* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download DNA! - Chapter 10
Human genome wikipedia , lookup
Genomic library wikipedia , lookup
RNA silencing wikipedia , lookup
Designer baby wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Cancer epigenetics wikipedia , lookup
SNP genotyping wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Nucleic acid tertiary structure wikipedia , lookup
Genealogical DNA test wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Genetic code wikipedia , lookup
Polyadenylation wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Microevolution wikipedia , lookup
DNA vaccination wikipedia , lookup
Molecular cloning wikipedia , lookup
Epigenomics wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
History of RNA biology wikipedia , lookup
History of genetic engineering wikipedia , lookup
DNA polymerase wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Messenger RNA wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
DNA supercoil wikipedia , lookup
Non-coding DNA wikipedia , lookup
Point mutation wikipedia , lookup
Non-coding RNA wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Epitranscriptome wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Helitron (biology) wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
DNA! - Chapter 10 Good luck! 5 minutes to review Let’s review where we find our genetic coding …… What holds our genetic coding? • Chromosomes ✓ Strands of DNA that contain all of the genes an organism needs to survive and reproduce • Genes ✓ Segments of DNA that specify how to build a protein • There can be multiple genes for a trait/protein ✓ Chromosome maps are used to show the locus (location) of genes on a chromosome The E. Coli genome includes approximately 4,000 genes Genetic Variation ✓ Phenotypic variation among organisms is due to genotypic variation (differences in the sequence of their DNA bases) ✓ Differences exist between species and within a species • Different genes (genomes) → different proteins • Different versions of the same gene (alleles) • Differences in gene expression (epigenetics) DO NOW: What are the 3 components that make up a nucleotide structure? Structure of DNA DNA stands for: Deoxyribonucleic acid DNA is located in the nucleus of eukaryotic cells and cytoplasm in prokaryotic cells DNA and RNA are polymers composed of nucleotides ▪ Polymers = DNA and RNA ▪ Monomer = nucleotide Each nucleotide contains a: – Nitrogenous base – 5-carbon sugar – Phosphate group Nitrogenous base (A, G, C, or T) Phosphate group Thymine (T) Sugar (deoxyribose) The 4 Nitrogenous bases of DNA: Thymine (T) Cytosine (C) Pyrimidines Adenine (A) Guanine (G) Purines What is the difference between pyrimidines and purines? Nitrogenous bases bond together to make a BASE PAIR Adenine → Thymine How are they bonded Cytosine → Guanine together? How many bonds does each pair have? A sugar-phosphate backbone is formed by covalent bonding between the phosphate of one nucleotide and the sugar of the next nucleotide Nitrogenous bases extend from the sugar-phosphate backbone What does Antiparallel mean? ● Two DNA strands run parallel but in the opposite alignment ● Allows nucleotides to make the needed hydrogen bonds 5’ - 3’ ● These numbers identify the carbons on the sugar backbone ● Start to the right of the “o” ● Asymmetry gives a DNA strand “direction” Count the carbons Sugar-phosphate backbone Phosphate group Nitrogenous base Sugar DNA nucleotide Phosphate group Nitrogenous base (A, G, C, or T) Thymine (T) Sugar (deoxyribose) DNA nucleotide DNA polynucleotide Notice the → ● Different bonds ● Different bases ● 5’ - 3’ & 3’-5’ Sugar → Deoxyribose or Ribose What is RNA? ● ● ● ● Ribonucleic Acid, present in all living cells Single Stranded Helps with the creation of proteins! Has 3 of the same nitrogenous bases DNA has except uracil takes the place of thymine DNA Replication DNA Replication • Cell Division (mitosis) ✓ Cells must copy their chromosomes (S phase) before they divide so that each daughter cell will have a copy Questions before we start… 1. How does that DNA actually replicated? 2. What form is the DNA in during this? AT GC CG TA GC DNA Synthesis ✓ The DNA bases on each strand act as a template to synthesize a complementary strand ✓ The process is semiconservative because each new double-stranded DNA contains one old strand (template) and one newly-synthesized complementary strand AT GC CG ATTA GGCC CG TA GC A G C T G AT GC CG TA GC T C G A C Enzymes involved: • Topoisomerase ✓ Unwinds (uncoils) the DNA • Helicase ✓ An enzyme that separates strands of nucleic acids “Replication Fork” • Single Stranded Binding Proteins ✓ Prevent DNA that has been opened at the replication fork during DNA replication from immediately reestablishing double helix conformation • RNA Primase ✓ an enzyme that creates a short RNA sequence, called a primer, tells the DNA polymerase where to start replication • DNA Polymerase (I and III) ✓ Enzyme that catalyzes the covalent bond between the phosphate of one nucleotide and the deoxyribose (sugar) of the next nucleotide Polymerase I: replaces segments of primer with DNA nucleotides Polymerase