Download The Evolutionary History of Human and Chimpanzee Y

The Evolutionary History of Human and Chimpanzee Y-Chromosome
Gene Loss
George H. Perry,* à Raul Y. Tito,* and Brian C. Verrelli* *Center for Evolutionary Functional Genomics, The Biodesign Institute, Arizona State University, Tempe; School of Life Sciences,
Arizona State University, Tempe; and àSchool of Human Evolution and Social Change, Arizona State University, Tempe
Recent studies have suggested that gene gain and loss may contribute significantly to the divergence between humans and
chimpanzees. Initial comparisons of the human and chimpanzee Y-chromosomes indicate that chimpanzees have a disproportionate loss of Y-chromosome genes, which may have implications for the adaptive evolution of sex-specific as well
as reproductive traits, especially because one of the genes lost in chimpanzees is critically involved in spermatogenesis in
humans. Here we have characterized Y-chromosome sequences in gorilla, bonobo, and several chimpanzee subspecies for
7 chimpanzee gene–disruptive mutations. Our analyses show that 6 of these gene-disruptive mutations predate chimpanzee–bonobo divergence at ;1.8 MYA, which indicates significant Y-chromosome change in the chimpanzee lineage
relatively early in the evolutionary divergence of humans and chimpanzees.
Introduction
Comparative analyses of single-nucleotide differences
between human and chimpanzee genomes typically show
estimates of approximately 1–2% divergence (Watanabe
et al. 2004; Chimpanzee Sequencing and Analysis Consortium 2005). Surprisingly, more focused comparative genomic analyses have identified greater than 100 genes with
lineage-specific coding sequence disruptions in the form
of stop codon or splice site mutations, frameshift insertion/deletions, and gene deletions (Watanabe et al. 2004;
Chimpanzee Sequencing and Analysis Consortium 2005;
Newman et al. 2005; Varki and Altheide 2005; Hahn
and Lee 2006; Wang et al. 2006). This observation is a radical change from previous beliefs of the types of genetic
changes that predominantly accompanied the divergence
of human and chimpanzee lineages and strongly implicates
gene structure and reorganization as important means by
which our 2 lineages have become genetically and phenotypically distinct.
Gene loss at any particular region of the genome can
result in many unpredicted changes in phenotype; however,
lineage-specific gene loss on the Y-chromosome is of particular interest because this chromosome is highly enriched
for genes involved in spermatogenesis (Lahn and Page 1997;
Skaletsky et al. 2003). Therefore, studies of Y-chromosome
gene loss can potentially reveal the history of evolutionary
change between human and chimpanzee mating and fertility
systems. Furthermore, the Y-chromosome seems to be particularly prone to gene loss; most of the Y-chromosome does
not undergo meiotic recombination (Tilford et al. 2001),
meaning that positive or negative natural selection can have
very important implications for ‘‘linked’’ variation compared with that of other chromosomes. As a result, there
has been a general trend of Y-chromosome degradation
and gene loss over evolutionary time (e.g., Muller’s ratchet),
which may sometimes involve the fixation of genedisruptive mutations on the background of an otherwise
adaptive haplotype (Muller 1918; Charlesworth B and
Charlesworth D 2000).
Key words: pseudogene, Muller’s ratchet, sperm competition, Pan
troglodytes, Pan paniscus.
E-mail: [email protected].
Mol. Biol. Evol. 24(3):853–859. 2007
doi:10.1093/molbev/msm002
Advance Access publication January 11, 2007
Ó The Author 2007. Published by Oxford University Press on behalf of
the Society for Molecular Biology and Evolution. All rights reserved.
For permissions, please e-mail: [email protected]
The initial comparisons of human and chimpanzee
(Pan troglodytes) Y-chromosome sequences revealed that
although there are no lineage-specific gene-disruptive mutations in the X-degenerate portion of the Y-chromosome
fixed within humans, surprisingly, 4 genes, CYorf15B,
TBL1Y, TMSB4Y, and USP9Y, are disrupted by one or more
splice site or premature stop codon mutations in chimpanzees (Hughes et al. 2005; Kuroki et al. 2006; Tyler-Smith
et al. 2006). Given that levels of sperm competition are
likely greater in chimpanzees than in humans (Harcourt
et al. 1981; Dorus et al. 2004) and that the Y-chromosome
is highly enriched for genes associated with spermatogenesis, the contrast between rates of human and chimpanzee
Y-chromosome gene disruption was unanticipated. Although the specific functions of CYorf15b, TBL1Y, and
TMSB4Y are not well understood (Skaletsky et al. 2003;
Yan et al. 2005), USP9Y is critical for spermatogenesis
in humans, with gene-disruptive mutations at this locus resulting in azoospermia or the absence of sperm in semen
(Sun et al. 1999; Blagosklonova et al. 2000). Thus, the
potential loss of this specific gene in the chimpanzee lineage is especially puzzling.
