Download DNA Structure, Replication and Translation Review

AP Biology
Name: Answer Key______________
Review of DNA Structure, DNA Replication and Protein Synthesis
1. Complete the following chart about purine and pyrimidine nucleotides.
Number of Rings
Purine
2
Pyrimidine
1
Examples
Adenine, Cytosine
Thymine, guanine, uracil
2. What is the position of the sugar-phosphate backbone relative to the bases? Is it outside or inside the
bases? The sugar-phosphate backbone is on the outside of the bases, with the bases attaching to the
sugars.
3. What type of bond holds the sugar and phosphate together? Is this bond strong or weak? What is the
significance of this? They are joined by covalent bonds called phosphodiester linkages. These are strong
bonds that are not meant to break. This helps to keep a strand of DNA or RNA intact.
4. What type of bond holds together the two strands of DNA in the double helix? Is this bond strong or
weak? What is the significance of this? The two strands are held together by hydrogen bonds. This type
of bond is weak alone, but strong with multiple bonds working together. This allows for the strands to be
easily unzipped from one end to another.
5. Here is a sequence of bases in a nucleic acid molecule: 5’ CGCAGAAGGCAA 3’. Is this sequence
located in a DNA molecule or an RNA molecule? How can you tell? You can’t tell because it doesn’t
contain any uracil or thymine. If it contained thymine, it would be a DNA molecule, and if it contained
uracil it would be an RNA molecule.
6. Below is a section of DNA. Write the complementary DNA sequence below it and label the 5’ and 3’
ends.
5’
A G C A A T G C C G T A T A C 3’
3’
T C G T T A C G G C A T A T G 5’
7. The following are the materials needed for the process of DNA replication. For each material, state
what its role is in the process of replication.
Substances Needed for Replication
Helicase
Primase
Role
Enzyme that untwists the double helix at the replication fork,
separating the two strands
Stabilize the unwound parental DNA; holds the strands apart
while they serve as templates for the synthesis of new
complementary strands
Joins RNA nucleotides to make the primer
RNA nucleotides
Nucleotides that contain ribose and are used to make mRNA
DNA Polymerase
Enzyme that brings DNA nucleotides together on a new strand of
DNA
Nucleotides that contain Deoxyribose and are used to make DNA
Single Stranded Binding Proteins
DNA Nucleotides
Ligase
Nuclease
Telomerase
Joins the Okazaki fragments from the lagging strand into a single
DNA strand
DNA cutting enzyme; used to remove a damaged section of a
strand of DNA
Enzyme that catalyzes the lengthening of telomeres; replaces lost
DNA segments on the leading strand that are left after the RNA
primer is removed from a strand of DNA
8. What are Okazaki fragments? Why is the DNA in the lagging strand synthesized in fragments rather
than continuously? Okazaki fragments are the pieces of DNA that are synthesized on the lagging strand
of DNA, which are later joined together to create a continuous strand of DNA. The lagging strand is
synthesized in fragments because nucleotides can only be added to a preexisting chain of nucleotides
going in the 5’  3’ direction. So RNA primers attach to the lagging end in segments, and the
nucleotides attach to the primer, and the fragments are later connected by ligase.
9. How does the process of protein synthesis differ between eukaryotic and prokaryotic cells? Because
prokaryotic cells don’t have a nucleus, they can go directly from transcription to translation. Eukaryotic
mRNA needs to be processed before it can leave the nucleus.
10. Fill in the missing letters:
DNA (Complementary Strand)
TGTGCACGT
DNA (Template Strand)
ACACGTGCA
mRNA
UGUGCACGU
tRNA
ACUCGUGCA
11. The following are the materials involved in the process of protein synthesis. For each material, state
what its role is in the process of protein synthesis.
Substances Involved in
Protein Synthesis
Promoter
A region of DNA where RNA polymerase attaches and initiates transcription
Transcription Factors
Mediate the binding of RNA polymerase and the initiation of transcription
RNA Polymerase
Pries the two strands of DNA apart and hooks together the RNA nucleotides
as they base-pair along the DNA template
Modified form of a guanine nucleotide; helps protect the mRNA from
degradation by hydrolytic enzymes; functions as part of an “attach here” sign
for ribosomes
Inhibits degradation of the RNA; helps the ribosome attach to it
5’ Cap
Poly-A Tail
snRNPs
Splicosome
Intron
Exon
tRNA
Ribosome
Role
Small nuclear ribonucleoproteins; recognize sites where introns end and
mRNA is supposed to be cut and spliced together
Made up of snRNPs combined with addition proteins; interacts with the
splice sites at the end of an introns; cuts at specific points to release the
introns, then immediately joins together the two exons that flanked the intron
Noncoding segments of DNA; lends stability to the DNA molecule as a
whole
Coding segments of DNA
Transfer RNA; each molecule connects to a specific amino acid and functions
to bring them together according to the sequence contained in a segment of
mRNA
Site of protein synthesis where the mRNA and tRNA come together to
assemble amino acids in the appropriate order to form a polypeptide
12. Transcribe and translate the following piece of DNA.
Direction of Transcription
3’ ATGTTCCCACTGACATGATCAACCACGT 5’ (DNA)
5’ UACAAGGGUGACUGUACUAGUUGGUGCA 3’ (mRNA)
Tyr  Lys  Gly  Asp  Cys  Thr  Ser Trp  Cys (Protein)
13. Explain the effect that the following mutations have on the structure of the protein.
A. silent mutation No effect; the change results in the same amino acid
B. missense mutation Still creates an amino acid, but the wrong amino acid
C. nonsense mutation Prematurely stops an amino acid chain because it makes a codon code for a stop
codon; nearly all lead to a nonfunctioning protein
D. deletion of 1 nucleotide Causes a frameshift, and every amino acid from the mutation onward will be
different.
E. deletion of 3 nucleotides Deletes an entire amino acid; everything afterwards remains unchanged