* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Bio Unit 7b DNA packet
Human genome wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
Polyadenylation wikipedia , lookup
Cancer epigenetics wikipedia , lookup
SNP genotyping wikipedia , lookup
Nucleic acid tertiary structure wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Microevolution wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Genealogical DNA test wikipedia , lookup
DNA polymerase wikipedia , lookup
DNA vaccination wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Molecular cloning wikipedia , lookup
Epigenomics wikipedia , lookup
Transfer RNA wikipedia , lookup
Frameshift mutation wikipedia , lookup
History of genetic engineering wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
History of RNA biology wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Non-coding RNA wikipedia , lookup
Non-coding DNA wikipedia , lookup
DNA supercoil wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Expanded genetic code wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Helitron (biology) wikipedia , lookup
Messenger RNA wikipedia , lookup
Point mutation wikipedia , lookup
Genetic code wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Epitranscriptome wikipedia , lookup
DNA Replication Questions 1. What are the 3 parts of a DNA nucleotide? 2. List the 4 nitrogen bases which make up DNA. 3. What type of bond holds the DNA strands together? 4. What “unzips” the DNA molecule? 5. If the following were part of a DNA chain, list the complementary bases necessary to pa them to replicate the chain: A T C G C C T T A C A A T C G G 6. Describe how the two new DNA copies are like the original DNA. Label the following parts on the DNA Replication below: Replication Fork, Parent Strand, N Strand. Draw in the following on the DNA Replication model below: DNA Polymerase, Helicase 12 13 STUDY GUIDE DNA Match the statements on the left with the terms on the right by writing the correct letter in each blank. c _____ 1. units that make up proteins a. deoxyribose d _____ 2. used to demonstrate that the DNA molecule is a helix b. ribosomes b _____ 3. where messenger RNA attaches during protein construction c. amino acids j _____ 4. pairs with cytosine d. X rays a _____ 5. sugar molecules in DNA e. Watson and Crick i _____ 6. the part of DNA that directs the making of a specific protein f. Franklin f _____ 7. discovered DNA was a strand of molecules in a spiral form g. RNA h _____ 8. used to build cells and tissues h. protein e _____ 9. made a working model of the DNA molecule i. gene g 10. contains uracil _____ j. guanine Complete the following sentences using the appropriate words from the textbook. traits 11. Hair color and freckles are both ______________________________ . 12. During the making of a protein, amino acids are brought to the ribosome by transfer RNA or tRNA ______________________________ . sugar or deoxyribose 13. The “handrails” of each DNA strand are made up of ______________________________ and phosphate groups ______________________________ . mutation 14. Any permanent change in the genetic material of a cell is called a _______________________ . nitrogen bases 15. DNA strands held together by ______________________________ are separated by an enzyme ______________________________ when DNA copies itself. protein 16. Changes in the order of amino acids will change the ___________________________ produced. Messenger RNA or mRNA 17. ______________________________ carries the code for amino acids. Genes 18. ______________________________ control proteins that build cells and tissues and work as enzymes. double spiral 19. The shape of a DNA molecule is a ______________________________ . Copyright © Glencoe/ McGraw-Hill, a division of The McGraw-Hill Companies, Inc. 19 14 RNA: Structure and Function • RNA stands for _____________________________________ • “________________” instructions from _______code Structure • Made of _________________________________ • -Sugar (_________________) • -Phosphate Group (______________________ + _______________________) • -Nitrogen Bases: 3 Differences between DNA & RNA 1. 2. 3. 3 Types of RNA 1. Messenger RNA (___________) Carries ____________________ of instructions for assembling ______________________ 2. Ribosomal RNA (____________) Make up _______________________, where ____________________ are assembled 3. Transfer RNA (_____________) Transfers _______________ ______________ to the ____________________ as coded by the mRNA Steps of Protein Synthesis 1. Transcription: 2. Translation: Transcription • A ______________________ sequence of ________ is copied into a complimentary sequence in __________ • Synthesis of ____________ • _________is located in the ___________________ • ________ copies ____________ • _______________ leaves the _______________ and travels through the cytoplasm to the ____________________ 15 • ___________ complements known as _____________ (only _____ nucleotide “letters” long) • Remember RNA has _________________ instead of ____________________ 5 Steps to Transcription 1. RNA polymerase binds to ________ in the nucleus and separates the ________ strands 2. RNA polymerase uses _____ strand of the ______ as a template and complimentary _______ nucleotides are assembled into single stranded ________ 3. The ______ strand of ___________ separates from the ________ 4. The ____ strands of _______ reunite 5. The _________ leaves the _________________, moving into the __________________ Genetic Code • Polypeptides: • ________ different AA’s (Amino Acids) can combine to form a ____________________ • Codon: ______ consecutive nucleotides on _________ that specify a single amino acid • _______ possible codons. Certain codons code for “start” or “stop” the protein • Transcription Step 1: Write the complimentary DNA strand A • C G T A T C G C G T A Transcription Step 2: Using the first template DNA strand, write the complimentary RNA sequence A C G T A T C G C G T A Translation Overview • ______________ is decoded into a polypeptide ________________ • _____________ uses mRNA to synthesizes a ______________ • Codon – ____ consecutive bases on ________ • Anti-codon – ______ bases on ________ that are complimentary to the ________ codon Carries ______ kind of amino acid 10 Steps to Translation 1. mRNA leaves the _________________, attaches