Download Mutations in a gene encoding a novel protein tyrosine

© 1998 Nature America Inc. • http://genetics.nature.com
letter
Mutations in a gene encoding a novel protein tyrosine
phosphatase cause progressive myoclonus epilepsy
© 1998 Nature America Inc. • http://genetics.nature.com
Berge A. Minassian1,2, Jeffrey R. Lee1, Jo-Anne Herbrick1, Jack Huizenga1, Sylvia Soder1,
Andrew J. Mungall3, Ian Dunham3, Rebecca Gardner4, Chung-yan G. Fong5, Stirling Carpenter6,
Laura Jardim7, P. Satishchandra8, Eva Andermann9, O. Carter Snead III2, Iscia Lopes-Cendes9,10,
Lap-Chee Tsui1,11, Antonio V. Delgado-Escueta5, Guy A. Rouleau9,10 & Stephen W. Scherer1,11
Lafora’s disease (LD; OMIM 254780) is an autosomal recessive
form of progressive myoclonus epilepsy characterized by
seizures and cumulative neurological deterioration. Onset
occurs during late childhood and usually results in death within
ten years of the first symptoms1,2. With few exceptions,
patients follow a homogeneous clinical course despite the existence of genetic heterogeneity3. Biopsy of various tissues,
including brain, revealed characteristic polyglucosan inclusions
called Lafora bodies4–8, which suggested LD might be a generalized storage disease6,9. Using a positional cloning approach,
we have identified at chromosome 6q24 a novel gene, EPM2A,
that encodes a protein with consensus amino acid sequence
indicative of a protein tyrosine phosphatase (PTP). mRNA transcripts representing alternatively spliced forms of EPM2A were
found in every tissue examined, including brain. Six distinct
a
Fig. 1 A physical map of the LD critical
region at 6q24. a, A YAC contig between
D6S1003 and D6S311. The presence of a
DNA marker on a YAC clone is shown by a
corresponding vertical bar; those highlighted with a circle or a square represent
genetic markers or ESTs, respectively, and
those remaining are unique landmarks
(STSs). ESTs in the LD critical region have
been provisionally named LDCR1−LDCR6.
Information on all DNA markers and
genomic DNA sequence can be found at
the Genome DataBase (http://www.gdbwww.gdb.org/) or the Sanger Center web
site (http://www.sanger.ac.uk/chr6/). The
region between D6S1003 and D6S1042
that demonstrated an extended region of
homozygosity in affected members in family LD39 is shown by the thickened horizontal bar (Fig. 2a). b, A PAC map of the
immediate region surrounding D6S1703.
The extent of the deletion could be
defined by PCR analysis of mapped STSs
(Fig. 2b). LDCR4 represents a transcript of
unidentified function. The 5´ end of
EPM2A is not yet known and is represented
with a dashed line. The presence of an HTFisland demarcated by a NotI (N) and four
BssHII (B) sites is shown.
DNA sequence variations in EPM2A in nine families, and one
homozygous microdeletion in another family, have been found
to cosegregate with LD. These mutations are predicted to cause
deleterious effects in the putative protein product, named
laforin, resulting in LD.
Previous linkage analysis and homozygosity mapping localized
an LD locus to a region at chromosome 6q23−q25 bounded by
the markers D6S1003 and D6S311 (Fig. 1; refs 10,11). We constructed a physical map across the critical region that allowed the
positioning of seven genetic markers, GRM1 and six expressed
sequence tags (ESTs; Fig. 1a). Using the genetic markers to test 30
families that appeared to be linked to chromosome 6q23−q25, we
detected a homozygous deletion in family LD-L4 that encompassed approximately 50 kb of DNA at D6S1703 (Fig. 1 and
Fig. 2a). In another consanguineous family, LD39, the extent of
Previous LD critical region
b
EPM2A
1Department of Genetics and 2Division of Neurology, Department of Paediatrics, The Hospital for Sick Children, University of Toronto, Toronto, Ontario, M5G
1X8, Canada. 3Sanger Centre, Wellcome Trust Genome Campus, Hinxton, Cambs. CB10 1SA, UK. 4Wessex Regional Genetics Laboratory, Salisbury Health
Care NHS Trust, Salisbury District Hospital, Salisbury, Wiltshire SP2 8BJ, UK. 5California Comprehensive Epilepsy Program, UCLA School of Medicine and
West Los Angeles DVA Medical Center, Los Angeles, California, USA. 6Department of Pathology, The Toronto Hospital, University of Toronto, Toronto, Ontario
M5T 2S8, Canada. 7Medical Genetics Service, Hospital de Clinicas de Porto Alegre, Porto Alegre RS 90035-003, Brazil. 8National Institute of Mental Health
and Neurosciences, Deemed University, Bangalore 560029, India. 9Department of Human Genetics, McGill University, Montreal, Quebec, Canada. 10Centre
for Research in Neuroscience, Montreal General Hospital Research Institute, Montreal, Quebec, Canada. 11Department of Molecular and Medical Genetics,
University of Toronto, Toronto, Ontario M5S 1A8, Canada. Correspondence should be addressed to S.W.S. (e-mail: [email protected]).
