Download CHAPTER 14

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project

Document related concepts

Nutriepigenomics wikipedia , lookup

United Kingdom National DNA Database wikipedia , lookup

Genomic library wikipedia , lookup

Short interspersed nuclear elements (SINEs) wikipedia , lookup

SNP genotyping wikipedia , lookup

Designer baby wikipedia , lookup

Cancer epigenetics wikipedia , lookup

RNA interference wikipedia , lookup

Bisulfite sequencing wikipedia , lookup

DNA damage theory of aging wikipedia , lookup

DNA polymerase wikipedia , lookup

Site-specific recombinase technology wikipedia , lookup

No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup

Gel electrophoresis of nucleic acids wikipedia , lookup

RNA world wikipedia , lookup

Molecular cloning wikipedia , lookup

Nucleic acid double helix wikipedia , lookup

NEDD9 wikipedia , lookup

Epigenetics of human development wikipedia , lookup

DNA supercoil wikipedia , lookup

Genomics wikipedia , lookup

DNA vaccination wikipedia , lookup

Microevolution wikipedia , lookup

Replisome wikipedia , lookup

Extrachromosomal DNA wikipedia , lookup

Epigenomics wikipedia , lookup

History of genetic engineering wikipedia , lookup

Cre-Lox recombination wikipedia , lookup

Cell-free fetal DNA wikipedia , lookup

Nucleosome wikipedia , lookup

Gene wikipedia , lookup

Point mutation wikipedia , lookup

Non-coding DNA wikipedia , lookup

Nucleic acid tertiary structure wikipedia , lookup

RNA silencing wikipedia , lookup

Polyadenylation wikipedia , lookup

RNA wikipedia , lookup

Helitron (biology) wikipedia , lookup

Vectors in gene therapy wikipedia , lookup

Messenger RNA wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

History of RNA biology wikipedia , lookup

RNA-Seq wikipedia , lookup

Nucleic acid analogue wikipedia , lookup

Non-coding RNA wikipedia , lookup

Therapeutic gene modulation wikipedia , lookup

RNA-binding protein wikipedia , lookup

Deoxyribozyme wikipedia , lookup

Epitranscriptome wikipedia , lookup

Primary transcript wikipedia , lookup

Transcript
CHAPTER 14
Application and Experimental Questions
E1.
A research group has sequenced the cDNA and genomic DNA from a particular
gene. The cDNA is derived from mRNA, so that it does not contain introns. Here are the
DNA sequences.
cDNA:
5’–
ATTGCATCCAGCGTATACTATCTCGGGCCCAATTAATGCCAGCGGCCAGACT
ATCACCCAACTCGGTTACCTACTAGTATATCCCATATACTAGCATATATTTTA
CCCATAATTTGTGTGTGGGTATACAGTATAATCATATA–3’
Genomic DNA (contains one intron):
5’–
ATTGCATCCAGCGTATACTATCTCGGGCCCAATTAATGCCAGCGGCCAGACT
ATCACCCAACTCGGCCCACCCCCCAGGTTTACACAGTCATACCATACATACA
AAAATCGCAGTTACTTATCCCAAAAAAACCTAGATACCCCACATACTATTAA
CTCTTTCTTTCTAGGTTACCTACTAGTATATCCCATATACTAGCATATATTTTA
CCCATAATTTGTGTGTGGGTATACAGTATAATCATATA–3’
Indicate where the intron is located. Does the intron contain the normal consensus splice
site sequences based on those described in Figure 14.19? Underline the splice site
sequences, and indicate whether or not they fit the consensus sequence.
Answer: The location of the intron within the cDNA is shown below.
cDNA:
5’-ATTGCATCCAGCGTATACTATCTCGGGCCCAATTAATGCCAGC
GGCCAGACTATCACCCAACTCG...INTRON...GTTACCTACTAGTATATCCCATA
TACTAGCATATATTTTACCCATAATTTGTGTGTGGGTATACAGTATAATCATA
TA–3’
You can figure this out by finding where the sequence of the genomic DNA begins to
differ from the sequence of the cDNA. The genomic DNA has the normal splice sites that
are described in Figure 14.19.
Genomic DNA:
5’–
ATTGCATCCAGCGTATACTATCTCGGGCCCAATTAATGCCAGCGGCCAGACT
ATCACCCAACTCGGCCCACCCCCCAGGTTTACACAGTCATACCATACATACA
AAAATCGCAGTTACTTATCCCAAAAAAACCTAGATACCCCACATACTATTAA
CTCTTTCTTTCTAGTTACCTACTAGTATATCCCATATACTAGCATATATTTTAC
CCATAATTTGTGTGTGGGTATACAGTATAATCATATA–3’
The splice donor and acceptor sites are underlined. The space indicates where the strands
in the corresponding RNA would be cut. The branch site is also underlined. The bold A is
the adenine that participates in the splicing reaction.
E2.
Chapter 19 describes a technique known as Northern blotting that can be used to
detect RNA that is transcribed from a particular gene. In this method, a specific RNA is
detected using a short segment of cloned DNA as a probe. The DNA probe, which is
