Download Clustering of mandibular organ-inhibiting hormone and moult

Gene 253 (2000) 197–207
www.elsevier.com/locate/gene
Clustering of mandibular organ-inhibiting hormone and moultinhibiting hormone genes in the crab, Cancer pagurus, and
implications for regulation of expression
Weiqun Lu a, Geoffrey Wainwright a, Simon G. Webster b, Huw H. Rees a, *,
Philip C. Turner a
a School of Biological Sciences, University of Liverpool, Life Sciences Building, Crown Street, Liverpool L69 7ZB, UK
b School of Biological Sciences, University of Wales, Bangor, Gwynedd LL57 2UW, UK
Received 29 March 2000; received in revised form 15 May 2000; accepted 1 June 2000
Received by D. Finnegan
Abstract
Development and reproduction of crustaceans is regulated by a combination of neuropeptide hormones, ecdysteroids (moulting
hormones) and the isoprenoid, methyl farnesoate (MF ), the unepoxidised analogue of insect juvenile hormone-III (JH-III ). MF
and the ecdysteroids are respectively synthesised under the negative control of the sinus gland-derived mandibular organ-inhibiting
hormones (MO-IHs) and moult-inhibiting hormone (MIH ) that are produced in eyestalk neural ganglia. Previous work has
demonstrated the existence of two isoforms of MO-IH, called MO-IH-1 and -2, that differ by a single amino acid in the mature
peptide and one in the putative signal peptide. To study the structural organisation of the crab MIH and MO-IH genes, a genomic
DNA library was constructed from DNA of an individual female crab and screened with both MO-IH and MIH probes. The
results from genomic Southern blot analysis and library screening indicated that the Cancer pagurus genome contains at least two
copies of the MIH gene and three copies of the MO-IH genes. Upon screening, two types of overlapping genomic clone were
isolated. Each member of one type of genomic clone contains a single copy of each of the convergently transcribed MO-IH-1 and
MIH genes clustered within 6.5 kb. The other type contains only the MO-IH-2 gene, which is not closely linked to an MIH gene.
There are three exons and two introns in all MIH and MO-IH genes analysed. The exon–intron boundary of the crab MIH and
MO-IH genes follows Chambon’s rule (GT–AG) for the splice donor and acceptor sites. The first intron occurs within the signal
peptide region and the second intron occurs in the coding region of the mature peptide. Sequence analysis of upstream regions of
MO-IH and MIH genes showed that they contained promoter elements with characteristics similar to other eukaryotic genes.
These included sequences with high degrees of similarity to the arthropod initiator, TATA box and cAMP response element
binding protein. Additionally, putative CF1/USP and Broad Complex Z2 transcription factor elements were found in the upstream
regions of MIH and MO-IH genes respectively. The implications of the presence of the latter two putative transcription factor
binding-elements for control of expression of MIH and MO-IH genes is discussed. Phylogenetic analysis and gene organisation
show that MO-IH and MIH genes are closely related. Their relationship suggests that they represent an example of evolutionary
divergence of crustacean hormones. © 2000 Published by Elsevier Science B.V. All rights reserved.
Keywords: Ecdysteroids; Eyestalk; Juvenile hormone; Methyl farnesoate; Promoter
Abbreviations: CHH, crustacean hyperglycaemic hormone; GIH, gonad-inhibiting hormone; MF, methyl farnesoate; MIH, moult-inhibiting
hormone; MO, mandibular organ; MO-IH, mandibular organ-inhibiting hormone; RACE, rapid amplification of cDNA ends; RT-PCR, reverse
transcriptase–polymerase chain reaction.
* Corresponding author. Tel.: +44-151-794-4352; fax +44-151-794-4349.
E-mail address: [email protected] (H.H. Rees)
0378-1119/00/$ - see front matter © 2000 Published by Elsevier Science B.V. All rights reserved.
PII: S0 3 7 8 -1 1 1 9 ( 0 0 ) 0 0 28 2 - 1
198
W. Lu et al. / Gene 253 (2000) 197–207
1. Introduction
Regulation of growth and reproduction in crustaceans involves the steroidal moulting hormones, the
ecdysteroids (Chaix and De Reggi, 1982; Jegla, 1990),
and the isoprenoid, methyl farnesoate (MF ) (Laufer
et al., 1987; Wainwright et al., 1996a). The ecdysteroids
are synthesised and secreted from the Y-organs of
crustaceans under the negative control of the neuropeptide, moult-inhibiting hormone (MIH ), derived from
the X-organ-sinus gland ( XO-SG) complex in the eyestalk [for a review see Webster (1998)]. Likewise, MF
is synthesised in the mandibular organs of crustaceans
under the negative control of the XO-SG-derived neuropeptide,
mandibular
organ-inhibiting
hormone
(MO-IH ) ( Wainwright et al., 1996b; Liu et al., 1997).
MIH and MO-IH are members of the ever-expanding
crustacean hyperglycaemic hormone (CHH )/MIH/
vitellogenesis-inhibiting hormone ( VIH ) family of crustacean neuropeptides ( Webster, 1998).
In crustaceans, ecdysteroids are involved in the regulation of moulting (Spindler et al., 1980) and, in adults,
in aspects of regulation of reproductive development
(Meusy et al., 1977; Souty et al., 1982). In particular, it
has been demonstrated that physiological doses of
ecdysteroids reinitiate meiosis in arrested oocytes (Lanot
and Clédon, 1989). Reports have also supported roles
for MF in delaying the onset of moulting/
metamorphosis in larval crustaceans (Borst et al., 1987;
Smith et al., 2000) and in reproductive development. In
particular, a report has indicated that treatment of
prawn oocytes in vitro with physiological doses of MF
stimulates an increase in the size of the oocytes
( Tsukimura and Kamemoto, 1991). Additionally, there
is evidence to suggest that MF may be involved in the
differentiation of reproductive morphtypes of male
spider crabs, Libinia emarginata (Laufer et al., 1993).