In order to better understand the evolutionary history
and significance of chimpanzee Y-chromosome gene loss,
we have characterized the nucleotide sequences involving
the gene-disruptive mutations in each of the CYorf15B,
TBL1Y, TMSB4Y, and USP9Y genes in the gorilla (Gorilla
gorilla), the bonobo (Pan paniscus), and in wild-born individuals from several chimpanzee subspecies. This analysis enables us to make inferences about the origin and
timing of these gene-disruptive mutations as well as evaluate the impact of these potentially important events that
distinguish the evolutionary histories of human and chimpanzee Y-chromosomes.
Materials and Methods
Although comparison of the exhaustive pseudogene
catalogs for humans versus chimpanzees may provide insight into our respective evolutionary and ecological histories in general, the current draft quality of the chimpanzee
genome sequence (Build 1.1) precludes the reliable and
comprehensive genome-wide identification of chimpanzee
pseudogenes without further validations, as discussed by
the Chimpanzee Sequencing and Analysis Consortium
(2005). However, 2 independent and high-quality
854 Perry et al.
Table 1
Summary of Y-Chromosome Gene-Disruptive Mutations
Similarity to
Chimpanzeea
Gene
CYorf15b
TBL1Y
TMSB4Y
USP9Y
Exon
Type of Mutation
Gorilla
Bonobo
4
12
1
8
34
36
39
Stop codon
Splice site mutationb
Splice site mutation
Splice site deletion (4 bp)
Splice site mutation
Frameshift deletion (4 bp)
Splice site mutation
No
No
No
No
No
No
No
Yes
Yes
Noc
Yes
Yes
Yes
Yes
a
Yes: the individual was found to have the gene-disruptive mutation as found in
the 2 publicly available chimpanzee Y-chromosome sequences. No: shares the human sequence.
b
Mutations at exon–intron boundaries involved in intron splice site recognition.
c
Because the bonobo did not have this mutation, this gene region was characterized in 1 wild-born individual from each of 4 chimpanzee subspecies, all found to
have the identical gene-disruptive mutation as in the chimpanzee reference sequences
(see Results and Discussion).
chimpanzee Y-chromosome sequences are publicly available (Hughes et al. 2005; Kuroki et al. 2006), offering excellent opportunities for focused analyses on this
chromosome.
We aligned the Hughes et al. (2005) and Kuroki et al.
(2006) chimpanzee Y-chromosome sequences and the human Y-chromosome reference sequence (Build 35) for the
CYorf15B, TBL1Y, TMSB4Y, and USP9Y genes. This alignment confirmed that the splice site and stop codon mutations described by Hughes et al. (2005) are found in
both chimpanzee Y-chromosome sequences (and not in
the human sequence), making it highly unlikely that these
reflect sequencing or assembly errors. We also identified
a 4-bp frameshift deletion in USP9Y exon 36 in the chimpanzee lineage (as inferred by comparison to human and
gorilla sequences), which was not originally identified in
the study conducted by Hughes et al. (2005). In total,
we characterized 7 Y-chromosome gene-disruptive mutations in each primate species (table 1).
Whole blood samples from wild-born chimpanzees
housed at research facilities or zoological institutions were
collected during regularly scheduled veterinary examinations. DNA was isolated using a standard phenol/chloroform extraction method (Sambrook and Russell 2001).
Chimpanzee subspecies were determined from comparisons of mitochondrial DNA and Y-chromosome sequences
to those of wild-born individuals with known capture location, as described by Stone et al. (2002). Bonobo, gorilla,
and other chimpanzee DNA samples (PR00107, PR00251,
PR00496, and PR00573) were obtained from the Integrated
Biomaterials and Information Resource (IPBIR; http://
www.ipbir.org). DNA from Clint (S006006), the captiveborn chimpanzee who was the donor for the chimpanzee
genome sequence project, was obtained from the Coriell
Institute for Medical Research (http://www.coriell.org).
Tocharacterizethe7gene-disruptivemutations(table1),
polymerase chain reaction (PCR) primers were designed
based on the human Y-chromosome sequence using the
Primer3 computer program (Rozen and Skaletsky 2000)
to amplify gene regions encompassing the 7 mutations.
Primer sequences were compared first with the chimpanzee
Y-chromosome sequences to ensure similarity, and second,
with the homologous region on the X-chromosome to ensure Y-chromosome specificity. Primer sequences (all 5#–3#)
used were CYorf15B forward: 5#-ACAAGTGTCAGCTGGTTGAGAA-3# and reverse: 5#-CAGGGGAAAATCTGAATAAAGC-3# (fragment size 691 bp),
TBL1Y forward: 5#-TTCAACAGTTTTCTGCACTTGG-3#
and reverse: 5#-CTCAAGATGGATCAGACATTCG-3#
(917 bp), TMSB4Y forward: 5#-ACAAACCTGGTATGGCTGAGAT-3# and reverse: 5#-CCTAAACGTTCTGCAAGTGTACC-3# (733 bp), USP9Y exon 8 forward:
5#-GTTGTGTCCCCATGAACTATGA-3# and reverse: 5#TAGCATTGTCCAAATGGTCTGA-3# (664 bp), USP9Y
exon 34 forward: 5#-AAACAATGTGCGTTTCTCCTTT-3#
and reverse: 5#-GGTGGAAACTGAAACCATGAAT-3#
(696 bp), USP9Y exon 36 forward: 5#-CATGAAATTGTTTTAGTTTCTGTTCT-3# and reverse: 5#-CTGATGGGGTCTTGCAATAGTT-3# (674 bp), and USP9Y exon 39
forward: 5#-GCAAATAAAAGCTGTTTCTGCAT-3# and
reverse: 5#-GCATTCTAGAGGCACTCAAAAGA-3# (796
bp). PCR reactions were performed in 25 lL reactions using
Platinum Taq (Invitrogen, Carlsbad, California), with the following conditions: 94 °C for 2 min, followed by 40 cycles of
94 °C for 15 s, 59 °C for 30 s, and 70 °C for 30 s.
