* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download •How? . . . _____ - Model High School
Human genome wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
Nutriepigenomics wikipedia , lookup
DNA profiling wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Designer baby wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
Oncogenomics wikipedia , lookup
Expanded genetic code wikipedia , lookup
Genomic library wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
SNP genotyping wikipedia , lookup
Epitranscriptome wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Cancer epigenetics wikipedia , lookup
DNA polymerase wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Genetic code wikipedia , lookup
DNA vaccination wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Molecular cloning wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Epigenomics wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Microsatellite wikipedia , lookup
Non-coding DNA wikipedia , lookup
History of genetic engineering wikipedia , lookup
Microevolution wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Frameshift mutation wikipedia , lookup
DNA supercoil wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Primary transcript wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Helitron (biology) wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
11/28/2012 DNA HEREDITY = passing on • __________ of characteristics from parents to offspring The molecule of heredity DNA! • How? . . . _____ 1 DNA 2 I. DNA, Chromosomes, Chromatin and Genes DNA = blueprint of life (has • ______ the instructions for making an organism) Chromatin = uncoiled DNA • ___________ Chromosome = coiled DNA • ______________ 3 46 chromosomes • You have ___ 23 pairs in the ________ nucleus of or ___ each body cell. • _____ 23 from Mom and _____ 23 from Dad 5 4 Gene = a • _______ segment of DNA that codes for a protein, which in turn codes for a trait (skin tone, eye color, etc); a gene is a stretch of DNA. –There is a gene for every protein your body has to make. 6 1 11/28/2012 II. DNA A. Shape and Structure • Deoxyribonucleic Acid • Located in the nucleus of the cell ___________________ genes • Codes for your _______ Frank Griffith • _____________ • DNA nucleotide components: 1. _____________ Deoxyribose (simple sugar) Phosphate 2. ___________ group _______ Nitrogen bases 3. _______________ discovered DNA in 1928 7 (A,T,C,G) 8 B. Base Pairing • Shaped similar to a twisted ladder . . . therefore . . . double helix ! ____________ • The uprights of this ladder are composed of ____________ phosphates and ___________________ deoxyribose sugar • 1953: James Watson and Francis Crick ___________________________________ discovered the DNA double helix. What you may not know is that without ___________________ Rosalind Franklin they would have never made their discovery. 9 10 DNA DNA Purines = • _________ adenine (A) and guanine (G) Pyrimidines = • _____________ thymine (T) and cytosine (C) • The rungs are composed of 2 bases (a purine and pyrimidine) joined at the center by weak hydrogen __________ bonds. 11 12 2 11/28/2012 Direction of the two DNA strands: 5’ = orientation of the sugar • ___ has carbon on the left 3’ = orientation of the sugar • ___ has carbon on the right Direction of the two DNA strands: • The _____ top strand is oriented 5’-3’ and bottom the ________ strand is opposite 3’-5’ 13 B. Base Pairing • 1962: James Watson and Francis Crick ___________________________________ discovered that A always bonds with T and C bonds with G 14 DNA thymine are Adenine and _________ • _________ complementary. They both require ___ 2 hydrogen bonds. • __________ Cytosine and _________ guanine are complementary. They both 3 hydrogen bonds. require ___ 15 Sequence of bases determines • __________ the genetic information and is unique to each organism. • If the organisms are closely alike the related the more _______ DNA nucleotide sequence will be. 17 16 • The rungs of the ladder can occur in any order (as long as base-pair rule is followed). the ______________ • If the order of base pairs in a DNA molecule is changed what might occur? MUTATIONS! 18 3 11/28/2012 • DNA is made of double a ________ strand of nucleotides. • The DNA from each side is complementary ________________ to the other side. • If you know the sequence of one side you can determine the sequence of the other side. 19 20 C. Two Functions of DNA • What is the complementary strand to this DNA molecule? 1. To direct and control protein synthesis ___________________. DNA replication = 2. _________________ reproducing an exact copy of DNA so that the information can be passed on during cellular division. AATCGTACCGAT T T AG CA T GG C T A 21 22 D. DNA Replication D. DNA Replication Semiconservative replication = parental _____________________________ strands of DNA separate, serve as a template, and produce DNA molecules that have one strand of parental DNA and one strand of new DNA. ____________ Replication is the process where DNA makes a copy of itself. 23 24 4 11/28/2012 Semiconservative Replication reduce the number copying errors. • Helps ________ • 3 stages: ___________, unwinding base pairing, and joining. Why does DNA need to replicate? • Cells divide for an organism to grow or reproduce; every new cell needs a copy of the DNA or instructions to know how to be a cell. • DNA replicates right before a cell divides (MITOSIS) ___________. 