In the edible crab, Cancer pagurus, MIH and MO-IH
are both 78-residue peptides possessing significant (56%)
sequence similarity to each other ( Wainwright et al.,
1996b). In fact, in this species, there are two isoforms
of MO-IH (1 and 2) that differ from each other by a
single amino acid substitution of lysine in MO-IH-1 for
a glutamine in MO-IH-2. Subsequently, sequencing of
the cDNAs encoding MO-IH-1 and -2 highlighted a
further amino acid substitution of isoleucine in MO-IH-1
for a serine in MO-IH-2 in the putative signal peptide
region ( Tang et al., 1999). The aforementioned evidence
clearly demonstrates the key roles of MIH and MO-IH
peptides in regulation of development in crustaceans,
through their regulation of ecdysteroids and MF
respectively.
In our previous work, Southern blot results suggested
a complex arrangement of MIH and MO-IH genes in
C. pagurus ( Tang et al., 1999; Lu et al., unpublished
results). Therefore, given the central role of these peptides in the regulation of growth and reproduction in
crustaceans, we now report isolation and characterisation of the genes encoding MIH, MO-IH-1 and
MO-IH-2 to further our understanding of the potential
mechanism by which expression of these genes may be
regulated. The results demonstrate that MIH and MOIH-1 genes are clustered on the same chromosome
segment within 6.5 kb of each other. Furthermore, we
have identified putative DNA regulatory elements that
may be involved in regulation of MIH, MO-IH-1 and
MO-IH-2 gene expression.
2. Materials and methods
2.1. Southern blot analysis
High molecular weight genomic DNA was isolated
from crab muscle tissue using established protocols
(Sambrook et al., 1989). For this, 10 mg samples of
DNA were digested to completion with BamHI, EcoRI,
HindIII, PvuII, MboI or TaqI and the digested DNAs
electrophoresed on a 0.7% agarose gel. The gel samples
were partially hydrolysed by acid depurination with
0.2 M HCl for 10 min, then denatured by soaking in
400 ml of 0.5 M NaOH containing 1.5 M NaCl for
45 min at room temperature and neutralised in 400 ml
of 1.0 M Tris–HCl, pH 7.4 containing 1.5 M NaCl for
45 min. The DNAs were then transferred to ElectranA
nylon blotting membranes (BDH ) using 10×SSC and
cross-linked by ultraviolet irradiation. Prehybridisation
was performed with QuikHybA solution (Stratagene)
for 15 min at 68°C, and hybridisations carried out, in
turn, with full-length cDNA probes (i.e. including the
putative 5∞-signal peptide through the entire 3∞-UTR)
encoding C. pagurus MIH (probe A; Lu et al., unpublished results) and MO-IH-1 (probe B; Tang et al.,
1999), labelled with [32P]-dCTP (ICN ), at 68°C for 1 h.
After hybridisation, the blot was washed twice in
2×SSC containing 0.1% SDS for 15 min at room temperature and then once in 0.1×SSC containing 0.1%
SDS for 30 min at 60°C, and autoradiographed at
−70°C using Fuji medical X-ray film.
2.2. Genomic library construction
Female C. pagurus were caught in the Irish Sea (off
the Island of Anglesey, North Wales, UK ) and maintained in a recirculating sea water system under ambient
conditions. A C. pagurus genomic DNA library constructed in the lambda FIXA II Vector, using muscle
DNA from a single female crab, was made commercially (Stratagene, CA, USA). For this, the genomic
DNA was partially digested with Sau3A, followed by a
partial fill-in reaction. The FIX II vector was digested
with XhoI, then partially filled in. The vector and the
insert then had compatible ends for ligation. The primary library size is 2.3×106 pfu.
W. Lu et al. / Gene 253 (2000) 197–207
2.3. Genomic DNA library screening and sub-cloning
Screening of the genomic DNA library was performed
using the manufacturer’s guidelines (Stratagene, CA,
USA) with probe A and probe B. The positive clones
were analysed by restriction digestion and Southern
blotting, using the restriction enzymes BamHI, EcoRI
and HindIII. The restriction fragments from positive
clones were sub-cloned into pBluescript II KS+ vector
using HindIII, or HindIII and BamHI restriction sites.
2.4. DNA sequence analysis
Double-stranded DNA sequencing was performed by
the dideoxy termination method using Sequenase
Version 2.0 ( USB@, Amersham Pharmacia Biotech).
Putative exon–intron boundaries were identified by comparing the gene sequences with the cDNA sequences
obtained previously ( Tang et al., 1999; Lu et al., unpublished results). DNA sequences were aligned using
DNAman software (Lynnon Biosoft, Canada) and the
transcription factor binding site search was performed
using the GenomeNet WWW server (http://pdap1.trc.
rwcp.or.jp/research/db/TFSEARCH.html ) and Pat-
199
Search version 1.1 software through the TRANSFAC
transcription factor database (http://transfac.gbfbraunschweig.de/TRANSFAC/).
2.5. 5∞-End cDNA amplification
To determine the start site of transcription, amplification of the 5∞-end of the cDNA was carried out. 5∞-End
cDNA amplification was performed using a 5∞-RACE
system (Life Technologies Inc.) for rapid amplification
of cDNA ends (RACE). First-strand cDNA synthesis
was carried out using PMIHas-1 primer (5∞-CTAGTGTTCTCCGTTGCGTCG-3∞) and PMOIHas-1 (5∞-CTAGTGTTCTCCGTTGCGTCG-3∞) primer to give
PMIHas-1-cDNA and PMO-IHas-1-cDNA respectively.