For each PCR fragment amplification, we included
DNA from both male and female human, chimpanzee,
and bonobo individuals, in order to verify that homologous
fragments from the X-chromosome were not amplified. Following amplification, PCR products were purified with
Shrimp Alkaline Phosphatase and Exonuclease I (USB Corporation, Cleveland, Ohio), cycle sequenced with BigDye
Terminator Cycle Sequencing Kit version 3.1 (Applied
Biosystems, Foster City, California), cleaned with isopropanol, and analyzed by electrophoresis on an Applied Biosystems 3730 capillary sequencer. Sequence data were
manually aligned and analyzed using the Sequencher version 4.6 computer program (Gene Codes Corporation, Ann
Arbor, Michigan). The Y-chromosome sequences generated for this study have been deposited in GenBank with
accession numbers EF197918–EF197935.
Results and Discussion
Origins of Chimpanzee Y-Chromosome Gene-Disruptive
Mutations
Table 1 displays the nucleotide sequence analysis of
each of the 7 characterized gene regions. Because the ancestral lineages separating gorillas and the common ancestor of humans and chimpanzees likely diverged over
a relatively short period of time, ;1 Myr or less (see
fig. 1), gene genealogies from the nuclear genome do
not consistently support the more recent common ancestor
for chimpanzees and humans (Chen and Li 2001). This has
consequences for determining whether fixation events occurred on the human or chimpanzee lineages using the gorilla as an outgroup sequence. However, given the smaller
effective population size and more recent coalescence time
of the Y-chromosome (e.g., Stone et al. 2002), the gorilla
nucleotide sequence can be appropriately used to polarize
human and chimpanzee lineage-specific fixation events on
this chromosome. Our analysis of the male gorilla finds
Chimpanzee Y-Chromosome Gene Loss 855
gorilla
human
bonobo
gene disruptions:
CYorf15b
TBL1Y
USP9Y
chimpanzees:
western
central
eastern
gene disruption: TMSB4Y
8
7
6
5
4
3
2
1
0
Million years ago
FIG. 1.—Timing of Y-chromosome gene losses during chimpanzee
evolution. Disruptions to the coding sequences of 3 Y-chromosome genes
(CYorf15b, TBL1Y, and USP9Y) are estimated to have an origin in the ancestral chimpanzee–bonobo lineage following divergence from the human
lineage, whereas the TMSB4Y coding sequence was disrupted in the chimpanzee lineage following chimpanzee–bonobo Y-chromosome divergence, but prior to the separation of chimpanzee subspecies.
that, for each of the 7 gene regions, the nucleotide sequence
is identical to the human sequence at the site of each of the 7
gene-disruptive mutations (table 1). From this, we infer that
each mutation occurred on the chimpanzee lineage following divergence from the human–chimpanzee common ancestor. This supported the previous conclusions of Hughes
et al. (2005) that were based on comparisons of only the
human and chimpanzee Y-chromosome sequences to the
human X-chromosome sequence.
In polarizing all 7 mutations to the chimpanzee lineage, this simply purports that they have occurred sometime
over the last ;6 Myr, or since the estimated divergence of
Pan and Homo lineages (Kumar et al. 2005). Therefore, in
characterizing the male bonobo nucleotide sequence for
these 7 gene regions, we can estimate the origin of the
gene-disruptive mutations along the chimpanzee lineage.
It should be noted here that with our alignment of chimpanzee and human Y-chromosome sequences, we are only
identifying mutations that have occurred along these 2 lineages and not necessarily those mutations that may have
occurred along the gorilla lineage or the bonobo lineage,
following divergence from chimpanzees. Therefore, there
may be other gene-disruptive mutations along the Ychromosome that are fixed between these species, in which
case any estimates of gene loss from our analysis would be
inaccurate given the ascertainment bias inherent within our
sampling design (i.e., gene regions nonrandomly chosen
based on the presence of known gene-disruptive mutations). Further nucleotide sequence analysis of the entire
gorilla and bonobo Y-chromosome could certainly address
this issue at a later date. However, because of the difficulty
in large-scale amplification and sequencing of these
Y-chromosome regions from genomic DNA (e.g., high
X-chromosome homology), this would likely best be accomplished with a bacterial artificial chromosome–based
sequencing strategy, similar to those used by Hughes
et al. (2005) and Kuroki et al. (2006) to produce their chimpanzee Y-chromosome sequences.