radioactive, is complementary to the RNA that the researcher wishes to detect. After the
radioactive probe DNA binds to the RNA, the RNA is visualized as a dark (radioactive)
band on an X-ray film. As shown here, the method of Northern blotting can be used to
determine the amount of a particular RNA transcribed in a given cell type. If one type of
cell produces twice as much of a particular mRNA compared to another cell, the band
will appear twice as intense. Also, the method can distinguish if alternative RNA splicing
has occurred to produce an RNA that has a different molecular mass.
[Insert Text Art 14.1]
Lane 1 is a sample of RNA isolated from nerve cells.
Lane 2 is a sample of RNA isolated from kidney cells. Nerve cells produce twice as much
of this RNA compared to kidney cells.
Lane 3 is a sample of RNA isolated from spleen cells. Spleen cells produce an
alternatively spliced version of this RNA that is about 200 nucleotides longer than the
RNA produced in nerve and kidney cells.
Let’s suppose a researcher was interested in the effects of mutations on the expression of
a particular structural gene in eukaryotes. The gene has one intron that is 450 nucleotides
long. After this intron is removed from the pre-mRNA, the mRNA transcript is 1,100
nucleotides in length. Diploid somatic cells have two copies of this gene. Make a drawing
that shows the expected results of a Northern blot using mRNA from the cytosol of
somatic cells, which were obtained from the following individuals:
Lane 1:
A normal individual
Lane 2:
An individual homozygous for a deletion that removes the –50 to –100
region of the gene that encodes this mRNA
Lane 3:
An individual heterozygous in which one gene is normal and the other
gene had a deletion that removes the –50 to –100 region
Lane 4:
An individual homozygous for a mutation that introduces an early stop
codon into the middle of the coding sequence of the gene
Lane 5:
An individual homozygous for a three-nucleotide deletion that removes
the AG sequence at the 3’ splice site
Answer: The 1,100-nucleotide band would be observed from a normal individual (lane
1). A deletion that removed the –50 to –100 region would greatly diminish transcription,
so the homozygote would produce hardly any of the transcript (just a faint amount, as
shown in lane 2), and the heterozygote would produce roughly half as much of the 1,100nucleotide transcript (lane 3) compared to a normal individual. A nonsense codon would
not have an effect on transcription; it affects only translation. So the individual with this
mutation would produce a normal amount of the 1,100-nucleotide transcript (lane 4). A
mutation that removed the splice acceptor site would prevent splicing. Therefore, this
individual would produce a 1,550-nucleotide transcript (actually, 1,547 to be precise,
1,550 minus 3). The Northern blot is shown here:
E3.
A gel retardation assay can be used to study the binding of proteins to a segment
of DNA. This method is described in Chapter 19. When a protein binds to a segment of
DNA, it retards the movement of the DNA through a gel, so the DNA appears at a higher
point in the gel (see below).
[Insert Text Art 14.2]
Lane 1: 900 bp fragment alone
Lane 2: 900 bp fragment plus a protein that binds to the 900 bp fragment
In this example, the segment of DNA is 900 bp in length, and the binding of a protein
causes the DNA to appear at a higher point in the gel. If this 900 bp fragment of DNA
contains a eukaryotic promoter for a structural gene, draw a gel that shows the relative
locations of the 900 bp fragment under the following conditions:
Lane 1:
900 bp plus TFIID
Lane 2:
900 bp plus TFIIB
Lane 3:
900 bp plus TFIID and TFIIB
Lane 4:
900 bp plus TFIIB and RNA polymerase II
Lane 5:
900 bp plus TFIID, TFIIB, and RNA polymerase II/TFIIF
Answer: When the 900 bp fragment is mixed with TFIID (lane 1), it would be retarded
because TFIID would bind. When mixed with TFIIB (lane 2), it would not be retarded
because TFIIB cannot bind without TFIID. Compared to lane 1, the 900 bp fragment
would be retarded even more when mixed with TFIID and TFIIB (lane 3), because both
transcription factors could bind. It would not be retarded when mixed with TFIIB and