These cDNAs were tailed using terminal transferase and
dCTP to create an abridged primer binding site [oligo
(dC )] on the 3∞-end of the cDNA. The target cDNA
was amplified by PCR with the following temperature
profile: 94°C/1 min, 55°C/1 min, 72°C/2 min, using the
step–cycle program on a Hybaid DNA Thermal Cycler
in 50 ml of 50 mM KCl, 20 mM Tris–HCl, pH 8.4,
1.5 mM MgCl , 200 mM dNTP mix, containing 5 ml
2
dC-tailed cDNA and 200 pmol of each primer. The
Fig. 1. Southern blot analysis of the MIH and MO-IH genes of C. pagurus. 10 mg of C. pagurus genomic DNA was digested with a variety of
restriction enzymes ( lanes 4–9), separated by 0.7% agarose gel electrophoresis and blotted onto a nylon membrane. Hybridisation of 32P radiolabelled
MIH cDNA probes was carried out at 68°C followed by high stringency washing at 60°C. For these experiments, two different probes were used.
(A) Full-length MIH cDNA probe (nucleotides 220–1314; Lu et al., unpublished results). (B) Full-length MO-IH probe (nucleotides 32–814; Tang
et al., 1999). Lane M, l DNA digested with HindIII; lane 1, 100 pg linear MIH cDNA; lane 2, 50 pg linear MIH cDNA; lane 3, 10 pg linear MIH
cDNA; lanes 4–9, C. pagurus genomic DNA digested with TaqI, MboI, PvuII, HindIII, EcoRI and BamHI respectively. The arrows indicate same
size bands in (A) and (B).
200
W. Lu et al. / Gene 253 (2000) 197–207
PCR was performed using the antisense primers
PMIHas-2 (5∞-CTCACAGATCCATTCTACTTTCTTATAAAG-3∞) or PMOIHas-3 (5∞-CGACACCAAACACGACAGCAAC-3∞) with the Abridged Anchor
Primer (AAP; GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG, provided by the kit). The amplified
product was cloned into pGEMA-T Easy vector and
sequenced.
3. Results
3.1. Southern blot analysis of genomic DNA
To gain preliminary information on the genomic
organisation of MIH and MO-IH genes in C. pagurus,
Southern blot analysis of restriction endonucleasedigested genomic DNA was carried out, using TaqI
( lane 4), MboI ( lane 5), PvuII ( lane 6), HindIII ( lane
7), EcoRI ( lane 8) and BamHI ( lane 9). Using MIH
probe A (see Section 2.1; Fig. 1A), two bands were
detected in EcoRI-, HindIII-, MboI- and TaqI-digested
DNA. A single band was detected in BamHI- and PvuIIdigested DNA. The bands in lanes 1, 2 and 3 represent
ten, five and one copies of the MIH gene respectively.
The Southern blot membrane was washed and
re-hybridised to MO-IH probe B (see Section 2.1;
Fig. 1B). Using this probe, no band was detected in
lanes 1, 2 and 3, thus demonstrating that there was no
cross-hybridisation between MO-IH and MIH probes
under these conditions. The largest bands in lanes 4, 6,
7, 8 and 9 in Fig. 1A share the same position as the
corresponding bands in Fig. 1B.
3.2. Organisation of MIH and MO-IH genes
To determine the organisation of the MO-IH-1, -2
and MIH genes, an unamplified C. pagurus genomic
DNA library was constructed using DNA from muscle
of a single female crab, and screened using MIH and
Fig. 2. Organisation of the MIH and MO-IH genes in C. pagurus. (A) Overall maps derived from three different groups of genomic clones that
contain a single copy of each of the convergently transcribed MO-IH-1 and MIH genes. (B) Enlarged diagram for the structure of individual MIH
and MO-IH genes. The black boxes represent protein coding sequences and white boxes are introns. SP indicates signal peptide and MP indicates
mature peptide. (C ) Overall map derived from one group of genomic clones that only contain a single MO-IH-2 gene. The arrows show the gene
orientation. The MIH and MO-IH genes are represented by hatched boxes in (A) and (C ). The marked TaqI site is a variant site in different groups.
W. Lu et al. / Gene 253 (2000) 197–207
MO-IH-1 cDNA probes (probes A and B respectively;
see Section 2.1). A total of 19 positive clones was
obtained. After restriction digestion and Southern blot
analysis, the 19 clones were initially subdivided into four
groups. Nine of them, which contained a single copy of
each of the convergently transcribed MIH and MOIH-1 genes, were placed in group 1 ( Fig. 2). Five of
them, which contained a single copy of each of the
convergently transcribed MIH and MO-IH-1 genes and
a TaqI site between the genes, were placed in group 2.
Two of the clones only contained the MIH gene and
were placed in group 3. Three of them only contained
the MO-IH-2 gene and were placed in group 4. The
overall maps for each of the groups are given in Fig. 2,
from which it can be seen that groups 1–3 are overlapping examples of a single type of gene organisation but
with a polymorphic TaqI site.
3.3. MIH and MO-IH gene sequences
The gene regions of all clones were sequenced (either
directly or following sub-cloning into Bluescript vector)
by using M13 forward and reverse primers, together
with gene-specific primers. In addition, the sequence of
continuous regions of 8.5 kb from a representative group
1 clone (l1) and 4.3 kb from a representative group 4
clone (l12) were determined and are compared in Fig. 3.
The results show that there are three exons and two
introns in all MIH and MO-IH genes analysed ( Figs. 2
and 3). Exons 1 and 2 contain coding sequences for the
signal peptide, and introns of 347 bp or 785 bp separate
the two exons of the MIH and MO-IH genes respectively. Exons 2 and 3 contain the coding sequences of
the mature MIH or MO-IH peptide and are separated
by a small intron of 354 bp or 356 bp respectively
(Figs. 2 and 3). The introns were located in the same
relative positions in both the MIH and MO-IH genes.