25 E. Replication Steps 26 E. Replication Steps DNA polymerase (an 2) Base pairing: __________________ enzyme) runs along the parent chain of DNA in the 3’-5’ direction and bonds free floating nucleotides to the parent (original) chain - - based on base pairing rules. 1) Unwinding: DNA helicase (an enzyme unwinds _________) and unzips the double helix and begins to break the H bonds between the nitrogen bases. − The newly assembled strand is called a leading strand of nucleotides and ________________ reforms the double helix. − Each new strand is a _____________ complement of parent strand. 27 E. Replication Steps 28 E. Replication Steps DNA ligase 4) Joining: Another enzyme, _____________ then bonds these Okazaki fragments lagging strand together into the ________________. 3) Because DNA synthesis can only occur 5’ to 3’, a second type of DNA polymerasebinds to the other ________________ template strand as the double helix opens. − DNA polymerase synthesizes discontinuous segments of nucleotides (called ___________________). Okazaki fragments 29 30 5 11/28/2012 E. Replication Steps DNA Replication Therefore, the result is the formation of ___ 2 DNA molecules, each of which is identical to the original DNA molecule. 31 32 F. What makes up our characteristics? What makes you tall or short? • If you have brown hair, what makes it brown, as opposed to blonde, or red? • A pigment called melanin _________, • The lengths of your bones are made up of a framework of _______________. protein fibers protein is a _________, what you see as “brown” in the hair. 33 So, if heredity material controls our traits, and your traits are made of proteins, then shouldn’t heredity material control the making of proteins? 34 • This is exactly what _____ DNA does!! • The order of nitrogen bases _________________ (A, T, C, G) determines the protein type of _________ that is assembled. 35 36 6 11/28/2012 • If the order of bases is accidentally mutations changed, then _______________ occur which can change the proteins that need to be made. Radiation and Mutations 37 38 • If a hair cell needs to make melanin. III. Link between DNA & Proteins • In the cytoplasm of each cell, there are tiny organelles where proteins are assembled. What are they called? • How do the instructions to synthesize this protein get from the DNA to the ribosome? 39 • Something must carry these instructions from the nucleus to the ribosomes in the cytoplasm. This “messenger” molecule is mRNA ________!! 40 A. RNA: Ribonucleic Acid 41 Structure: DNA RNA Strands of nucleotides Double Single Sugars Deoxyribose Ribose Nitrogen bases A, T, C, G A, U, C, G 42 7 11/28/2012 single stranded • Structure: _________________ • Function: Carries the _____ DNA message from the nucleus to the ribosomes. • _______ Codon = set of three nitrogen bases representing an amino acid • Three kinds of RNA mRNA 1. ________ messenger RNA 43 44 tRNA tRNA transfer RNA 2. _______ anticodon that is a • Structure: has an ___________ mRNA codon at complement to the ______________ amino acid at the one end and an ______________ other end. 45 46 tRNA amino acids to • Function: Carries the _____________ the ribosomes for protein production. rRNA 3. ______ ribosomal RNA Structure: a part of ribosome Function: Creates the peptide bonds ___________________ between the amino acids during protein production. 47 48 8 11/28/2012 The molecule of heredity 49 50 DNA transfers this _____ information to mRNA, which carries the code to the ribosome where tRNA tRNA decodes it. ______ anticodons base pair with mRNA’s codons. Then rRNA forms peptide bonds ______ amino acids to between ____________ form a _________. protein IV. Protein Synthesis Overview: • The _________ protein created is determined by the base arrangement in DNA (code sequence) 51 • The process of protein synthesis is broken down into two sub-processes: transcription and translation. 1. Transcription ____________ = the process through which _____ DNA transfers the code to ______. mRNA 52 2. ____________ Translation = the process through which mRNA is decoded and forms a protein. ribosome •Takes places at a __________ Takes place in the _________. nucleus 53 54 9 11/28/2012 Transcription: from DNA to mRNA 1. _________________ RNA polymerase (enzyme) attaches at a specific location on DNA. 2. The enzyme then causes the DNA strands to separate from one another and allow one of the DNA decoded strands to be __________. 55 3. mRNA nucleotides are floating around in the nucleus to find their complement on the DNA strand and ______ bond together. This is possible due to the basepairing rules. 4. Once the DNA segment has been copied by the mRNA bases, the mRNA strand separates from the DNA. 57 56 5. The mRNA (messenger RNA) nucleus through leaves the _________ a nuclear pore and enters the ___________ cytoplasm → goes to the ___________ ribosomes for protein synthesis. 6. DNA zips up again to create the original double helix. 58 • Without transcription, the ribosome would have no idea what proteins the body needed and would not make any. Why is Transcription Important? • It is needed to get the _______________ DNA message out of the _________ nucleus so the ribosomes know what _________ protein to make! 59 60 10 11/28/2012 Translation (Protein Synthesis) from RNA to Protein You could _____ NOT replace the hair that we lose every day; could NOT grow long fingernails; be able to fight off disease; cells would fall apart because the proteins were not being __________!! replaced codon of mRNA 1. First _______ attaches to __________. ribosome 61 2. _______ tRNA (transfer RNA) each carries a specific amino acid; the tRNA anticodon will pair up with its complementary mRNA codon. 