* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download DNA Word Messages
Human genome wikipedia , lookup
DNA paternity testing wikipedia , lookup
Epigenetics wikipedia , lookup
DNA barcoding wikipedia , lookup
History of RNA biology wikipedia , lookup
DNA sequencing wikipedia , lookup
Transcription factor wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
Epigenetics in learning and memory wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Non-coding RNA wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Genomic library wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Microevolution wikipedia , lookup
Frameshift mutation wikipedia , lookup
DNA profiling wikipedia , lookup
SNP genotyping wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
DNA polymerase wikipedia , lookup
DNA vaccination wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Molecular cloning wikipedia , lookup
Point mutation wikipedia , lookup
Genealogical DNA test wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
History of genetic engineering wikipedia , lookup
Epigenomics wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Non-coding DNA wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Helitron (biology) wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Transfer RNA wikipedia , lookup
DNA supercoil wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Expanded genetic code wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Genetic code wikipedia , lookup
Messenger RNA wikipedia , lookup
1. CTACGTGCGCAGAGGCATCGGGGAAAAAAA 2. AAAGTACGGTAGGTCGGAAATCGAAAAAAA 3. TACAATTTCGTATAAGGGATCTTAAAAAAAA 4. AGGATACTTCATGTCAACAGAAATCAAAAAA 5. ACTACCGAACTCGGCCTCTTATCAGGGAAAA 6. CCGGTACTTGAAGATTAAAATCCGGAGAAAA 7. GCGCTACACGAAGACAGGAATCGATCAAAAA 8. ATACTCGCACGCTGCGATCGGCCTTTTAAAAA 9. TCGGGCTACCCCCAATGTACCGTCAGTATCAA 10. AAGGATACCAGGTCTTTCCAATCAGGATTCAA 11. ACCGTACAGCCGTCTAGAGATCGATTTCAAAA 12. CTACGTGACTCTGGCAATCGATCAAGAAAAAA 13. TTACTTCATGTCATATGTCATCGGGAACAAAA 14. GGAAGGATACTGCGAGACTAACCCGATCAAAA 15. ATTCATACTTGCATCTCTCTTTTCCAATCAAAAA 16. TTTCCTACCCCTGATTAACCAGTATCGCCAAAA 17. TTAATACGTGACTCGGTCCATCGGGGCCGGCAA 18. AAAAAATACGCCCATCTCTAAGGGATCGGCAA 19. CAACTACTTGCAGATTAAATTTCCAATCAAAAA 20. TTTTTACCGAGATGTGGCTAACCCGATCACAAA DNA Message Number Copy the DNA Message Complementary DNA chain mRNA from the Original DNA Message Circle the codons on the mRNA above starting with the Start Codon (AUG) and end at the Stop Codon (UAG) Determine the AntiCodons for the Codons circled above. Find the words that the tRNA would represent and determine the message. DNA Message Number Copy the DNA Message Complementary DNA chain mRNA from the Original DNA Message Circle the codons on the mRNA above starting with the Start Codon (AUG) and end at the Stop Codon (UAG) Determine the AntiCodons for the Codons circled above. Find the words that the tRNA would represent and determine the message. Analysis: 1. How is complementary base paring different when pairing DNA to DNA than when pairing DNA to mRNA? 2. What is the role of each of the following molecules in protein synthesis? a. DNA b. mRNA c. tRNA d. Amino Acids e. Splicosome 3. What is the process of transcription? 4. What location does transcription occur? 5. What is the process of translation? 6. What location does translation occur? 7. Each mRNA has a cap and poly-A-tail. What is their purpose? 8. Compare and contrast DNA polymerase and RNA polymerase? 9. Does transcription and translation start at the first nucleotide of the gene? Explain your answer. 10. After transcription, mRNA is edited to become mature mRNA. Explain this editing process 11. What is the significance of a promoter and transcription factors? 12. Explain the difference between a codon and an anticodon. 13. Why were the words written on the backs of the anticodon cards? Amino Acids tRNA Amino Acids tRNA a an and are ACC CUG GAU GCU UGU AAG CAU CAA Batman's best biology breath butt cheese day dog dress Ducks ear eat every father fun funny girls hockey I idiot is jump kicks kind L.A. Kings like look UCG CCG CGA GGA GAA GUC CCA ACA AGU AGC AUU CAG UUU UGA CUU UCC GCC GAG UUG GCA ACU GAC AGG UAG UGC UCA UAA has have love mother Mr. Clendenon much nice nothing old padded play read smells so someone superman teaches team tell the them they tights to us wax weak wears with you your "START" "STOP" UAC AUC GUG CCU GGG GGC UAU GCG CGU UCU AUG CGG UUC GGU CGC GUU AAU AAC AUA GUA CAC CUC AGA AAA CUA UUA UGG ACG CCC