For CYorf15B, TBL1Y, and USP9Y, the same genedisruptive mutations present in the chimpanzee Ychromosome sequences were also present in the bonobo sequence (table 1), indicating that these mutations occurred
and were fixed in the common ancestor of chimpanzees
and bonobos (fig. 1). There are 4 mutations that disrupt
the USP9Y coding region in chimpanzees, all of which were
observed in the bonobo. Chimpanzee–bonobo Y-chromosome divergence has been estimated to ;1.8 MYA (Stone
et al. 2002). Therefore, the disruptive mutations at these 3
genes likely occurred between ;6 and ;1.8 MYA (fig. 1).
In contrast to the other 3 genes, the exon–intron splice
site mutation in exon 1 of the chimpanzee TMSB4Y gene is
not present in our bonobo sequence. Instead, the bonobo
splice site sequence is identical to the human sequence
(table 1), suggesting that the disruptive mutation at this gene
occurred in the chimpanzee lineage following chimpanzee–
bonobo divergence. Both of the publicly available chimpanzee Y-chromosome sequences (Hughes et al. 2005;
Kuroki et al. 2006) are from the western chimpanzee subspecies (Pan troglodytes verus), and thus, the presence of
the mutations in both sequences does not necessarily imply
that they are fixed among chimpanzee subspecies. To address this issue, we additionally obtained nucleotide sequence for this TMSB4Y gene region in 4 wild-born
male chimpanzees representing each subspecies: 1 western
chimpanzee (Pan troglodytes verus), 1 central chimpanzee
(Pan troglodytes troglodytes), 1 eastern chimpanzee (Pan
troglodytes schweinfurthii), and 1 Nigerian chimpanzee
(Pan troglodytes vellerosus). We found that the TMSB4Y
gene-disruptive mutation was present in all 4 subspecies (table
1). Although autosome and X-chromosome gene variation is
often shared across chimpanzee subspecies because of relatively large effective population sizes for these loci in
chimpanzees (e.g., Kaessmann et al. 1999; Fischer et al.
2004; Verrelli et al. 2006), this is not the case for the
Y-chromosome (Stone et al. 2002). Therefore, our data suggest that the TMSB4Y mutation is fixed among chimpanzee
subspecies and occurred after bonobo–chimpanzee divergence (;1.8 MYA) but prior to the divergence of chimpanzee Y-chromosome haplogroups (;0.7 MYA; fig. 1).
Molecular Evidence for Relaxed Functional Constraint
Just as the absence of any of these Y-chromosome
gene-disruptive mutations within any lineage does not by
itself imply a functional protein, the presence of a disruptive
mutation within a coding region does not alone imply pseudogenization. If the gene is still transcribed, the messenger
RNA (mRNA) could have regulatory roles and/or may still
be translated into a shorter protein that remains functional.
Hughes et al. (2005) performed reverse transcriptase–PCR
856 Perry et al.
Table 2
Human–Chimpanzee dN/dS Comparisons for Disrupted YChromosome Gene Regions
Upstream of Disruptive
Mutation
N
Gene
S
Downstream of Disruptive
Mutation
N
S
Sites Diffs Sites Diffs dN/dS Sites Diffs Sites Diffs dN/dS
CYorf15b 112
TBL1Y
680
TMSB4Y
77
USP9Ya 4032
0
26 0
9 205 9
1
19 0
45 1158 14
0.0
307 3
0.301 526 4
NA
24 1
0.923 1922 14
92
143
6
541
3
5
0
4
0.300
0.217
NA
0.985
NOTE.—N, nonsynonymous; S, synonymous. Diffs, Human–chimpanzee differences. NA (not available), could not be calculated due to a zero number of synonymous substitutions in the denominator.
a
The upstream and downstream regions for USP9Y were divided at the point of
the exon 34 disruptive mutation (see Results and Discussion).
(RT–PCR) experiments for detection of mRNA in various
chimpanzee tissues. Although TMSB4Y mRNA was not
found, detectable quantities of CYorf15b, TBL1Y, and USP9Y mRNA were present in multiple tissues. The finding of
mRNA for these latter 3 genes leaves open the possibility
that they are still translated into functional proteins. If this is
the case, we may have certain expectations about the molecular evolutionary signature associated with functional
constraint acting on protein-coding sequences.
Compared with functional genes that may be subject
to purifying or positive selection, pseudogenes are expected
to follow a neutral pattern of nucleotide substitution. If a
gene region is subject to purifying selection, the ratio of
nonsynonymous (amino acid changing) substitutions per
nonsynonymous site to synonymous substitutions per synonymous site (dN/dS) is expected to be less than 1, whereas
under neutrality dN/dS will approximate 1. To evaluate
whether functional constraint may be acting on specific regions of these genes, we aligned the entire human and chimpanzee coding sequences for each of the 4 genes. We
computed and compared dN/dS for each gene for the region
upstream from the disruptive mutation with the region
downstream from the mutation (table 2). If, despite a disruptive mutation, the upstream region of a gene maintains function in chimpanzees, then upstream dN/dS may be different
than that of the downstream region, which follows the disruptive mutation and is expected to be free of functional
constraint.