to a ribosome in the ____________________ 2. ______________finds the start codon (______) 16 3. _________ with the anti-codon (complimentary to the mRNA start codon) brings in the __________ amino acid 4. The ________________ moves down the __________ to the next codon; __________ anti-codon brings in the ____________amino acid 5. Peptide bond forms between the ______ amino acids 6. Ribosome ________________ the ________ from the ________ 7. The tRNA ______________ away from the ribosome, leaving the _____________ ____________ behind 8. The next ____________ enters and binds to the next ____________ on the mRNA 9. Adding of amino acids and releasing of tRNA continues; this forms a __________________ ______________ 10. ___________________________ ends when the ribosome reaches a ________ codon ***A new polypeptide chain of protein is now complete. Decoding Chart ________________ codon is used in a decoder chart to determine the ________________ amino acid Start in the _____________ and work your way ________ UCC GAC CCA Phenylalanine Arginine What would be the complementary DNA strand for the following DNA sequence? CGTATG Mutation Heritable change in the ____________________________ that affects genetic information. What do we do if there is a change? • Some changes cause _______________ • ____________ are non-lethal - Important for diversity (survival of the fittest) How many genes do this? • Any gene has the _________________ to mutate • Can happen anywhere (______________________________________________) • Only mutations that happen in the _________ or ________ may be passed on to your children • Most mutations don’t change your body’s function, these are called ____________ mutations 17 Types of mutations • Deletion – one or more bases __________________. • Duplication – extra ___________ of bases added. • Inversion – bases are ________________________ • Translocation – _______________ are moved What causes a mutation? • Copying mistakes during replication. – Mutations are a natural part of the cellular process reproduction. The cell has tools that catch and repair __________% of mutations. • Other factors may cause extra mutations to occur or damage the “catch and repair” mechanism • Some mutations are the ____________ hit to a cell, for example freckles have a mutation already and another mutation makes the cell potentially cancerous (doublewhammy) What are the other factors? • These ____________ may include: – radiation – chemical _______________ – UV light (_______________) How do I stop this? We are all mutants. The best way to prevent excessive and dangerous mutations is to avoid prolonged UV light from the sun (use sunblock), avoid pesticides and other mutagens, and limit radiation levels to federally acceptable levels. 18 Name Period ________ 1. What is the mRNA strand that would be copied from this DNA strand? G G C T A T A T C C T G C G C T A T A C G C T A . 2. The m in mRNA stands for 3. What is the function of mRNA? 4. Draw a picture of the building block of RNA, called a . 5. In your picture label the following parts – ribose sugar, base, and phosphate group. 6. What are three differences between RNA and DNA? 7. What are the three types of RNA? (use both the abbreviations and names) 8. If the following strand is a tRNA, what is the sequence of the DNA strand it copied itself from? U U A G C G C G G G A U U A A 19 G C U C G A A U A 9. What is the function of tRNA? 10. Proteins are made up of _______________________________, which our bodies either make or come from our food. 11. What does a rRNA do? 12. Name the two places in the cell where you can find RNA. 13. Name the place in the cell where you can find DNA. 14. Draw an mRNA strand that would complement the DNA strand CCAAT. 15. In your picture above, circle an RNA nucleotide. 16. What are the four steps of transcription? 17. Both DNA and mRNA carry information for making things – How is this information carried so that the correct products are made? 20 Name: _______________________ Row: _______ Date:_____________ Period:______ Protein Synthesis Worksheet Directions: 1st Fill in the complimentary DNA strand using DNA base pairing rules. 2nd Fill in the correct mRNA bases by transcribing the bottom DNA code. 3rd Translate the mRNA codons and find the correct amino acid using the Codon Table 4th Write in the amino acid and the correct anti-codon the tRNA molecule. 5th The answer to the questions about protein synthesis below the amino acids. A T G G T A G C T A A C C T T C G A T 1. 2. 3. 4. 5. mRNA is synthesized in translation or transcription? 6. mRNA has codons or anti-codons? C A G G A A T T G C T 7. 8. 9. 10. 21 T T T C A A T C G A C C A A C 11. 12. 13. 14. 15. 1 or 3 codons equal one amino acid? 16. tRNA brings amino acids to the nucleus or ribosome? 17. A polypeptide is a sequence of proteins or amino acids? 18. tRNA has codons or anti-codons? 19. tRNA transfers amino acids during translation or transcription? 20. Ribosomes are the site where translation or transcription takes place? G T A C T C A A G G T C T A G 21. 22. 23. 24. 22 BreakingtheCode DNAReplication–Foreachofthe3DNAsequencesbelow,writethesequenceofthecomp.strand ofDNAthatresultsafterreplication. DNAMolecule#1– TACCGGATGCCAGATCAAATC ComplementaryDNA#1- _____________________ DNAMolecule#2- TACGGGGGCGTAACCACAACT ComplementaryDNA#2- _____________________ DNAMolecule#3– TACCTGTTAAGCTACAAAATT ComplementaryDNA#3- _____________________ Transcription–ForeachofthesameDNAsequencesbelow,writethesequenceofmRNAcodons thatismadeduringtranscription. DNAMolecule#1– TACCGGATGCCAGATCAAATC mRNA#1- _____________________ DNAMolecule#2- TACGGGGGCGTAACCACAACT mRNA#2- _____________________ DNAMolecule#3– TACCTGTTAAGCTACAAAATT mRNA#3- _____________________ Translation–ForeachofthemRNAcodonsequencesyouhavemade,determinethesequenceof tRNAanticodonsthatmatchit. mRNA#1- AnticodonsformRNA#1- mRNA#2- AnticodonsformRNA#2- _____________________ _____________________ _____________________ _____________________ 23 mRNA#3- _____________________ AnticodonsformRNA3- _____________________ Usingthechartbelow,writetheaminoacidsequencecodedforbyeachmRNA (Note:ThecodeisbasedonmRNAcodons,nottRNAanticodons.) Polypeptide#1-_____________________ Polypeptide#2-_____________________ Polypeptide#3-_____________________ UsethischartREADINGmRNA!! 24