S, Girard-Bascou J, Kuras R,
Choquet Y, Wollman FA. 2011. Dual functions of the nucleusencoded factor TDA1 in trapping and translation activation of
atpA transcripts in Chlamydomonas reinhardtii chloroplasts. Plant
J. 67:1055–1066.
2705
Lefebvre-Legendre et al. . doi:10.1093/molbev/msu215
Ghulam MM, Courtois F, Lerbs-Mache S, Merendino L. 2013. Complex
processing patterns of mRNAs of the large ATP synthase operon in
Arabidopsis chloroplasts. PLoS One 8:e78265.
Girard-Bascou J, Pierre Y, Drapier D. 1992. A nuclear mutation affects the
synthesis of the chloroplast psbA gene production Chlamydomonas
reinhardtii. Curr Genet. 22:47–52.
Glanz S, Jacobs J, Kock V, Mishra A, Kuck U. 2012. Raa4 is a trans-splicing
factor that specifically binds chloroplast tscA intron RNA. Plant J. 69:
421–431.
Glanz S, Kuck U. 2009. Trans-splicing of organelle introns—a detour to
continuous RNAs. Bioessays 31:921–934.
Goldschmidt-Clermont M. 1991. Transgenic expression of aminoglycoside adenine transferase in the chloroplast: a selectable marker of
site-directed transformation of Chlamydomonas. Nucleic Acids Res.
19:4083–4089.
Goldschmidt-Clermont M, Choquet Y, Girard-Bascou J, Michel F,
Schirmer-Rahire M, Rochaix JD. 1991. A small chloroplast RNA
may be required for trans-splicing in Chlamydomonas reinhardtii.
Cell 65:135–143.
Goldschmidt-Clermont M, Girard-Bascou J, Choquet Y, Rochaix JD.
1990. Trans-splicing mutants of Chlamydomonas reinhardtii. Mol
Gen Genet. 223:417–425.
Gray MW, Lukes J, Archibald JM, Keeling PJ, Doolittle WF. 2010. Cell
biology. Irremediable complexity? Science 330:920–921.
Greiner S, Rauwolf U, Meurer J, Herrmann RG. 2011. The role of plastids
in plant speciation. Mol Ecol. 20:671–691.
Hahn D, Nickelsen J, Hackert A, Kuck U. 1998. A single nuclear locus is
involved in both chloroplast RNA trans-splicing and 3’ end processing. Plant J. 15:575–581.
Hammani K, Bonnard G, Bouchoucha A, Gobert A, Pinker F, Salinas T,
Giege P. 2014. Helical repeats modular proteins are major players for
organelle gene expression. Biochimie 100:141–150.
Hohner R, Barth J, Magneschi L, Jaeger D, Niehues A, Bald T, Grossman
A, Fufezan C, Hippler M. 2013. The metabolic status drives acclimation of iron deficiency responses in Chlamydomonas reinhardtii as
revealed by proteomics based hierarchical clustering and reverse
genetics. Mol Cell Proteomics. 12:2774–2790.
Holloway SP, Herrin DL. 1998. Processing of a composite large subunit
rRNA. Studies with chlamydomonas mutants deficient in maturation
of the 23s-like rrna. Plant Cell 10:1193–1206.
Jacobs J, Marx C, Kock V, Reifschneider O, Franzel B, Krisp C, Wolters D,
Kuck U. 2013. Identification of a chloroplast ribonucleoprotein
complex containing trans-splicing factors, intron RNA, and novel
components. Mol Cell Proteomics. 12:1912–1925.
Jenkins BD, Barkan A. 2001. Recruitment of a peptidyl-tRNA hydrolase
as a facilitator of group II intron splicing in chloroplasts. EMBO J. 20:
872–879.
Johanningmeier U, Heiss S. 1993. Construction of a Chlamydomonas
reinhardtii mutant with an intronless psbA gene. Plant Mol Biol.
22:91–99.
Johnson X, Wostrikoff K, Finazzi G, Kuras R, Schwarz C, Bujaldon S,
Nickelsen J, Stern DB, Wollman FA, Vallon O. 2010. MRL1, a conserved pentatricopeptide repeat protein, is required for stabilization
of rbcL mRNA in Chlamydomonas and Arabidopsis. Plant Cell 22:
234–248.
Ke J, Chen RZ, Ban T, Zhou XE, Gu X, Tan MH, Chen C, Kang Y, Brunzelle
JS, Zhu JK, et al. 2013. Structural basis for RNA recognition
by a dimeric PPR-protein complex. Nat Struct Mol Biol. 20:
1377–1382.
Kleinknecht L, Wang F, Stube R, Philippar K, Nickelsen J, Bohne AV.
2014. RAP, the sole octotricopeptide repeat protein in Arabidopsis, is
required for chloroplast 16S rRNA maturation. Plant Cell 26:
777–787.
Kuchka MR, Goldschmidt-Clermont M, van Dillewijn J, Rochaix JD. 1989.
Mutation at the Chlamydomonas nuclear NAC2 locus specifically
affects stability of the chloroplast psbD transcript encoding polypeptide D2 of PS II. Cell 58:869–876.