The first intron was located between amino acid residues
Gln and Arg in the signal peptide region, and the second
intron was located within the codon for 41Arg in the
mature peptide region (Figs. 2 and 3). The exon–intron
boundaries of the crab MIH and MO-IH-1 genes also
followed the ‘GT–AG rule’ (Mount, 1982) for the splice
donor and acceptor sequences.
It seems unlikely that the promoter of the MIH gene
extends further upstream than −132 (1080 in l1; Fig. 3),
since at this point the first of several simple repeat
sequences begins (also, see Section 3.4). The 250 bp
upstream of −132 contains a perfect (GT ) repeat and
75
a (GT ) run with only three mismatches. The rest of
16
this element is very (GT ) rich. A perfect (CT ) sequence
27
is also present about 600 bp further upstream. Only
59 bp after the poly(A) signal (at 3210 in l1; Fig. 3)
there is another perfect dinucleotide repeat, comprising
a (GA) that extends to (GA) with only two mis48
60
201
matches. Thus, the MIH gene in C. pagurus seems to
have become surrounded by dinucleotide repeats.
We have sequenced 1467 bp upstream of the transcription start site of the MO-IH-1 gene in the genomic
clone, l1 and 956 bp in the MO-IH-containing clone,
l12 ( Fig. 3). There are only seven nucleotide differences
between these two regions and, unlike the MIH gene,
neither contains any simple repeat sequences. In the
2090 bp transcribed regions of MO-IH-1 and -2 [ from
+1 to the poly(A) signal ] there are only 24 nucleotide
differences and these are less frequent in coding regions
than introns. Surprisingly, 58 bp downstream of the
poly(A) signals of these genes there is a perfect
(GT ) repeat (beginning at 4883 and 1357 in l1 and
19
l12 respectively) in l12 which has only two mismatches
in l1. This is in an almost identical position to the
(GA) repeat seen downstream of the MIH poly(A)
60
signal. Approximately 250 bp further downstream of
both MO-IH genes there is a (GA) repeat, (GA) in
47
MO-IH-1 (beginning at 4581 in l1) and (GA) in MO40
IH-2 (beginning at 1057 in l12). About 1100 bp further
downstream, the (GA) repeat downstream of the MIH
60
gene is encountered as a (CT ) on the opposite strand
60
of these convergently transcribed genes.
Since the group 4 clones ( Fig. 2) do not contain MIH
genes, we sequenced l12 in the region downstream of
the MO-IH-2 gene to see at what point it ceased to be
approximately 99% identical to l1. Downstream of the
poly(A) signal the genes remain almost identical for
about 1200 bp, there being a progressive increase in base
changes and short insertions/deletions with distance
from the poly(A) signal. The sequence similarity breaks
down around this point due to the presence of a
trinucleotide repeat (CTC ) (beginning at 182 in l12)
21
with only one mismatch. There was no significant
sequence identity further downstream from this repeat.
3.4. Identification of the transcription start point
To determine the start site of transcription, 5∞-RACE
was carried out using X-organ mRNA as template. All
of the 5∞-RACE-generated MIH cDNAs were found to
terminate at the same nucleotide (see arrow at position
+1 in Fig. 4). Sequencing of the longest MO-IH
5∞-RACE products identified the nucleotide at position
+1 (see arrow) as the start site; thus, presuming that
shorter products are caused by premature termination
of cDNA synthesis, it would seem as if site +1 is used
as the transcription initiation site in each case.
3.5. Identification of putative upstream regulatory
elements
To identify any putative upstream regulatory elements, a computer analysis of the 5∞-flanking region
sequence of the MIH and MO-IH genes was carried out
202
W. Lu et al. / Gene 253 (2000) 197–207
Fig. 3. Genomic DNA sequences of the MIH and MO-IH-1 genes (l1) and the MO-IH-2 gene (l12). Nucleotide positions given are for genomic
clone l1 (1–8501 bp; EMBL accession number, AJ276104) a member of group 1 (Fig. 2) and clone l12 (1–4363 bp; EMBL accession number,
AJ276105) from group 4. For the MIH/MO-IH-1 sequence, the numbering starts 1433 bp upstream of the MIH translation start codon and
represents the left-hand limit of the sequence determined for l1 (see Fig. 2B). For the MO-IH-2 gene (l12), the numbering starts 1857 bp downstream
of the translation stop codon. The introns are enclosed by large boxes within coding regions (bold text). The putative signal peptides are shown
in italic single letter amino acid code. 1 indicates a stop codon. Putative transcription initiation start sites are indicated by arrows, TATA sequences
are boxed, cAMP response element binding (CREB) elements are underlined and arthropod initiator elements are double underlined. The polyadenylation signals are indicated by dotted, underlined letters. Regions between the coding regions that have been aligned are enclosed by large brackets.
The numbers of differences between aligned sequences (which include nucleotide substitutions, insertions or deletions) are indicated in the
aligned regions.
using the GenomeNet TFSEARCH program and the
TRANSFAC database PatSearch programme. The
matched elements included several potentially significant
motifs (Fig. 4). Sequence alignment of the upstream
regions of MO-IH and MIH genes from C. pagurus and
a putative MIH gene from the crab C. feriatus (Chan
et al., 1998) shows that all three of them contain
sequences ( TCAGC ) similar to the arthropod initiator
consensus sequence ( TCAGT; Cherbas and Cherbas,
1993) located at position +4 to +8 for MIH and +12
to +16 for MO-IH, just downstream of the presumed
transcription initiation site. This sequence shows a high
Fig. 4. Sequence analysis of the upstream regions of the MO-IH and MIH genes. Sequence alignment for the upstream regions of MO-IH and MIH from C. pagurus and MIH from the crab,
Charybdis feriatus, was performed using DNAman software. Putative binding sites for transcription factors are boxed. The arrow bar indicates the transcription initiation sites determined by
5∞-RACE. MM are the first two amino acids of the signal peptides. Numbering for each sequence indicates the transcription start site as +1.
