* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download DNA Structure, Replication and Translation Review
Promoter (genetics) wikipedia , lookup
DNA repair protein XRCC4 wikipedia , lookup
Polyadenylation wikipedia , lookup
DNA profiling wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Restriction enzyme wikipedia , lookup
Agarose gel electrophoresis wikipedia , lookup
Genomic library wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Messenger RNA wikipedia , lookup
Biochemistry wikipedia , lookup
Genetic code wikipedia , lookup
SNP genotyping wikipedia , lookup
Community fingerprinting wikipedia , lookup
Real-time polymerase chain reaction wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Molecular cloning wikipedia , lookup
Epitranscriptome wikipedia , lookup
Gene expression wikipedia , lookup
Non-coding DNA wikipedia , lookup
Point mutation wikipedia , lookup
DNA supercoil wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Biosynthesis wikipedia , lookup
AP Biology Name: Answer Key______________ Review of DNA Structure, DNA Replication and Protein Synthesis 1. Complete the following chart about purine and pyrimidine nucleotides. Number of Rings Purine 2 Pyrimidine 1 Examples Adenine, Cytosine Thymine, guanine, uracil 2. What is the position of the sugar-phosphate backbone relative to the bases? Is it outside or inside the bases? The sugar-phosphate backbone is on the outside of the bases, with the bases attaching to the sugars. 3. What type of bond holds the sugar and phosphate together? Is this bond strong or weak? What is the significance of this? They are joined by covalent bonds called phosphodiester linkages. These are strong bonds that are not meant to break. This helps to keep a strand of DNA or RNA intact. 4. What type of bond holds together the two strands of DNA in the double helix? Is this bond strong or weak? What is the significance of this? The two strands are held together by hydrogen bonds. This type of bond is weak alone, but strong with multiple bonds working together. This allows for the strands to be easily unzipped from one end to another. 5. Here is a sequence of bases in a nucleic acid molecule: 5’ CGCAGAAGGCAA 3’. Is this sequence located in a DNA molecule or an RNA molecule? How can you tell? You can’t tell because it doesn’t contain any uracil or thymine. If it contained thymine, it would be a DNA molecule, and if it contained uracil it would be an RNA molecule. 6. Below is a section of DNA. Write the complementary DNA sequence below it and label the 5’ and 3’ ends. 5’ A G C A A T G C C G T A T A C 3’ 3’ T C G T T A C G G C A T A T G 5’ 7. The following are the materials needed for the process of DNA replication. For each material, state what its role is in the process of replication. Substances Needed for Replication Helicase Primase Role Enzyme that untwists the double helix at the replication fork, separating the two strands Stabilize the unwound parental DNA; holds the strands apart while they serve as templates for the synthesis of new complementary strands Joins RNA nucleotides to make the primer RNA nucleotides Nucleotides that contain ribose and are used to make mRNA DNA Polymerase Enzyme that brings DNA nucleotides together on a new strand of DNA Nucleotides that contain Deoxyribose and are used to make DNA Single Stranded Binding Proteins DNA Nucleotides Ligase Nuclease Telomerase Joins the Okazaki fragments from the lagging strand into a single DNA strand DNA cutting enzyme; used to remove a damaged section of a strand of DNA Enzyme that catalyzes the lengthening of telomeres; replaces lost DNA segments on the leading strand that are left after the RNA primer is removed from a strand of DNA 8. What are Okazaki fragments? Why is the DNA in the lagging strand synthesized in fragments rather than continuously? Okazaki fragments are the pieces of DNA that are synthesized on the lagging strand of DNA, which are later joined together to create a continuous strand of DNA. The lagging strand is synthesized in fragments because nucleotides can only be added to a preexisting chain of nucleotides going in the 5’ 3’ direction. So RNA primers attach to the lagging end in segments, and the nucleotides attach to the primer, and the fragments are later connected by ligase. 9. How does the process of protein synthesis differ between eukaryotic and prokaryotic cells? Because prokaryotic cells don’t have a nucleus, they can go directly from transcription to translation. Eukaryotic mRNA needs to be processed before it can leave the nucleus. 10. Fill in the missing letters: DNA (Complementary Strand) TGTGCACGT DNA (Template Strand) ACACGTGCA mRNA UGUGCACGU tRNA ACUCGUGCA 11. The following are the materials involved in the process of protein synthesis. For each material, state what its role is in the process of protein synthesis. Substances Involved in Protein Synthesis Promoter A region of DNA where RNA polymerase attaches and initiates transcription Transcription Factors Mediate the binding of RNA polymerase and the initiation of transcription RNA Polymerase Pries the two strands of DNA apart and hooks together the RNA nucleotides as they base-pair along the DNA template Modified form of a guanine nucleotide; helps protect the mRNA from degradation by hydrolytic enzymes; functions as part of an “attach here” sign for ribosomes Inhibits degradation of the RNA; helps the ribosome attach to it 5’ Cap Poly-A Tail snRNPs Splicosome Intron Exon tRNA Ribosome Role Small nuclear ribonucleoproteins; recognize sites where introns end and mRNA is supposed to be cut and spliced together Made up of snRNPs combined with addition proteins; interacts with the splice sites at the end of an introns; cuts at specific points to release the introns, then immediately joins together the two exons that flanked the intron Noncoding segments of DNA; lends stability to the DNA molecule as a whole Coding segments of DNA Transfer RNA; each molecule connects to a specific amino acid and functions to bring them together according to the sequence contained in a segment of mRNA Site of protein synthesis where the mRNA and tRNA come together to assemble amino acids in the appropriate order to form a polypeptide 12. Transcribe and translate the following piece of DNA. Direction of Transcription 3’ ATGTTCCCACTGACATGATCAACCACGT 5’ (DNA) 5’ UACAAGGGUGACUGUACUAGUUGGUGCA 3’ (mRNA) Tyr Lys Gly Asp Cys Thr Ser Trp Cys (Protein) 13. Explain the effect that the following mutations have on the structure of the protein. A. silent mutation No effect; the change results in the same amino acid B. missense mutation Still creates an amino acid, but the wrong amino acid C. nonsense mutation Prematurely stops an amino acid chain because it makes a codon code for a stop codon; nearly all lead to a nonfunctioning protein D. deletion of 1 nucleotide Causes a frameshift, and every amino acid from the mutation onward will be different. E. deletion of 3 nucleotides Deletes an entire amino acid; everything afterwards remains unchanged