nature genetics volume 20 october 1998
171
letter
a
365C1.H65
D6S1703
109F4.EO.5
© 1998 Nature America Inc. • http://genetics.nature.com
dJ28H5T7
© 1998 Nature America Inc. • http://genetics.nature.com
b
D6S409
D6S308
D6S279
D6S1704
D6S1003
D6S1010
D6S1049
D6S1703
D6S1042
D6S1649
D6S978
D6S311
D6S1637
Fig. 2 Refined mapping of the gene associated with LD. a, Detection of two
markers (D6S1703 and 109F4.E0.5) determined by PCR to be absent in affected
members of the consanguineous Lafora family LD-L4. b, Pedigrees and genotype data are provided for Lafora family LD39. Individuals affected (solid) or
unaffected (open) with LD are indicated. Below each individual are the corresponding genotypes. The markers are listed in their order from centromere
(top) to telomere (bottom), as determined using the physical map (Fig. 1). The
boxed segments of the haplotypes indicate regions of homozygosity. The vertical line indicates markers contained within the EPM2A critical region.
microsatellite homozygosity suggested that the telomeric boundary of the critical region could be restricted to D6S1042 (Fig. 2b).
We determined the genomic DNA sequence of PAC clones
365C1, 466P17 and 28H5, which encompassed the deletion
(Fig. 1b). DNA sequence analysis indicated that only a single
gene, EPM2A, was deleted in family LD-L4 (Fig. 1b).
From the alignment of the DNA sequences of the ESTs and
cDNA, at least four putative types of transcripts that corresponded to EPM2A could be defined (transcripts A, B, C and D,
Fig. 3). cDNAs grouped as transcript A could be categorized based
on regions of sequence identity at their 3´ ends. A consensus
sequence was compiled that was found to be distributed among
four exons spanning approximately 100 kb (Fig. 1a, Fig. 3 and
Fig. 4). A single cDNA (266552) representing transcript B shared
identity with transcript A, except for the omission of a 1,770-bp
segment due to splicing (Figs 3, 4). The common origin of transcripts A and B suggests they are alternative forms of the same
gene, the products of which would be predicted to have unique
carboxy-terminal amino acid sequences (Fig. 4b).
Two other cDNA clones, SFB14 and 743381, which could represent additional alternative forms of EPM2A, were also identified (Fig. 3). SFB14 was contiguous with genomic DNA and
identical to the 3´ end of transcript A, although the ORF was predicted to extend 48-aa 5´ into the last intron (Fig. 3). Clone
743381 contained eight exons with appropriate exon-intron
boundaries, but its significance could not be assessed due to the
lack of continuous ORF.
A predominant hybridization band of approximately 3.2 kb
was observed in RNA blots of multiple tissues, using probes
derived from different regions of EPM2A (Fig. 5). On the basis of
northern-blot results and the relative number of ESTs identified,
it is probable that transcript A represents the major isoform of
EPM2A, and that it corresponds to the 3.2-kb mRNA. From the
analysis of the genomic DNA sequence, we have identified an
additional ORF at the HTF-island (Fig. 3). As this predicted exon
has all the proposed features of the consensus sequence of a
eukaryotic translation initiation site12, and 113 nt of it are represented in the consensus cDNA sequence, it could represent the 5´
end of EPM2A.