W. Lu et al. / Gene 253 (2000) 197–207
203
204
W. Lu et al. / Gene 253 (2000) 197–207
Fig. 5. Sub-grouping of CHH family members. A schematic representation of MIH-like and CHH-like peptides is shown at the top. Below is a
cDNA sequence percentage identity tree generated using DNAman software using C. pagurus MIH and MO-IH-1 ( Tang et al., 1999; Lu et al.,
unpublished results), Cancer magister MIH ( Umphrey et al., 1998), Carcinus maenas MIH ( Klein et al., 1993), C. feriatus MIH (Chan et al.,
1998), Callinectes sapidus MIH (Lee et al., 1995), Penaeus japonicus MIH (Ohira et al., 1997), L. emarginata MO-IH (Liu et al., 1997) and C.
maenas CHH ( Weidemann et al., 1989). The MIH-like peptide sub-group is shown in a grey box.
degree of identity to the CAP signal (Bucher, 1990) for
transcription initiation. Both of the MO-IH genes and
the MIH gene contain a TATA box-like element (Bucher,
1990) and a CREB protein sequence (Benbrook and
Jones, 1994) located at 24 bp and 42 bp upstream of the
transcription initiation site respectively. Apparent ecdysone-responsive elements were detected in both C.
pagurus genes, CF1/USP ( Thummel, 1995) in the MIH
gene and Broad-Complex Z2 (von Kalm et al., 1994) in
the MO-IH gene. The foregoing computer-based analysis of upstream regions of the MIH and MO-IH genes
for the presence of promoters failed to detect EcR or
EcR-like binding elements.
3.6. Phylogenetic analysis of MIH and MO-IH cDNA
sequences
To gain an understanding of the evolutionary relatedness of the CHH/MIH/VIH peptides, phylogenetic
analysis was carried out using MIH and MO-IH cDNA
sequences together with other members of the CHH
family of neuropeptides. Both phylogenetic and
sequence similarity analyses yielded the same results for
grouping of species. The phylogenetic tree (Fig. 5) shows
that there are two main sub-groups of peptide within
this family, viz. those that are structurally more akin to
CHH, and those more akin to MIH. C. pagurus MIH
and MO-IH both fall into the MIH group.
4. Discussion
In previous work, we demonstrated that there are at
least two copies of the MIH gene and three to ten copies
of the MO-IH genes in C. pagurus ( Tang et al., 1999;
Lu et al., unpublished results). The MO-IH-1 probe
used in the foregoing work cannot distinguish between
MO-IH-1 and -2; thus, hybridising bands may represent
detection of either or both MO-IH genes ( Tang et al.,
1999). Furthermore, in the current work, comparison
of Southern blots resulting from consecutive probing
with MIH and MO-IH cDNA using the same membrane
showed that the largest bands in the TaqI, PvuII,
HindIII, EcoRI and BamHI lanes in the MIH blot share
the same positions in the MO-IH blot (Fig. 1). Since
there is no cross-hybridisation between the MO-IH and
W. Lu et al. / Gene 253 (2000) 197–207
MIH probes (see Section 3.1), this indicates that some
copies of the MIH and MO-IH genes are located close
to each other, i.e. within approximately 4.5–9.0 kb.
To elucidate the organisation of the MO-IH and
MIH genes in C. pagurus, a genomic DNA library was
constructed and clones containing MO-IH and MIH
sequences isolated by hybridisation. The result of the
screening (Fig. 2) showed that greater than 75% of the
isolated genomic clones contained a single copy of each
of the convergently transcribed MO-IH-1 and MIH
genes clustered within 6.5 kb. The remaining clones
contained only the MO-IH-2 gene, which is not closely
linked to an MIH gene. Based on the number of group
members and sequence of these clones and the variation
in restriction sites between them, the results indicate
that the C. pagurus genome contains at least two copies
of the MIH gene and at least three copies of the MOIH genes. This is consistent with our Southern blot
analysis results ( Tang et al., 1999; Lu et al., unpublished
results). Sequence analysis of the structure of the MIH
and MO-IH genes for this crab shows that they consist
of three exons and two introns (Fig. 2). The introns
occur at precisely the same positions in all of the genes,
although they are of different lengths in the MIH and
MO-IH genes; in particular, intron I is 347 bp in MIH
and 785 bp in MO-IH. The first intron occurs within
the putative signal peptide region and the second intron
occurs in the coding region of the mature peptide. The
numbers and positions of the introns in the MIH and
MO-IH genes, relative to the amino acid sequence of
the peptides, are almost identical with those of the
putative MIH gene isolated from the crab C. feriatus
(Chan et al., 1998). However, such a comparison with
the CHH gene of the shrimp, Metapenaeus ensis, shows
that only intron II is conserved in this manner (Gu and
Chan, 1998). This supports a tenet that MIH and MOIH genes are more closely related to each other than
they are to CHH genes, and given the phylogenetic
distribution and relatedness of CHHs, MIHs and
MO-IHs to each other (see below), it is likely that CHH
is the prototypical peptide of the CHH/MIH/VIH family
of neuropeptides from which the other peptides arose
through gene duplication events.