Using Fisher’s exact tests, we find no significant difference between upstream and downstream region dN/dS,
for any of the 4 genes with chimpanzee lineage gene-disruptive mutations. For USP9Y, because we are not able to
determine which of the 4 disruptive mutations occurred first
(i.e., we can infer only that they all occurred prior to chimpanzee–bonobo divergence), we compared upstream with
downstream dN/dS in this fashion for each of them, and
found no significant difference in any comparison. The results for the USP9Y exon 34 gene-disruptive mutations are
shown in table 2 because this provides the most even division (in terms of bp) between upstream and downstream
regions. However, it is important to note that the small size
of some of these genes (e.g., TMSB4Y; table 2) may prohibit
us from detecting differences in functional constraint between upstream and downstream regions.
Given that we find no clear pattern of differential functional constraint between upstream and downstream
regions, we cannot reject the hypothesis that these 4 genes
have become pseudogenes in the chimpanzee lineage.
However, it is interesting to note that, in general, the whole
gene (combined upstream and downstream regions) dN/dS
values and levels of nucleotide divergence for these genes
are not noticeably different from those observed for
other, intact genes in the X-degenerate portion of the Ychromosome (Hughes et al. 2005; Kuroki et al. 2006).
Therefore, despite the relatively ancient age for many of
the gene-disrupting mutations, the typical dN/dS values
for these genes are inconsistent with expectations of neutrality in the chimpanzee lineage. These seemingly incongruent results could be explained by the tendency for Ychromosome genes to evolve rapidly in general (Hughes
et al. 2005), which may make it difficult to infer subtle differences in functional constraint using comparisons among
subsets of these genes. This raises questions about our general expectations of the molecular signature associated with
potentially gene-disrupting mutations on the Y-chromosome
and whether nonneutral scenarios may explain these patterns.
Once a mutation disrupts a coding region, the gene
may continue to degrade through the neutral fixation of additional gene-disruptive mutations, now that functional
constraint on the protein-coding sequence has become relaxed. Therefore, we may expect that the age of the original
gene-disruptive mutation is correlated with the total number
of disruptive mutations for each gene. Among the 4 chimpanzee Y-chromosome genes with disruptive mutations,
only USP9Y contains multiple mutations that would disrupt
the coding sequence (table 1). In this respect, it is interesting
to note that 4 gene-disruptive mutations occurred prior to
chimpanzee–bonobo divergence, but that none have become fixed in ;1.8 Myr. The coding region of USP9Y
is considerably larger than the 2 other genes that were
disrupted in the chimpanzee–bonobo common ancestor
(CYorf15b and TBL1Y; table 2), and the absence of multiple
disruptive mutations in these genes may simply reflect gene
size rather than functional constraint. Complete coding region sequences for these genes in the bonobo would help to
address this issue. For example, 21 bp downstream from the
USP9Y exon 36 frameshift deletion that occurred in the
chimpanzee–bonobo common ancestor, we coincidentally
found a 16-bp frameshift deletion in the bonobo that is
not present in any other primate lineage examined here
(fig. 2). Therefore, although no gene-disruptive mutations
have apparently become fixed in the chimpanzee lineage in
the last ;1.8 Myr, this gene continues to degrade in the
bonobo lineage. With additional sampling of the bonobo
Y-chromosome sequence, we can better estimate the magnitude of gene-disruptive mutations that may have recently
occurred in our close primate relatives.
Compared with CYorf15b, TBL1Y, and USP9Y, the
coding sequence of TMSB4Y was disrupted more recently
(i.e., following chimpanzee–bonobo divergence). However, the absence of TMSB4Y mRNA from any chimpanzee
tissue (Hughes et al. 2005) strongly suggests that this gene
has become nonfunctional in the chimpanzee lineage. This
is an interesting observation; that is, of the 4 genes that
have coding sequence–disruptive mutations, the one that
Chimpanzee Y-Chromosome Gene Loss 857
AA seq
gorilla
human
chimpanzee
bonobo
E Q S D N E T A G G T K Y R L V G V L V H S G Q
GAGCAGTCTGACAATGAAACTGCAGGAGGCACAAAGTACAGACTTGTAGGAGTGCTTGTACACAGTGGTCAA
GAGCAGTCTGACAATGAAACTGCAGGAGGCACAAAGTACAGACTTGTAGGAGTGCTTGTACACAGTGGTCAA
GAGCAGTCTGACA----AACTGCAGGAGGCACAAAGTACAGACTTGTAGGAGTGCTTGTACACAGTGGTCAA
GAGCAGTCTGACA----AACTGCAGGAGGCACAAAGT----------------GCTTGTACACAGTGGTCAA
A
B
FIG. 2.—Continued degradation of the USP9Y coding region in bonobos. The USP9Y exon 36 gene region shown for several primate species with the
4-bp frameshift deletion (A) that occurred in the chimpanzee–bonobo ancestral lineage, by comparison with the gorilla and human sequences. A second
example of more recent gene degradation is shown by a 16-bp frameshift deletion (B) that is unique to the bonobo lineage.
produces no detectable mRNA is the one that has occurred
much more recently. Similar RT–PCR experiments in bonobo tissue may help to determine whether TMSB4Y transcription was either abolished prior to chimpanzee–bonobo
divergence (i.e., following a regulatory region mutation)
leading to relaxed functional constraint on the amino acid
sequence or, alternatively, if this gene remains functional
provided we find no other disruptive mutations in this gene
in bonobos.