The protein encoded by EPM2A contains an amino acid
motif (Fig. 4c) that corresponds with the consensus sequence,
HCxxGxxRS(T), of the catalytic site of PTPs (refs 13,14). In addition to the essential cysteine and arginine residues found in all
PTPs (Fig. 4c), EPM2A contains the expected aspartic acid necessary for completion of the catalytic reaction13,14, positioned 31aa N terminal of the cysteine nucleophile.
To date, mutations have been found in 10 of 30 (33%) EPM2A
families (Table 1). For example, in family I-22, a homozygous Gto-T nonsense mutation results in an in-frame stop codon that
predicts premature termination of the putative EPM2A protein.
primers for
mutation screening
genomic DNA
sequence
northern blot
probes
Fig. 3 Overlapping cDNA clones aligned with genomic DNA sequence. The size of each DNA sequence contig is shown (top), but is not drawn to scale. The portions of each cDNA clone that could be aligned to the genomic sequence is shown. On the basis of this analysis, they were grouped into four transcripts. Open
boxes in the cDNA represent ORFs. RACE-A represents four independently isolated and identical 5´-RACE clones obtained from separate experiments. RACE-B also
represents four independently isolated 5´-RACE clones that contained splicing of coding region to an Alu repeat that was present in the genomic sequence. The
consensus cDNA is a compilation of group A sequence and RACE-A (Fig. 4). The stippled box in the consensus cDNA represents the region found in clone 266552
(transcript B) that is differentially spliced. The stop codons (*) are shown. The HTF-island demarcated by a NotI (N) and four BssHII (B) sites is shown. From a stretch
of 301 nt of DNA, GRAIL analysis predicted the presence of a start codon at the HTF-island. An ATG (AUG) triplet is present at the beginning of this predicted ORF
and the nucleotide sequence surrounding the consensus sequence (CCCGCCAUGC) has the proposed features of the consensus sequence (GCCA/GCCAUGG) of a
eukaryotic translation initiation site12. The predicted start exon maintains an ORF with the most 5´ sequence of EPM2A, and this contains exon/intron junction
sequences with splice sites that conform with the consensus in other mammalian genes. Although no cDNA has yet been identified to confirm that the predicted
exon represents the 5´ end of EPM2A, if it is, the gene would be predicted to encode a protein of 332 aa.
172
nature genetics volume 20 october 1998
letter
© 1998 Nature America Inc. • http://genetics.nature.com
© 1998 Nature America Inc. • http://genetics.nature.com
a
c
b
EPM2A
Fig. 4 Nucleotide sequence and predicted amino acid sequence of EPM2A. a, The consensus nucleotide sequence was derived from cDNA clones (Fig. 3). The position of the mutations identified are indicated. A stop mutation (*) and the position of four splice junctions (vertical arrows) are shown. An A→T polymorphism
present in 16 of 37 (43%) control samples is shown. The position of the putative PTP domain is boxed, as are polyadenylation sites (AATAAA) observed in different cDNA clones. b, The deduced C terminus of transcript A compared with transcript B. The latter arises due to the removal by splicing of nt 738−2508 (Fig. 3 and
Fig. 4a), which would be predicted to generate an isoform with a unique 3´ end. At the present time, transcript B is known to extend to position 94 of the predicted amino acid sequence shown (Fig. 4a). Transcript C (cDNA SFB14) is described elsewhere. c, The putative PTP active sites of EPM2A, MTM1, PTEN, PTP1B,
dPTP61F and viral PTP. The shaded amino acids (C and R) represent catalytic residues. On the basis of sequence analysis alone, laforin predicts an intracellular PTP
with dual specificity phosphatase activity14.