Sequence analysis of the upstream regions of the crab
MO-IH and MIH genes revealed the existence of a
number of putative promoter elements with characteristics similar to eukaryotic genes. All of the MIH and
MO-IH genes contain sequences ( TCAGC; Fig. 4) similar to the arthropod initiator consensus sequence element ( TCAGT; Cherbas and Cherbas, 1993) just
downstream of the presumed initiation site. This arthropod initiator sequence is found within the interval −10
to +10 of approximately 25% of arthropod RNA
polymerase-II-transcribed promoters, either in the presence or absence of a TATA-box (Cherbas and Cherbas,
1993). This sequence is also very similar to the CAP
205
signal for transcription initiation, normally located 28
to 32 bp downstream (centre-to-centre) of the TATAbox (Bucher, 1990). The presence of this arthropod
initiator motif also provides additional support that the
transcription start site identified by 5∞-RACE in the
MO-IH and MIH genes is actually valid. Also present
within the 50 bp upstream region of the putative transcription initiation start sites of the MO-IH and MIH
genes are sequences that correspond to a TATA boxlike element (Bucher, 1990) and CREB (Benbrook and
Jones, 1994) protein element ( Fig. 4). The latter suggests
that cAMP may be involved in regulation of expression
of these genes. Furthermore, two additional putative
promoter binding elements have been identified. In the
MIH gene, a sequence exhibiting high similarity to
chorion factor 1/ultraspiracle (CF1/USP; Thummel,
1995) binding protein response element occurs (Fig. 4).
The retinoid-X receptor ( RXR) proteins appear to be
the vertebrate equivalent of insect USP, in acting as
binding partners of nuclear hormone receptors (Henrich
and Brown, 1995; Durica et al., 1999). The presence of
a CF1/USP binding protein response element in C.
pagurus is interesting in that, thus far, only RXR-type
homologues have been isolated from crustaceans, but
these have DNA binding domains that more closely
resemble insect USP DNA binding domains (Chung
et al., 1998; Hopkins et al., 1999). In the MO-IH genes,
there is a sequence with high identity to Broad-Complex
Z2 (BR-C Z2; von Kalm et al., 1994) binding element.
The latter two putative response elements are of particular interest, considering that in insects the former
(CF1/USP) constitutes a binding partner of the ecdysteroid receptor [EcR; see Thummel (1995) for a review;
Jones and Sharp, 1997], whilst BR-C Z2 is a protein
product of the early ecdysone response in Drosophila
melanogaster (von Kalm et al., 1994). Recent reports
have provided evidence that, in insects, juvenile hormone
(a structural homologue of MF in crustaceans) modulates the activity of Broad-Complex (Restifo and Wilson,
1998) and binds to USP (Jones and Sharp, 1997). The
occurrence of these reports, and the presence of putative
CF1/USP and BR-C Z2 response elements in the
upstream regions of the MIH and MO-IH gene respectively, suggests that ecdysteroids and MF may well act
to regulate expression of MIH and MO-IH peptides. It
is interesting to note that an earlier report provided
evidence that ecdysteroids themselves may feedback and
regulate production of MIH from X-organ ( XO)
(Mattson and Spaziani, 1986). Although the authors
were measuring production of MIH activity from eyestalk ganglia and not MIH itself, or MIH gene expression, the results presented in that report provide a
possible explanation for the effects of ecdysteroids on
MIH production in XO-SG. Given the additional
CREB, it is clear that regulation of expression of these
genes is complex, and considering the importance of
206
W. Lu et al. / Gene 253 (2000) 197–207
MIH and MO-IH in regulation of growth and development, further investigation of transcriptional control of
these genes is warranted.
The genomic sequencing has shown the presence of
seven di- or tri-nucleotide repeat sequences in the 12.8 kb
of sequence determined (4.3%). In the case of the MIH
gene, simple repeats begin only 132 bp upstream of the
transcription start site and only 59 bp downstream of
the poly(A) signal. For both MO-IH genes, dinucleotide
repeats occur at an almost identical position downstream, but no repeats were present in the 1000–1500 bp
upstream. Assuming that the sequence signals required
for transcription are not present beyond the repeats,
this would suggest that there could be promoter elements
that regulate the expression of the MO-IH genes further
upstream of the transcription start than is the case
for MIH.
The MO-IH-1 and -2 genes are about 99% identical
throughout their length until they diverge just before
the 3∞ (CTC ) repeat. Since there are only seven differ21
ences in the 956 bp upstream of the transcription start
site, it is probable that these genes will show no differences in their regulation. Their near-identical sequence
and presumed regulation would suggest that they are
functionally identical. It seems likely that MO-IH-2 has
arisen from MO-IH-1 by a relatively recent gene duplication event and has subsequently accumulated nucleotide
changes to about 1%. The observation that the MO-IH-1
and -2 peptides are always found in the same relative
ratios in sinus gland tissue supports the view that they
are functionally identical and that the peptide ratios
simply reflect the copy number of the genes.
The overall structure of the MIH gene is very similar
to MO-IH: the peptides are 56% identical and the gene
sequences are 67% identical in the coding regions. This,
together with the fact that they are clustered, suggests
that these genes have also arisen by divergence following
a gene duplication event that occurred much further in
the past than the MO-IH-1 to MO-IH-2 event. With
the passage of time, they have evolved to carry out
different roles. Since MO-IH is restricted to evolutionarily more recent crabs, this duplication event may have
occurred relatively recently, presumably not earlier than
the 23 million years ago proposed for the divergence of
the Cancer genus (Harrison and Crespi, 1999).
Speciation of C. pagurus is proposed to have occurred
some 6–12 million years ago (Harrison and Crespi,
1999), and it is presumably since this speciation that
MO-IH-2 may have formed through gene duplication,
because only one MO-IH has been identified in the
other species of Cancer analysed thus far ( Tang et al.,
1999; unpublished observations).