Mating Systems and Y-Chromosome Evolution
Hughes et al. (2005) originally proposed that
CYorf15b, TBL1Y, TMSB4Y, and USP9Y may have been
evolutionary ‘‘casualties’’ of strong positive selection elsewhere on the Y-chromosome. By this action, low-frequency
disruptive mutations may become fixed because a linked
advantageous mutation elsewhere on the Y-chromosome
is highly advantageous. Although this is less likely to happen on X-chromosomal and autosomal haplotypes due to
recombination, the completely linked nonrecombining nature of the Y-chromosome provides for such a scenario
(Rice 1987; Bachtrog 2004). One possible adaptive scenario that could cause differential rates of gene loss on
the Y-chromosome may involve the difference in mating
systems between humans and chimpanzees.
Chimpanzees and bonobos both have multi-male/
multi-female mating systems (Nishida 1968; Kano 1982;
Goodall 1986) with presumably high levels of sperm competition relative to humans. Evolutionary consequences of
this difference may include a relatively greater testis to
body size ratio in chimpanzees than humans (Harcourt
et al. 1981) and significantly rapid evolution for genes involved in sperm development and function in the chimpanzee and bonobo lineages (e.g., Dorus et al. 2004).
Therefore, given the enrichment for genes involved in spermatogenesis on the Y-chromosome, it seems reasonable
that there may have been many selective sweeps during
the evolution of the chimpanzee Y-chromosome as a result
of strong sexual selection. It is also possible that some of
these selective episodes led to the fixation of gene-disruptive
mutations elsewhere on the Y-chromosome. In this study,
we have shown that 3 of the 4 analyzed Y-chromosome
genes were disrupted prior to the divergence of chimpanzees
and bonobos, implying that many sex-specific (i.e., Ychromosomal) fixation events in the chimpanzee lineage
were relatively ancient. These initial interspecific analyses
shed light on the historical impact that gene-disruptive mutations may have on fixation rates (i.e., dN/dS analyses),
whereas population genetic analyses can eventually be
used to test hypotheses about more recent events including
selective sweeps on the Y chromosome (e.g., Filatov et al.
2000; Bachtrog 2004).
It is also possible that one or more of the genedisruptive mutations themselves may have been adaptive.
Olson (1999) has proposed the ‘‘less-is-more’’ hypothesis,
which states that losses of gene function during hominin
evolution may in some cases have conferred a fitness benefit. However, as of yet, few examples conclusively support
this hypothesis. For example, although Stedman et al.
(2004) proposed that a frameshift deletion in the myosin
gene MYH16 led to masticatory gracilization and brain-size
expansion in the genus Homo, this interpretation has subsequently been called into question (Perry et al. 2005;
McCollum et al. 2006). More recently, 2 studies have
shown that a premature stop codon mutation in the human
CASPASE12 gene was likely swept toward fixation by positive selection (Wang et al. 2006; Xue et al. 2006), possibly
because loss of CASPASE12 gene function increases resistance to the system-wide response to infection, or sepsis
(Saleh et al. 2004, 2006). Therefore, it will be interesting
to determine how many examples of gene loss in fact fit
a picture of adaptive evolution when examining differences
between humans and other primates.
For example, given the high levels of sperm competition in chimpanzees, it is difficult to reconcile how chimpanzee USP9Y-disruptive mutations could have been
neutral because loss of function of this gene in humans
leads to the absence of sperm in semen (Sun et al. 1999;
Blagosklonova et al. 2000). Interestingly, Gerrard and Filatov (2005) identified 2 different disruptive mutations in
a small segment of the USP9Y coding region from the black
spider monkey (Ateles geoffroyi). Spider monkeys, like
chimpanzees and bonobos, have a multi-male/multi-female
mating system (Eisenberger 1973; Cant 1978; Chapman
et al. 1993, 1995), raising the possibility that knocking
out USP9Y gene function may have been advantageous
for primates with high levels of sperm competition. However, we cannot exclude the possibility that other genes
compensate for the loss of USP9Y function in nonhuman
primates but not in humans, or that USP9Y gained new
function in the human lineage, such that its disruption is
less deleterious in nonhuman primates. To more fully test
these hypotheses will require Y- chromosome sequences
from additional primate species, including multiple examples of each mating system.
Conclusion
The discussion of gene gain and loss has been of great
interest and debate in understanding how humans and our
primate relatives diverged (e.g., Olson 1999; Gilad et al.
858 Perry et al.
2003; Fortna et al. 2004; Hurles 2004; Wang et al. 2006).