4. The tRNA is __________ recycled to find another of the same amino acid so the process can occur again and again. 5. The protein chains are then transported to other areas of the body that need them. 62 3. When the 1st and 2nd amino acid is in place, the rRNA joins them by peptide bond As forming a ________________. process continues, amino acid chain is formed until a stop codon. 63 64 65 66 11 11/28/2012 Why is Translation Important? proteins • Makes all the __________ that the body need. • Without translation, proteins would not be made and we could not replace the proteins that are depleted or damaged. 67 Summary of Protein Synthesis 68 • NOTE: mRNA and tRNA never have ___ T’s in the sequence! Always use the mRNA strand to code for _______ amino acids the ________________. • Below you will find the base sequence of a single strand of DNA. Please fill in the complementary bases of mRNA, tRNA and the correct amino acid sequence. 69 70 DNA Code DNA & mRNA TACTTGCATGGAATGGTAACGGTAACTG TAC TTGCATGGAATGGTAACGGTAACTG AUGAACGUACCUUACCAUUGCCAUUGAC 71 72 12 11/28/2012 DNA & mRNA & tRNA Amino Acids TACTTGCATGGAATGGTAACGGTAACTG A U G A AC G U A C C U U A C C A U U GC C A U U GA C • Use the mRNA strand! • AUG – methoinine (start) UACUUBCAUBBAAUBBUAACBBUAACUG • AAC – asparagine • GUA – valine • CCU – proline • UAC – tyrosine • CAU – histidine • UGC – cysteine • CAU – histidine • UGA - stop 73 74 75 76 Mutations 77 78 13 11/28/2012 MUTATIONS MUTATIONS Chromosomal Mutations ____________________________ Gene Mutations ____________________________ Translocation Inversion Nondisjunction Point Frameshift Base Insertion Insertion/deletion Base deletion 79 VOCABULARY: 80 VOCABULARY: Mutation = • ____________ a random error or change in DNA sequence that may affect whole chromosomes or just one gene. Mutagen = • ____________ certain substances or conditions that can create a greater rate of mutation 81 82 Chromosomal Mutations: Mutagens: • Changes in chromosomes, usually during meiosis when gametes are being made. • Examples: –Some viruses _________ –High temperatures –______________ Chemicals –Radiation 83 84 14 11/28/2012 Chromosomal Mutations: 1. ________________ Nondisjunction = failure of homologous chromosomes to separate during meiosis resulting in gametes(egg or sperm) with too few or too many chromosomes. 85 Chromosomal Mutations: 86 Chromosomal Mutation: REMEMBER: Humans are diploid creatures; meaning _________ for every chromosome in our body, there is another one to match it. ____________ Aneuploidy = abnormal number of chromosomes. Ex. Trisomy, monosomy 87 88 ANEUPLOIDY: ANEUPLOIDY: • ________ Trisomy = zygote contains three copies of the chromosome. • ____________ Monosomy = zygote contains only one chromosome of the pair (it is missing one chromosome). –Ex: Down syndrome, Klinefelter’s (XXY) 89 90 15 11/28/2012 Chromosomal Mutation: Chromosomal Mutation: 2. _________ Deletion = occurs when part of a chromosome is missing. 3. ______________ Duplication = occurs when part of a chromatid breaks off and attaches to its sister chromatid. The result is a duplication of genes on the same chromosome. 91 Chromosomal Mutation: 92 Chromosomal Mutation: Inversion = Segment of chromosome 4. ___________ breaks off and is reinserted backwards (will flip upside down) 5. ________________ Translocation = occurs when part of one chromosome breaks off and is added to a different chromosome. 93 94 Gene Mutations: Gene Mutations: Changes in DNA sequence that will then change the amino acid sequence. (Remember: amino acids make up our proteins!) 1. ________________ Point mutation = a change in a single base pair in DNA. 95 96 16 11/28/2012 Gene Mutations: Frameshift Mutation: 2. ______________ Frameshift _____________ mutation = error in the DNA sequence that adds or deletes a single nitrogen base, causing nearly all amino acids following the mutation to be changed. • ______________ Base deletion = One nitrogen base (A, T, C or G) is deleted from the DNA sequence. 97 98 99 100 Frameshift Mutation: • _______________ Base insertion = Extra nitrogen base is added to the DNA sequence. Mutations Mutations: Can be bad but . . . • DNA is constantly subject to mutations, accidental changes in its code. • Mutations can lead to missing or malformed proteins, and that can lead to disease. • However, few mutations are bad for you. In fact, some mutations can be beneficial. Over time, genetic mutations create genetic diversity, which keeps populations healthy. Many mutations have no effect at all. These are called silent mutations. 101 • Cyclops shark: 102 17 11/28/2012 Mutations: Not necessarily a bad thing Mutations: Not necessarily a bad thing • The speckled moth: • Sickle-Cell Anemia & Malaria: During industrial Had a mutation that revolution trees weremade them black and covered with soot. not speckled. They “Mutated” black were easily seen by moths survived. birds and eaten. 103 104 Mutations • The mutations we hear about most often are the ones that cause disease. • Some well-known inherited genetic disorders include cystic fibrosis, sickle cell anemia, Tay-Sachs disease, phenylketonuria and color-blindness, among many others. • All of these disorders are caused by the mutation of a single gene. 105 18