Previous reports ( Weidemann et al., 1989; Klein et al.,
1993; Lee et al., 1995; Liu et al., 1997; Ohira et al.,
1997; Chan et al., 1998; Umphrey et al., 1998; Lacombe
et al., 1999; Tang et al., 1999; Lu et al., unpublished
results) and the current results, show the emergence of
two distinct sub-groups of the CHH/MIH/VIH family
of neuropeptides. In the Penaeid (prawn) species, neuropeptides regulating moulting and glucose levels are all
structurally similar to the prototype CHH from the
shore crab, C. maenas ( Weidemann et al., 1989), viz. 72
amino acids with blocked N- and C-termini. In evolutionary terms, more recent crustacean species appear to
possess a CHH peptide and structurally distinct MIH
and MO-IH peptides ( Tang et al., 1999; Lu et al.,
unpublished results), viz. 78 amino acids with unblocked
N- and C-termini. Phylogenetic analysis of the available
sequences of crustacean peptides serves to highlight this
hypothesis. Interestingly, in the spider crab, L. emarginata, a CHH is also responsible for MO-IH activity
(Liu et al., 1997). Thus, both phylogenetic analysis and
examination of the organisation of the MO-IH and
MIH genes in C. pagurus suggest that they are closely
related to each other. Indeed, given the conservation of
the position of intron II in the CHH, MIH and MO-IH
genes studied (Chan et al., 1998; Gu and Chan, 1998),
one could suggest that they resulted from duplication
of an ancestral CHH gene, with subsequent divergence
producing the functional MIH and MO-IHs.
Acknowledgement
This work was supported by the Biotechnology and
Biological Sciences Research Council (BBSRC ). We
thank Mr A. Tweedale and Mr S. Corrigan for the
supply and maintenance of C. pagurus.
References
Benbrook, D.M., Jones, N.C., 1994. Different binding specificities and
transactivation of variant CRES by CREB complexes. Nucleic
Acids Res. 22, 1463–1469.
Borst, D.W., Laufer, H., Landau, M., Chang, E.S., Hertz, W.A.,
Baker, F.C., Schooley, D.A., 1987. Methyl farnesoate and its role
in crustacean reproduction and development. Insect Biochem. 17,
1123–1127.
Bucher, P., 1990. Weight matrix descriptions of four eukaryotic RNA
polymerase II promoter elements derived from 502 unrelated promoter sequences. J. Mol. Biol. 212, 563–578.
Chaix, J.-C., De Reggi, M., 1982. Ecdysteroid levels during ovarian
development and embryogenesis in the spider crab Acanthonyx
lunulatus. Gen. Comp. Endocrinol. 47, 7–14.
Chan, S.-M., Chen, X.-G., Gu, P.-L., 1998. PCR cloning and expression of the molt-inhibiting hormone gene for the crab (Charybdis
feriatus). Gene 224, 23–33.
Cherbas, L., Cherbas, P., 1993. The arthropod initiator: the capsite
consensus plays an important role in transcription. Insect Biochem.
Mol. Biol. 23, 81–90.
Chung, A.C.-K., Durica, D.S., Clifton, S.W., Roe, B.A., Hopkins,
P.M., 1998. Cloning of crustacean ecdysteroid receptor and
retinoid-X receptor gene homologs and elevation of retinoid-X
W. Lu et al. / Gene 253 (2000) 197–207
receptor mRNA by retinoic acid. Mol. Cell. Endocrinol. 139,
209–227.
Durica, D.S., Chung, A.C.-K., Hopkins, P.M., 1999. Characterization
of EcR and RXR gene homologs and receptor expression during
the molt cycle in the crab, Uca pugilator. Am. Zool. 39, 758–773.
Gu, P.-L., Chan, S.-M., 1998. The shrimp hyperglycaemic hormonelike neuropeptide is encoded by multiple copies of genes arranged
in a cluster. FEBS Lett. 441, 397–403.
Harrison, M.K., Crespi, B.J., 1999. Phylogenetics of Cancer crabs
(Crustacea: Decapoda: Brachyura). Mol. Phylogenet. Evol. 12,
186–199.
Henrich, V.C., Brown, N.E., 1995. Insect nuclear receptors: a developmental and comparative perspective. Insect Biochem. Mol. Biol.
25, 881–897.
Hopkins, P.M., Chung, A.C.-K., Durica, D.S., 1999. Limb regeneration in the fiddler crab, Uca pugilator: histological, physiological
and molecular considerations. Am. Zool. 39, 513–526.
Jegla, T.C., 1990. Evidence for ecdysteroids as molting hormones in
Chelicerata, Crustacea, and Myriapoda. In: Gupta, A.P. (Ed.),
Morphogenetic Hormones of Arthropods vol. 1. Rutgers University Press, New Brunswick, pp. 227–275.
Jones, G., Sharp, P.A., 1997. Ultraspiracle: an invertebrate nuclear
receptor for juvenile hormones. Proc. Natl. Acad. Sci. U. S. A. 94,
13 499–13 503.
Klein, J.M., Mangerich, S., De Kleijn, D.P.V., Keller, R., Weidemann,
W.M., 1993. Molecular cloning of crustacean molt-inhibiting hormone (MIH ) precursor. FEBS Lett. 334, 139–142.
Lacombe, C., Greve, P., Martin, G., 1999. Overview on the sub-grouping of the crustacean hyperglycemic hormone family. Neuropeptides 33, 71–80.
Lanot, R., Clédon, P., 1989. Ecdysteroids and meiotic reinitiation in
Palaemon serratus (Crustacea, Decapoda, Natantia) and in Locusta
migratoria (Insecta, Orthoptera) — a comparative study. Inv.