K€uck U, Choquet Y, Schneider M, Dron M, Bennoun P. 1987. Structural
and transcription analysis of the two homolgous genes for the P700
2706
MBE
chlorophyll a-apoprotein in Chlamydomonas reinhardtii: evidence
for in vivo trans-splicing. EMBO J. 6:2185–2195.
Lambowitz AM, Zimmerly S. 2004. Mobile group II introns. Annu Rev
Genet. 38:1–35.
Loizeau K, Qu Y, Depp S, Fiechter V, Ruwe H, Lefebvre-Legendre L,
Schmitz-Linneweber C, Goldschmidt-Clermont M. 2014. Small
RNAs reveal two target sites of the RNA-maturation factor Mbb1
in the chloroplast of Chlamydomonas. Nucleic Acids Res. 42:
3286–3297.
Lukes J, Archibald JM, Keeling PJ, Doolittle WF, Gray MW. 2011. How a
neutral evolutionary ratchet can build cellular complexity. IUBMB
Life 63:528–537.
Lynch M. 2007. The origins of genome architecture. Sunderland (MA):
Sinauer Associates, Inc.
Lynch M, Bobay LM, Catania F, Gout JF, Rho M. 2011. The repatterning
of eukaryotic genomes by random genetic drift. Annu Rev Genomics
Hum Genet. 12:347–366.
Lyska D, Meierhoff K, Westhoff P. 2013. How to build functional thylakoid membranes: from plastid transcription to protein complex
assembly. Planta 237:413–428.
Maier UG, Bozarth A, Funk HT, Zauner S, Rensing SA, SchmitzLinneweber C, Borner T, Tillich M. 2008. Complex chloroplast
RNA metabolism: just debugging the genetic programme? BMC
Biol. 6:36.
Merendino L, Perron K, Rahire M, Howald I, Rochaix JD, GoldschmidtClermont M. 2006. A novel multifunctional factor involved in
trans-splicing of chloroplast introns in Chlamydomonas. Nucleic
Acids Res. 34:262–274.
Millar AH, Heazlewood JL, Kristensen BK, Braun HP, Moller IM. 2005.
The plant mitochondrial proteome. Trends Plant Sci. 10:36–43.
Minagawa J, Crofts A. 1994. A robust protocol for site-directed mutagenesis of the D1 protein in Chlamydomonas reinhardtii. Photosynth
Res. 42:121–131.
Monod C, Goldschmidt-Clermont M, Rochaix JD. 1992. Accumulation
of chloroplast psbB RNA requires a nuclear factor in
Chlamydomonas reinhardtii. Mol Gen Genet. 231:449–459.
Moseley JL, Allinger T, Herzog S, Hoerth P, Wehinger E, Merchant S,
Hippler M. 2002. Adaptation to Fe-deficiency requires remodeling of
the photosynthetic apparatus. EMBO J. 21:6709–6720.
Naumann B, Stauber EJ, Busch A, Sommer F, Hippler M. 2005. N-terminal processing of Lhca3 Is a key step in remodeling of the photosystem I-light-harvesting complex under iron deficiency in
Chlamydomonas reinhardtii. J Biol Chem. 280:20431–20441.
Nickelsen J, Fleischmann M, Boudreau E, Rahire M, Rochaix JD. 1999.
Identification of cis-acting RNA leader elements required for chloroplast psbD gene expression in Chlamydomonas. Plant Cell. 11:
957–970.
Peeters NM, Hanson MR. 2002. Transcript abundance supercedes editing efficiency as a factor in developmental variation of chloroplast
gene expression. RNA 8:497–511.
Perron K, Goldschmidt-Clermont M, Rochaix JD. 1999. A factor related
to pseudouridine synthases is required for chloroplast group II
intron trans-splicing in Chlamydomonas reinhardtii. EMBO J. 18:
6481–6490.
Petersen K, Schottler MA, Karcher D, Thiele W, Bock R. 2011.
Elimination of a group II intron from a plastid gene causes a
mutant phenotype. Nucleic Acids Res. 39:5181–5192.
Pfalz J, Bayraktar OA, Prikryl J, Barkan A. 2009. Site-specific binding of a
PPR protein defines and stabilizes 5’ and 3’ mRNA termini in chloroplasts. EMBO J. 28:2042–2052.
Rahire M, Laroche F, Cerutti L, Rochaix JD. 2012. Identification of an OPR
protein involved in the translation initiation of the PsaB subunit of
photosystem I. Plant J. 72:652–661.
Raynaud C, Loiselay C, Wostrikoff K, Kuras R, Girard-Bascou J, Wollman
FA, Choquet Y. 2007. Evidence for regulatory function of nucleusencoded factors on mRNA stabilization and translation in the chloroplast. Proc Natl Acad Sci U S A. 104:9093–9098.
Redding K, MacMillan F, Leibl W, Brettel K, Hanley J, Rutherford AW,
Breton J, Rochaix JD. 1998. A systematic survey of conserved
By-pass of psaA Trans-splicing . doi:10.1093/molbev/msu215
histidines in the core subunits of photosystem I by site-directed
mutagenesis reveals the likely axial ligands of P700. EMBO J. 17:
50–60.