III: binds at the end of the primer and adds new DNA nucleotides • Ligase ✓ Joins DNA strands back together (acts as a glue) 3’ end has a free deoxyribose 5’ end has a free phosphate DNA polymerase: ✓ can only build the new strand in the 5’ to 3’ direction ✓ Thus scans the template strand in 3’ to 5’ direction DNA Replication Steps… 1. Initiation 2. Elongation 3. Termination Initiation • Primase (a type of RNA polymerase) builds an RNA primer (5-10 ribonucleotides long) • DNA polymerase attaches onto the 3’ end of the RNA primer DNA polymerase Elongation • DNA polymerase uses each strand as a template in the 3’ to 5’ direction to build a complementary strand in the 5’ to 3’ direction • results in a leading strand and a lagging strand DNA polymerase Lagging Strand Creates Okazaki Fragments • Newly synthesized DNA fragments that are formed on the lagging template strand during DNA replication Last step... Termination Primers are removed and replaced with new DNA nucleotides and the backbone is sealed by DNA ligase 2 new daughter strands of DNA! Eukaryotic vs. Prokaryotic DNA replication Review of Enzymes involved and DNA replication: – DNA polymerase adds nucleotides to a growing chain – DNA ligase joins small fragments into a continuous chain – Helicase unwinds the DNA strand – RNA Primase tells DNA polymerase where to start; “primer” – Single Stranded Binding Proteins prevent DNA from coiling back into a double helix during synthesis Review... Leading Strand 1. Topisomerase unwinds DNA and then Helicase breaks H-bonds 2. Primase creates a single RNA primer to start the replication 3. Polymerase slides along the leading strand in the 3’ to 5’ direction synthesizing the matching strand in the 5’ to 3’ direction 4. The RNA primer is degraded by RNase H and replaced with DNA nucleotides by DNA polymerase, and then DNA ligase connects the fragment at the start of the new strand to the end of the new strand (in circular chromosomes) Review... Lagging Strand 1. Topisomerase unwinds DNA and then Helicase breaks H-bonds 2. Primase creates RNA primers in spaced intervals 3. Polymerase slides along the leading strand in the 3’ to 5’ direction synthesizing the matching Okazaki fragments in the 5’ to 3’ direction 4. The RNA primers are degraded by RNase H and replaced with DNA nucleotides by DNA polymerase 5. DNA ligase connects the Okazaki fragments to one another (covalently bonds the phosphate in one nucleotide to the deoxyribose of the adjacent nucleotide) Protein Synthesis Protein Synthesis • DNA provides the instructions for how to build proteins • Each gene dictates how to build a single protein • The sequence of nucleotides (AGCT) in DNA dictate the order of amino acids that make up a protein Nucleotide sequence of this gene Protein construction requires a conversion of a nucleotide sequence to an amino acid sequence Central Dogma Protein Synthesis • Protein synthesis occurs in two primary steps 1 ● DNA is transcribed into mRNA (messenger RNA) ● RNA processing occurs shortly after ✓Cytoplasm of prokaryotes ✓Nucleus of eukaryotes 2 ● mRNA is used by ribosome to build protein by being assisted by rRNA and tRNA ● Ribosomes (rRNA) attach to the mRNA and use its sequence of nucleotides to determine the order of amino acids in the protein Before we start, let's review the 3 types of RNA we will be talking about mRNA ~ Messenger RNA; takes the code from the DNA and brings it to the ribosome. It is made during first step called transcription. rRNA ~ Ribosomal RNA; combines with proteins to make the structure of the ribosome. tRNA ~ Transfer RNA; carries an amino acid to the ribosome to be able to synthesize the protein during translation. Steps of Transcription and Translation 1. Initiation 2. Elongation 3. Termination *We will be going over the exact details of each step in both of these processes* Protein Synthesis 1) INITIATION • Transcription - Initiation ✓ RNA polymerase binds to a region on DNA known as the promoter, which signals the start of a gene (does not need a primer) ✓ Promoters are specific to genes ✓ Transcription factors assemble at the promoter forming a transcription initiation complex – activator proteins help stabilize the complex (eukaryotes) • Transcription - Elongation ✓ RNA polymerase unwinds the DNA and breaks the H-bonds between the bases of the two strands, separating them from one another. ✓ Base pairing occurs between incoming RNA nucleotides and the DNA nucleotides of the gene (template) • recall RNA uses uracil instead of thymine 1) INITIATION AGTCAT UCAGUA • Transcription - Elongation ✓ RNA polymerase unwinds the DNA and breaks the H-bonds between the bases of the two strands, separating them from one another. 