A homozygous insertion of an A, resulting in a frameshift that
causes interruption of the PTP domain, was identified in family
LD100. We have also found in four consanguineous families
(LD-16, LD15, LD-48, LD13) a homozygous nonsense mutation
that results from a C→T change which causes the introduction of
a premature stop codon. This same mutation was found on one
allele of an additional family (L6), whereas the other chromosome had a G→A change that results in a glycine-to-serine
non-conservative substitution. Finally, in family LD-33, a
homozygous A→T transition results in a glutamine-to-leucine
change in a residue located just after the PTP domain. This seem-
a
b
Table 1• Summary of mutations
Mutation/
(primers used)2
Predicted effect
consanguineous
homozygous deletion
(D6S1703 and 109F4.E0.5)
deletion of the
majority of EPM2A
LD100-4
consanguineous
homozygous insertion of A
resulting in a frameshift
(824F and 824R)
interruption
of the tyrosine
phosphatase domain
I-22
consanguineous
homozygous mutation
G→T (JRGXBF and JRGXBR)
glutamic acid→stop
LD-33
consanguineous
homozygous mutation
A→T (824F and 824R)
glutamine→leucine
LD-5
consanguineous
homozygous mutation
(C→T JRGXBF and JRGXBR)
arginine→cysteine
L6
consanguineous
(compound
heterozygote)
1. C→T (824R and H1F)
2. G→A (824F and 824R)
1. arginine→stop
2. glycine→serine
LD-16
consanguineous
homozygous mutation
C→T (824R and H1F)
arginine→stop
LD15
consanguineous
homozygous mutation
C→T (824R and H1F)
arginine→stop
LD-48
consanguineous
homozygous mutation
C→T (824R and H1F)
arginine→stop
LD13
consanguineous
homozygous mutation
C→T (824R and H1F)
arginine→stop
Family
Genetics1
LD-L4
c
EPM2A
β-actin
Fig. 5 Expression pattern of EPM2A. Northern-blot analysis in different tissues
as indicated. The northern blots in a and b were hybridized with probe A; the
northern blot in c was hybrized with probe B. The exposure time for all was 4 d
at −80 °C. EPM2A mRNA was observed in all tissues tested. The apparent overexpression in heart and skeletal muscle is mostly due to overloading of mRNA
in these lanes.
nature genetics volume 20 october 1998
ingly more benign mutation occurs in a family with relative
preservation of mental functions and a protracted course11.
The identification of EPM2A as a putative PTP provides the first
clue in understanding the basic defect in LD. Involvement of PTPs
in non-neoplastic disease have been described in only one other
1Families
L6, LD-16, LD15, LD-48 and LD13 are of Spanish decent indicating this may
be a common mutation in this ethnic background. 2The location of the PCR primers
and mutations are shown in Fig. 3 and Fig. 4, respectively.
173
© 1998 Nature America Inc. • http://genetics.nature.com
letter
© 1998 Nature America Inc. • http://genetics.nature.com
human disorder, X-linked myotubular myopathy15,16, which is
caused by mutations in the MTM1 gene. Similar to MTM1,
EPM2A has at least two forms, which appear to encode protein
isoforms predicted to have different functions, in a manner analogous to the Drosophila PTP, dPTP61F, which also undergoes alternative splicing at the 3´ end17. In the case of dPTP61F, it is known
that the alternate C termini govern the localization of the protein
to either the cytoplasmic membrane or the nucleus17.
The polyglucosans in the pathognomonic Lafora bodies are
considered unbranched equivalents of glycogen7. It is possible
that the laforin PTP is involved in glycogen metabolism, which is
known to be regulated by phosphatases18,19. Although the accumulations of polyglucosan bodies are thought to be implicated in
neuronal death in LD, it is not clear whether the epilepsy is secondary to neurodegeneration or if it is a direct result of abnormal
laforin expression. In various models, both synaptic transmission
and key components of neuronal excitability, such as the NMDA
type of voltage-gated calcium channels, are also subject to phosphoregulation20,21. Further investigation will be necessary to
understand the precise role of laforin in normal brain, in the formation of Lafora bodies and in epilepsy.
Methods
Patients. The diagnosis of LD was confirmed by demonstration of Lafora
bodies in skin, liver, muscle, or brain biopsies4–8 in at least one affected
member from each of 38 families included in this study. The clinical histories and basis for diagnosis of 35 of these families have been described previously10,11,22−24. In eight families (20%), haplotype analysis revealed evidence against linkage to 6q23−25. Of the remaining 30 LD families, whose
6q locus was proven based on homozygosity of markers, 16 reported a history of consanguinity.
Genotyping. Haplotypes for 6q23−25 were constructed for all members of
the 38 families, using microsatellite markers at loci D6S314, D6S1704,
D6S1003, D6S1010, D6S1049, D6S1703, D6S1042, D6S1649, D6S978,
D6S311 and D6S1637.