Although we find that many of the Y-chromosome gene
disruptions in the chimpanzee lineage are relatively ancient
in origin, others have found that 3 of these genes are still
transcribed in chimpanzees, and in general we find little evidence for relaxed functional constraint relative to other Ychromosome genes. Therefore, the full pseudogene status of
these genes warrants additional scrutiny. With a greater sampling of gene disruption events throughout the human and
chimpanzee genomes, it will be possible to determine
whether the higher rate of gene disruption in chimpanzees
is unique in comparison to other chromosomes. In light of
the results found here, it will also be of interest to determine
whether genes on other chromosomes that play a role in spermatogenesis or fertility also show different patterns of gene
disruption between the human and chimpanzee genomes.
Acknowledgments
We thank Phil Hedrick for encouraging conversation
and Anne Stone, the New Iberia Research Center, Primate
Foundation of Arizona, IPBIR, and the Coriell Institute for
Medical Research for the primate samples used in this
study. This work was supported by funding to B.C.V. from
the Center for Evolutionary Functional Genomics in The
Biodesign Institute at the Arizona State University.
Literature Cited
Bachtrog D. 2004. Evidence that positive selection drives
Y-chromosome degeneration in Drosophila miranda. Nat
Genet. 36:518–522.
Blagosklonova O, Fellmann F, Clavequin MC, Roux C, Bresson
JL. 2000. AZFa deletions in Sertoli cell-only syndrome: a retrospective study. Mol Hum Reprod. 6:795–799.
Cant JGH. 1978. Population survey of the spider monkey, Ateles
geoffroyi, at Tikal, Guatemala. Primates. 19:525–535.
Chapman CA, White FJ, Wrangham RW. 1993. Defining subgroup size in fission-fusion societies. Folia Primatol (Basel).
61:31–34.
Chapman CA, Wrangham RW, Chapman LJ. 1995. Ecological
constraints on group size—an analysis of spider
monkey and chimpanzee subgroups. Behav Ecol Sociobiol.
36:59–70.
Charlesworth B, Charlesworth D. 2000. The degeneration of
Y chromosomes. Philos Trans R Soc Lond B Biol Sci.
355:1563–1572.
Chen FC, Li WH. 2001. Genomic divergences between humans
and other hominoids and the effective population size of the
common ancestor of humans and chimpanzees. Am J Hum
Genet. 68:444–456.
Chimpanzee Sequencing and Analysis Consortium. 2005. Initial
sequence of the chimpanzee genome and comparison with the
human genome. Nature. 437:69–87.
Dorus S, Evans PD, Wyckoff GJ, Choi SS, Lahn BT. 2004. Rate
of molecular evolution of the seminal protein gene SEMG2
correlates with levels of female promiscuity. Nat Genet. 36:
1326–1329.
Eisenberger JF. 1973. Reproduction in two species of spider monkeys, Ateles fusciceps and Ateles geoffroyi. J Mammal.
54:955–957.
Filatov DA, Moneger F, Negrutiu I, Charlesworth D. 2000. Low
variability in a Y-linked plant gene and its implications for
Y-chromosome evolution. Nature. 404:388–390.
Fischer A, Wiebe V, Paabo S, Przeworski M. 2004. Evidence for
a complex demographic history of chimpanzees. Mol Biol
Evol. 21:799–808.
Fortna A, Kim Y, MacLaren E, et al. (16 co-authors). 2004. Lineage-specific gene duplication and loss in human and great ape
evolution. PLoS Biol. 2:E207.
Gerrard DT, Filatov DA. 2005. Positive and negative selection on
mammalian Y chromosomes. Mol Biol Evol. 22:1423–1432.
Gilad Y, Man O, Paabo S, Lancet D. 2003. Human specific loss of
olfactory receptor genes. Proc Natl Acad Sci USA. 100:3324–
3327.
Goodall J. 1986. The chimpanzees of Gombe: patterns of behavior. Cambridge: Belknap Press of Harvard University Press.
Hahn Y, Lee B. 2006. Human-specific nonsense mutations identified by genome-sequence comparisons. Hum Genet.
119:169–178.
Harcourt AH, Harvey PH, Larson SG, Short RV. 1981. Testis
weight, body weight and breeding system in primates. Nature.
293:55–57.
Hughes JF, Skaletsky H, Pyntikova T, Minx PJ, Graves T, Rozen S,
Wilson RK, Page DC. 2005. Conservation of Y-linked genes
during human evolution revealed by comparative sequencing
in chimpanzee. Nature. 437:100–103.
Hurles M. 2004. Gene duplication: the genomic trade in spare
parts. PLoS Biol. 2:E206.
Kaessmann H, Wiebe V, Paabo S. 1999. Extensive nuclear DNA
sequence diversity among chimpanzees. Science. 286:1159–
1162.
Kano T. 1982. The social group of pygmy chimpanzees (Pan paniscus) of Wamba. Primates. 23:171–188.
Kumar S, Filipski A, Swarna V, Walker A, Hedges SB. 2005.
Placing confidence limits on the molecular age of the human-chimpanzee divergence. Proc Natl Acad Sci USA.