Reprod. Dev. 16, 169–175.
Laufer, H., Borst, D.W., Baker, F.C., Carrasco, C., Sinkus, M.,
Reuter, C.C., Tsai, L.W., Schooley, D.W., 1987. Identification of
a juvenile hormone-like compound in a crustacean. Science 235,
202–205.
Laufer, H., Wainwright, G., Young, N.J., Sagi, A., Ahl, J.B.S., Rees,
H.H., 1993. Ecdysteroids and juvenoids in 2 male morphotypes of
Libinia emarginata. Insect Biochem. Mol. Biol. 23, 171–179.
Lee, K.J., Elton, T.S., Bej, A.K., Watts, S.A., Watson, R.D., 1995.
Molecular cloning of a cDNA encoding putative molt-inhibiting
hormone from the blue crab, Callinectes sapidus. Biochem. Biophys. Res. Commun. 209, 1126–1131.
Liu, L., Laufer, H., Wang, Y.-J., Hayes, T., 1997. A neurohormone
regulating both methyl farnesoate synthesis and glucose metabolism in a crustacean. Biochem. Biophys. Res. Commun. 237,
694–701.
Mattson, M.P., Spaziani, E., 1986. Evidence for ecdysteroid feedback
on release of molt-inhibiting hormone from crab eyestalk ganglia.
Biol. Bull. 171, 264–273.
Meusy, J.-J., Blanchet, M.F., Junéra, H., 1977. Mue et vitellogénes
chez le Crustacé Amphipode Orchestia gammarella Pallas. II.
Etude de la synthése de la vitellogénine (‘‘fraction-proteique femelle’’ de l’hémolymphe) après destruction des organs Y. Gen.
Comp. Endocrinol. 33, 35–40.
207
Mount, S.M., 1982. A catalogue of splice junction sequence. Nucleic
Acids Res. 10, 459–472.
Ohira, T., Watanabe, T., Nagasawa, H., Aida, K., 1997. Molecular
cloning of cDNA encoding four crustacean hyperglycemic hormones and a molt-inhibiting hormone from the Kuruma prawn
Penaeus japonicusin: Proceedings XIIIth International Congress of
Comparative Endocrinology, Yokohama, 83–87.
Restifo, L.L., Wilson, T.L., 1998. A juvenile hormone agonist reveals
distinct developmental pathways mediated by ecdysone-inducible
Broad Complex transcription factors. Dev. Genet. 22, 141–159.
Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. in: Molecular Cloning:
a Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, NY, pp. 9.17–9.19.
Smith, P.A., Clare, A.S., Rees, H.H., Prescott, M.C., Wainwright, G.,
Thorndyke, M.C., 2000. Identification of methyl farnesoate in the
cypris larvae of the barnacle, Balanus amphritrite and its role as a
juvenile hormone in delaying metamorphosis. Insect. Biochem.
Mol. Biol.. in press.
Souty, C., Besse, G., Picaud, J.-L., 1982. Ecdysone stimulates the rate
of vitellogenin release in hemolymph of the terrestrial crustacean
isopoda Porcellio dilatatus brandt. C. R. Acad. Sci. Ser. III 294,
1057–1059.
Spindler, K.-D., Keller, R., O’Connor, J.D., 1980. The role of ecdysteroids in the crustacean molt cycle. In: Hoffmann, J.A. ( Ed.), Progress in Ecdysone Research. Elsevier/North Holland, pp. 247–280.
Tang, C., Lu, W., Wainwright, G., Webster, S.G., Rees, H.H., Turner,
P.C., 1999. Molecular characterization and expression of mandibular organ-inhibiting hormone, a recently discovered neuropeptide
involved in regulation of growth and reproduction in the crab,
Cancer pagurus. Biochem. J. 343, 355–360.
Thummel, C.S., 1995. From embryogenesis to metamorphosis — the
regulation and function of Drosophila nuclear receptor superfamily
members. Cell 83, 871–877.
Tsukimura, B., Kamemoto, F.I., 1991. In vitro stimulation of oocytes
by presumptive mandibular organ secretions in the shrimp, Penaeus
vannamei. Aquaculture 92, 59–66.
Umphrey, H.R., Lee, K.J., Watson, R.D., Spaziani, E., 1998. Molecular cloning of a cDNA encoding molt-inhibiting hormone of the
crab, Cancer magister. Mol. Cell. Endocrinol. 136, 145–149.
Von Kalm, L., Crossgrove, K., von Seggern, D., Guild, G.M., Beckendorf, S.K., 1994. The Broad-Complex directly controls a tissuespecific response to the steroid–hormone ecdysone at the onset of
Drosophila metamorphosis. EMBO J. 13, 3505–3516.
Wainwright, G., Prescott, M.C., Rees, H.H., Webster, S.G., 1996a.
Mass spectrometric determination of methyl farnesoate profiles and
correlation with ovarian development in the edible crab, Cancer
pagurus. J. Mass Spectrom. 31, 1338–1344.
Wainwright, G., Webster, S.G., Wilkinson, M.C., Chung, J.S., Rees,
H.H., 1996b. Structure and significance of mandibular organ-inhibiting hormone in the crab, Cancer pagurus — involvement in multihormonal regulation of growth and reproduction. J. Biol. Chem.
271, 12 749–12 754.
Webster, S.G., 1998. Neuropeptides inhibiting growth and reproduction in crustaceans. In: Coast, G.M., Webster, S.G. (Eds.),
Recent Advances in Arthropod Endocrinology. Cambridge University Press, pp. 33–52.
Weidemann, W., Gromoll, J., Keller, R., 1989. Cloning and sequence
analysis of cDNA for precursor of a crustacean hyperglycemic hormone. FEBS Lett. 257, 31–34.