Northern blots, cDNA library screening and 5´-RACE. Multiple-tissue
and human brain II northern blots (Clontech) were carried out as recommended by the supplier. Probe A was generated using PCR primers 266F
(5´−CGGCACGAGGATTATTCAAG−3´) and GSP3 (5´−GCTCGGGTACTGAGGTCTG−3´), which amplified a 190-bp fragment from cDNA clone
266552 (Fig. 3). Probe B was derived using PCR primers AA490925F (5´−
AGTTGTTACACAGGGTTGTTGG−3´) and AA490925R (5´−AGGCTGTACATCAGACAGAAGG−3´), which amplified a 373-bp segment from
1. Berkovic, S.F., Andermann, F., Carpenter, S. & Wolfe, L.S. Progressive myoclonus
epilepsies: specific causes and diagnosis. New Eng. J. Med. 315, 296–305
(1986).
2. Van Heycop Ten Ham, M.W. Lafora disease, a form of progressive myoclonus
epilepsy. Handbook of Clinical Neurology 15, 382–422 (1974).
3. Minassian, B.A., Sainz, J., Bohlega, S., Sakamoto, L.M. & Delgado-Escueta, A.V.
Genetic heterogeneity in Lafora’s disease. Epilepsia 37, 126 (1996).
4. Lafora, G.R. Uber das vorkommen amyloider korperchen im innern der
ganglienzellen; zugleich ein beitrag zum studium der amyloiden substanz im
nervensystem. Virchows. Arch. Path. Anat. 205, 295–303 (1911).
5. Harriman, D.G. & Millar, J.H.D. Progressive familial myoclonic epilepsy in 3
families: its clinical features and pathological basis. Brain 78, 325–349 (1955).
6. Schwarz, G.A. & Yanoff, M. Lafora’s disease, distinct clinico-pathologic form of
Unverricht’s syndrome. Arch. Neurol. 12, 172–188 (1965).
7. Sakai, M., Austin, J., Witmer, F. & Trueb, L. Studies in myoclonus epilepsy
(Lafora body form). Neurol. 20, 160–176 (1970).
8. Carpenter, S. & Karpati, G. Sweat gland duct cells in Lafora disease: diagnosis
by skin biopsy. Neurol. 31, 1564–1568 (1981).
9. Carpenter, S., Karpati, G., Andermann, F., Jacob, J.C. & Andermann, E. Lafora’s
disease: peroxisomal storage in skeletal muscle. Neurol. 24, 531–538 (1974).
10. Serratosa, J. et al. The gene for progressive myoclonus epilepsy of the Lafora
type maps to chromosome 6q. Hum. Molec. Genet. 9, 1657–1663 (1995).
11. Sainz, J. et al. Lafora progressive myoclonus epilepsy: narrowing the
chromosome 6q24 locus by recombinations and homozygosities. Am. J. Hum.
Genet. 61, 1205–1209 (1997).
12. Kozak, M. Interpreting cDNA sequences: some insights from studies on
translation. Mamm. Genome 7, 563–574 (1996).
13. Yuvaniyama, J., Denu, J.M., Dixon, J.E. & Saper, M.A. Crystal structure of the
174
cDNA SFB14 (Fig. 3). Clones GSH and SFB14 were isolated from heart and
fetal brain cDNA libraries, respectively. All RACE experiments were performed using poly(A)+ fetal brain mRNA. To isolate the remainder of the
coding region, we performed consecutive rounds of 5´-RACE. Beyond the
most 5´ sequences (Fig. 4), however, all RACE clones recovered shared the
expected DNA sequences, but then diverged in different ways.
Mutation analysis. Using the available genomic structure of EPM2A, we
screened an affected member of each of 30 LD families in our collection for
mutations. Mutations were detected by radioactive cycle sequencing using
the Thermosequenase Kit (Amersham Life Science) with column (Qiagen)
purified PCR products. The position of the primers are shown (Fig. 3). The
combinations of PCR primer pairs used were: JRGXBF (5´−TCCATTGTGCTAATGCTATCTC−3´) and JRGXBR (5´−TCAGCTTGCTTTGAGGATATTT−3´), product size 310 bp; 824F (5´−GCCGAGTACAGATGCTGCC−3´) and 824R (5´−CACACAGTCCTTTCAGTTCAGG−3´), product
size 384 bp; and H1F (5´−GAATGCTCTTTCCACTTTGC−3´) and 824R,
product size 587 bp. Oligonucleotide specific hybridization was used to test
for the presence of point mutations in the unaffected population. For
example, PCR of the region surrounding the C→T point mutation in family LD-5 in the unaffected population was completed on 54 samples (108
chromosomes) using JRGXBF and JRGXBR primers and the product was
blotted in duplicate. One membrane was hybridized with a wild-type
oligonucleotide (ATCATGACCGTTGCTGTAC) and the other with LD5
mutant (TCATCATGACTGTTGCTGTAC) oligonucleotide at 42 °C (washing with 5×SSC at RT for 20 min followed by 2×SSC 20 min at 65 °C). No
mutant alleles were found in these analyses.