102:18842–18847.
Kuroki Y, Toyoda A, Noguchi H, et al. (19 co-authors). 2006. Comparative analysis of chimpanzee and human Y chromosomes unveils complex evolutionary pathway. Nat Genet. 38:158–167.
Lahn BT, Page DC. 1997. Functional coherence of the human
Y chromosome. Science. 278:675–680.
McCollum MA, Sherwood CC, Vinyard CJ, Lovejoy CO, Schachat F. 2006. Of muscle-bound crania and human brain evolution: the story behind the MYH16 headlines. J Hum Evol.
50:232–236.
Muller HJ. 1918. Genetic variability, twin hybrids and constant
hybrids, in a case of balanced lethal factors. Genetics.
3:422–499.
Newman TL, Tuzun E, Morrison VA, Hayden KE, Ventura M,
McGrath SD, Rocchi M, Eichler EE. 2005. A genome-wide
survey of structural variation between human and chimpanzee.
Genome Res. 15:1344–1356.
Nishida T. 1968. The social group of wild chimpanzees in the
Mahale Mountains. Primates. 9:167–224.
Olson MV. 1999. When less is more: gene loss as an engine of
evolutionary change. Am J Hum Genet. 64:18–23.
Perry GH, Verrelli BC, Stone AC. 2005. Comparative analyses
reveal a complex history of molecular evolution for human
MYH16. Mol Biol Evol. 22:379–382.
Rice WR. 1987. Genetic hitchhiking and the evolution of reduced
genetic activity of the Y sex chromosome. Genetics. 116:
161–167.
Rozen S, Skaletsky HJ. 2000. Primer3 on the WWW for
general users and for biologist programmers. In: Krawetz S,
Misener S, editors. Bioinformatics methods and protocols:
methods in molecular biology. Totowa (NJ): Humana Press.
p. 365–386.
Saleh M, Mathison JC, Wolinski MK, Bensinger SJ, Fitzgerald P,
Droin N, Ulevitch RJ, Green DR, Nicholson DW. 2006.
Chimpanzee Y-Chromosome Gene Loss 859
Enhanced bacterial clearance and sepsis resistance in caspase12-deficient mice. Nature. 440:1064–1068.
Saleh M, Vaillancourt JP, Graham RK, et al. (16 co-authors).
2004. Differential modulation of endotoxin responsiveness
by human caspase-12 polymorphisms. Nature. 429:75–79.
Sambrook J, Russell DW. 2001. Molecular cloning: a laboratory
manual. Cold Spring Harbor (NY): Cold Spring Harbor Laboratory Press.
Skaletsky H, Kuroda-Kawaguchi T, Minx PJ, et al. (40 co-authors).
2003. The male-specific region of the human Y chromosome is
a mosaic of discrete sequence classes. Nature. 423:825–837.
Stedman HH, Kozyak BW, Nelson A, Thesier DM, Su LT, Low
DW, Bridges CR, Shrager JB, Minugh-Purvis N, Mitchell MA.
2004. Myosin gene mutation correlates with anatomical
changes in the human lineage. Nature. 428:415–418.
Stone AC, Griffiths RC, Zegura SL, Hammer MF. 2002. High levels of Y-chromosome nucleotide diversity in the genus Pan.
Proc Natl Acad Sci USA. 99:43–48.
Sun C, Skaletsky H, Birren B, Devon K, Tang Z, Silber S, Oates R,
Page DC. 1999. An azoospermic man with a de novo point
mutation in the Y-chromosomal gene USP9Y. Nat Genet.
23:429–432.
Tilford CA, Kuroda-Kawaguchi T, Skaletsky H, et al. (12 coauthors). 2001. A physical map of the human Y chromosome.
Nature. 409:943–945.
Tyler-Smith C, Howe K, Santos FR. 2006. The rise and fall of the
ape Y chromosome? Nat Genet. 38:141–143.
Varki A, Altheide TK. 2005. Comparing the human and chimpanzee genomes: searching for needles in a haystack. Genome
Res. 15:1746–1758.
Verrelli BC, Tishkoff SA, Stone AC, Touchman JW. 2006. Contrasting histories of G6PD molecular evolution and malarial
resistance in humans and chimpanzees. Mol Biol Evol.
23:1592–1601.
Wang X, Grus WE, Zhang J. 2006. Gene losses during human
origins. PLoS Biol. 4:e52.
Watanabe H, Fujiyama A, Hattori M, et al. (45 co-authors). 2004.
DNA sequence and comparative analysis of chimpanzee chromosome 22. Nature. 429:382–388.
Xue Y, Daly A, Yngvadottir B, et al. (14 co-authors). 2006. Spread
of an inactive form of caspase-12 in humans is due to recent
positive selection. Am J Hum Genet. 78:659–670.
Yan HT, Shinka T, Kinoshita K, et al. (11 co-authors). 2005. Molecular analysis of TBL1Y, a Y-linked homologue of TBL1X
related with X-linked late-onset sensorineural deafness. J
Hum Genet. 50:175–181.
Yoko Satta, Associate Editor
Accepted January 3, 2007