Rivier C. 2000. Characterization of a factor involved in the trans-splicing
of a chloroplast tripartite group II intron from Chlamydomonas
reinhardtii. PhD dissertation. Geneva: University of Geneva.
Rivier C, Goldschmidt-Clermont M, Rochaix JD. 2001. Identification
of an RNA-protein complex involved in chloroplast group II
intron trans-splicing in Chlamydomonas reinhardtii. EMBO J. 20:
1765–1773.
Rochaix JD, Kuchka M, Mayfield S, Schirmer-Rahire M, Girard-Bascou J,
Bennoun P. 1989. Nuclear and chloroplast mutations affect the
synthesis or stability of the chloroplast psbC gene product in
Chlamydomonas reinhardtii. EMBO J. 8:1013–1021.
Rochaix JD, Mayfield S, Goldschmidt-Clermont M, Erickson J. 1988.
Molecular biology of Chlamydomonas. In: Shaw CH, editor. Plant
molecular biology, a practical approach. Oxford: IRL Press.
Schmitz-Linneweber C, Kushnir S, Babiychuk E, Poltnigg P, Herrmann
RG, Maier RM. 2005. Pigment deficiency in nightshade/tobacco
cybrids is caused by the failure to edit the plastid ATPase alphasubunit mRNA. Plant Cell 17:1815–1828.
Schmitz-Linneweber C, Small I. 2008. Pentatricopeptide repeat proteins:
a socket set for organelle gene expression. Trends Plant Sci. 13:
663–670.
Seraphin B, Boulet A, Simon M, Faye G. 1987. Construction of a yeast
strain devoid of mitochondrial introns and its use to screen nuclear
genes involved in mitochondrial splicing. Proc Natl Acad Sci U S A.
84:6810–6814.
Shikanai T, Fujii S. 2013. Function of PPR proteins in plastid gene
expression. RNA Biol. 10:1446–1456.
Spreitzer RJ, Ogren WL. 1983. Nuclear suppressors of the photosensitivity associated with defective photosynthesis in Chlamydomonas
reinhardii. Plant Physiol. 71:35–39.
Stern DB, Goldschmidt-Clermont M, Hanson MR. 2010. Chloroplast
RNA metabolism. Annu Rev Plant Biol. 61:125–155.
MBE
Terauchi AM, Peers G, Kobayashi MC, Niyogi KK, Merchant SS. 2010.
Trophic status of Chlamydomonas reinhardtii influences the impact
of iron deficiency on photosynthesis. Photosynth Res. 105:39–49.
Tourasse NJ, Choquet Y, Vallon O. 2013. PPR proteins of green algae.
RNA Biol. 10:1526–1542.
Vaistij FE, Boudreau E, Lemaire SD, Goldschmidt-Clermont M, Rochaix
JD. 2000. Characterization of Mbb1, a nucleus-encoded tetratricopeptide-like repeat protein required for expression of the chloroplast psbB/psbT/psbH gene cluster in Chlamydomonas reinhardtii.
Proc Natl Acad Sci U S A. 97:14813–14818.
Vaistij FE, Goldschmidt-Clermont M, Wostrikoff K, Rochaix JD. 2000.
Stability determinants in the chloroplast psbB/T/H mRNAs of
Chlamydomonas reinhardtii. Plant J. 21:469–482.
Watkins KP, Kroeger TS, Cooke AM, Williams-Carrier RE, Friso G, Belcher
SE, van Wijk KJ, Barkan A. 2007. A ribonuclease III domain protein
functions in group II intron splicing in maize chloroplasts. Plant Cell
19:2606–2623.
Wei L, Derrien B, Gautier A, Houille-Vernes L, Boulouis A, Saint-Marcoux
D, Malnoe A, Rappaport F, de Vitry C, Vallon O, et al. 2014. Nitric
oxide-triggered remodeling of chloroplast bioenergetics and thylakoid proteins upon nitrogen starvation in Chlamydomonas reinhardtii. Plant Cell 2014:353–372.
Wostrikoff K, Stern D. 2007. Rubisco large-subunit translation is autoregulated in response to its assembly state in tobacco chloroplasts.
Proc Natl Acad Sci U S A. 104:6466–6471.
Yagi Y, Hayashi S, Kobayashi K, Hirayama T, Nakamura T. 2013.
Elucidation of the RNA recognition code for pentatricopeptide
repeat proteins involved in organelle RNA editing in plants. PLoS
One 8:e57286.
Yin P, Li Q, Yan C, Liu Y, Liu J, Yu F, Wang Z, Long J, He J, Wang HW, et al.
2013. Structural basis for the modular recognition of single-stranded
RNA by PPR proteins. Nature 504:168–171.
Zhang H, Herman PL, Weeks DP. 1994. Gene isolation through genomic
complementation using an indexed library of Chlamydomonas reinhardtii DNA. Plant Mol Biol. 24:663–672.
2707