Accession numbers. GenBank: EPM2A consensus cDNA, AF084535;
dPTP61F, L14849. Swissprot: MTM1, Q13496; PTEN, O00633; PTP1B,
P18031; viral PTP, AF003534. All genomic DNA sequences are available
(http://www.sanger.ac.uk/).
Acknowledgements
We thank J. Rommens, L. Osborne, S. Beck, K. Thorpe, Q. Zhang and the
Bloorview Epilepsy Program. Supported by grants from the Hospital for Sick
Children (HSC) Foundation and the Medical Research Council of Canada
(MRC) to S.W.S. A.J.M. and I.D. are funded by the Wellcome Trust. A.V.D.
was supported by NIH grant 5P01-NS21908 (UCLA Comprehensive
Epilepsy Program) and contributions from A. Malenfant (Quebec Lafora
Society) and V. Faludi (Sweden Lafora effort). S.W.S. is a Scholar of the
MRC, L.-C.T. is a Senior Scientist of the MRC and Sellers Chair in Cystic
Fibrosis Research at HSC and International Scholar of the Howard Hughes
Medical Institute. S.W.S., L.-C.T. and G.R. are members of the Canadian
Genetic Disease Network.
Received 24 August; accepted 1 September, 1998.
dual specificity protein phosphatase VHR. Science 272, 1328–1331 (1996).
14. Denu, J.M., Stuckey, J.A., Saper, M.A. & Dixon, J.E. Form and function in protein
dephosphorylation. Cell 87, 361–364 (1996).
15. Laporte, J. et al. A gene mutated in X-linked myotubular myopathy defines a
new putative tyrosine phosphatase family conserved in yeast. Nature Genet.
13, 175–182 (1996).
16. Cui, X. et al. Association of SET domain and myotubularin-related proteins
modulates growth control. Nature Genet. 18, 331–337 (1998).
17. McLaughlin, S. & Dixon, J.E. Alternative splicing gives rise to a nuclear protein
tyrosine phosphatase in Drosophila. J. Biol. Chem. 268, 6839–6842 (1993).
18. Tonks, N.K. & Neel, B.G. From form to function: signaling by protein tyrosine
phosphatases. Cell 87, 365–368 (1996).
19. Wang, Q.M., Fiol, C.J., DePaoli-Roach, A.A. & Roach, P.J. Glycogen synthase
kinase-3ß is a dual specificity kinase differentially regulated by tyrosine and
serine/threonine phosphorylation. J. Biol. Chem. 20, 14566–14574 (1994).
20. Gurd, J.W. & Bissoon, N. The N-methyl-D-aspartate receptor subunits NR2A and
NR2B bind to the SH2 domains of phospholipase C-gamma. J. Neurochem. 69,
623–630 (1997).
21. Llinas, R., Moreno, H., Sugimori, M., Mohammadi, M. & Schlessinger, J.
Differential pre- and postsynaptic modulation of chemical transmission in the
squid giant synapse by tyrosine phosphorylation. Proc. Natl Acad. Sci. USA 94,
1990–1994 (1997).
22. Lopes-Cendes, I. et al. Searching for the gene causing Lafora body disease.
Epilepsia 36, 6 (1995).
23. Acharya, J.N., Satishchandra, P. & Shankar, S.K. Lafora’s disease in south India: a
clinical, electrophysiologic, and pathologic study. Epilepsia 34, 476–487 (1993).
24. Fong, C.G. et al. Lafora’s progressive myoclonus epilepsy: Italian families
narrow the chromosome 6q24 locus to less than 1cM. Epilepsia 39, 4–5 (1998).
nature genetics volume 20 october 1998