5’ ✓ Base pairing occurs between incoming RNA nucleotides and the DNA nucleotides of the gene (template) • recall RNA uses uracil instead of thymine 3’ + ATP ✓ RNA polymerase catalyzes bond to5’ form between ribose of 3’ nucleotide of mRNA and phosphate of incoming RNA nucleotide 3’ + ADP • Transcription - Elongation • Transcription - Termination 1) INITIATION ✓ A region on DNA known as the terminator signals the stop of a gene ✓ RNA polymerase disengages the mRNA and the DNA TRANSCRIPTION COMPLETE! At the end of Transcription you now have an almost complete mRNA strand... ● Eukaryotic mRNA has interrupting (noncoding) sequences called introns, separating the coding regions called exons. ● Although introns are taken out, they help cell function and enhance gene expression. RNA Processing = RNA Splicing ✓ Introns are removed (exons together) ✓ different combinations of exons form different mRNA resulting in multiple proteins from the same gene ✓ Humans have 30,000 genes but are capable of producing 100,000 proteins Light pink regions are the “introns” What are those yellow regions on the mRNA? A CAP and TAIL is added to the mRNA Cap added to 5’ end: single guanine nucleotide Tail added to 3’ end: Poly-A tail of 50–250 adenines Why is the CAP and TAIL important? These structures increase the stability of the mRNA as it moves through the cytoplasm and also help it to interact with the components necessary for protein synthesis. Exon Intron Exon Intron Exon DNA Cap RNA transcript with cap and tail Transcription Addition of cap and tail Introns removed Tail Exons spliced together mRNA Coding sequence Nucleus Cytoplasm Protein Synthesis Part 2 Transcription tRNA synthesis 1 2 mRNA mRNAmRNA copy of a gene is synthesized mRNA is used by ribosome to build protein ✓Cytoplasm of prokaryotes Ribosomes attach to the mRNA and use its ✓Nucleus of eukaryotes sequence of nucleotides to determine the order of amino acids in the protein ✓Cytoplasm of prokaryotes & eukaryotes Translation Protein Synthesis Part 2 Transcription • Translation tRNA synthesis ✓ Every three mRNA nucleotides (codon) specify an amino acid mRNA Translation Protein Synthesis Part 2 • Translation ✓ tRNA have an anticodon region that specifically binds to its codon ✓ Each tRNA carries a specific amino acid Protein Synthesis Part 2 • Translation - Initiation ✓ Start codon signals where the gene begins (at 5’ end of mRNA) ✓ We have 1 start codon = AUG 5’ AUGGACAUUGAACCG… start codon 3’ • Translation- Initiation ✓ Start codon signals where the gene begins (at 5’ end of mRNA) ✓ Ribosome binding site upstream from the start codon binds to the small ribosomal subunit ✓ This complex recruits the large ribosomal subunit to bind A site ✓ P site = hold tRNA carrying growing polypeptide chain ✓ A site = Holds tRNA carrying next amino acid in chain ✓ E site = Empty tRNA leaves exit site A site Translation Animation http://highered.mheducation. com/sites/0072507470/student_view0/chapter3/animation__h ow_translation_works.html • Translation - Elongation ✓ The ribosome moves in 5’ to 3’ direction “reading” the mRNA and assembling amino acids into the correct protein • Translation - Elongation ✓ The ribosome moves in 5’ to 3’ direction “reading” the mRNA and assembling amino acids into the correct protein • Translation - Termination ✓ Ribosome disengages from the mRNA when it encounters a stop codon ✓ There are 3 STOP codons = UAA, UAG, UGA Practice Question! Translate the following mRNA sequence AGCUACCAUACGCACCCGAGUUCUUCAAGC Practice Question! Translate the following mRNA sequence AGCUACCAUACGCACCCGAGUUCUUCAAGC Serine – Tyrosine – Histidine – Threonine – Histidine – Proline – Serine – Serine – Serine - Serine Practice Question! Translate the following mRNA sequence AGCUACCAUACGCACCCGAGUUCUUCAAGC Serine – Tyrosine – Histidine – Threonine – Histidine – Proline – Serine – Serine – Serine - Serine Ser – Tyr – His – Thr – His – Pro – Ser – Ser – Ser - Ser Practice Question! Translate the following mRNA sequence AGCUACCAUACGCACCCGAGUUCUUCAAGC Serine – Tyrosine – Histidine – Threonine – Histidine – Proline – Serine – Serine – Serine - Serine Ser – Tyr – His – Thr – His – Pro – Ser – Ser – Ser - Ser S – Y –H– T – H – P – S – S – S - S Protein Synthesis • Multiple RNA polymerases can engage a gene at one time • Multiple ribosomes can engage a single mRNA at one time Transcription DNA mRNAs Translation Protein Synthesis • Eukaryotes: transcription occurs in the nucleus and translation occurs in the cytoplasm • Prokaryotes: Transcription and translation occur simultaneously in the cytoplasm Practice Questions 1. Why is DNA synthesis said to be “semiconservative”? 2. What role do DNA polymerase, DNA primase (a type of RNA polymerase), helicase, topoisomerase, RNase H, and ligase play in DNA replication? 3. What is the difference between how the leading strand and lagging strand are copied during DNA replication? Why do they have to be synthesized differently in this fashion? 4. What would happen if insufficient RNase H were produced by a cell? What if insufficient ligase were produced by a cell? 5. What are four key differences between DNA polymerase and RNA polymerase? (“they are difference molecules” doesn’t count as one!) 6. Compare and contrast codons and anticodons? 7. What is alternative splicing? Why is it necessary in eukaryotes? 8. During translation, what amino acid sequence would the following mRNA segment be converted into: AUGGACAUUGAACCG? 9. How come there are only 20 amino acids when there are 64 different codons? 10. How come prokaryotes can both transcribe and translate a gene at the same time, but eukaryotes cannot?