RNA polymerase (lane 4) because you do not have TFIID, which is needed for the
binding of TFIIB and RNA polymerase. Finally, when mixed with TFIID, TFIIB, and
RNA polymerase/TFIIF, the 900 bp fragment would be retarded a great deal, because all
four factors could bind (lane 5).
E4.
As described in Chapter 19 and in experimental question E3, a gel retardation
assay can be used to determine if a protein binds to DNA. This method can also
determine if a protein binds to RNA. In the combinations described here, would you
expect the migration of the RNA to be retarded due to the binding of a protein?
A.
mRNA from a gene that is terminated in a ρ-independent manner plus ρ-
B.
mRNA from a gene that is terminated in a ρ-dependent manner plus ρ-
protein
protein
C.
pre-mRNA from a structural gene that contains two introns plus the
snRNP called U1
D.
Mature mRNA from a structural gene that contains two introns plus the
snRNP called U1
Answer:
A.
It would not be retarded because ρ protein would not bind to the mRNA that is
encoded by a gene that is terminated in a ρ-independent manner. The mRNA from such
genes does not contain the sequence near the 3’ end that acts as a recognition site for the
binding of ρ protein.
B.
It would be retarded because ρ-protein would bind to the mRNA.
C.
It would be retarded because U1 would bind to the pre-mRNA.
D.
It would not be retarded because U1 would not bind to mRNA that has already
had its introns removed. U1 binds only to pre-mRNA.
E5.
The technique of DNA footprinting is described in Chapter 19. If a protein binds
over a region of DNA, it will protect chromatin in that region from digestion by DNase I.
To carry out a DNA footprinting experiment, a researcher has a sample of a cloned DNA
fragment. The fragments are exposed to DNase I in the presence and absence of a DNAbinding protein. Regions of the DNA fragment that are not covered by the DNA-binding
protein will be digested by DNase I, and this will produce a series of bands on a gel.
Regions of the DNA fragment that are not digested by DNase I (because a DNA-binding
protein is preventing DNase I from gaining access to the DNA) will be revealed, because
a region of the gel will not contain any bands.
In the DNA footprinting experiment shown here, a researcher began with a
sample of cloned DNA that was 300 bp in length. This DNA contained a eukaryotic
promoter for RNA polymerase II. For the sample loaded in lane 1, no proteins were
added. For the sample loaded in lane 2, the 300 bp fragment was mixed with RNA
polymerase II plus TFIID and TFIIB.
[Insert Text Art 14.3]
A.
How long of a region of DNA is “covered up” by the binding of RNA
polymerase II and the transcription factors?
B.
Describe how this binding would occur if the DNA was within a
nucleosome structure? (Note: The structure of nucleosomes is described in Chapter 12.)
Do you think that the DNA is in a nucleosome structure when RNA polymerase and
transcription factors are bound to the promoter? Explain why or why not.
Answer:
A.
The region of the gel from about 250 bp to 75 bp does not contain any bands. This
is the region being covered up; it is about 175 base pairs long.
B.
In a nucleosome, the DNA is wrapped twice around the core histones; a
nucleosome contains 146 bp of DNA. The region bound by RNA polymerase II plus
TFIID and TFIIB would be slightly greater than this length. Therefore, if the DNA was in
a nucleosome structure, these proteins would have to be surrounding a nucleosome. It is a
little hard to imagine how large proteins such as TFIID, TFIIB, and RNA polymerase II
could all be wrapped around a single nucleosome (although it is possible). Therefore, the
type of results shown here makes it more likely that the DNA is released from the core
histones during the binding of transcription factors and RNA polymerase II.
E6.
As described in Table 14.1, several different types of RNA are made, especially in
eukaryotic cells. Researchers are sometimes interested in focusing their attention on the
transcription of structural genes in eukaryotes. Such researchers want to study mRNA.
One method that is used to isolate mRNA is column chromatography. (Note: See the
Appendix for a general description of chromatography.) Researchers can covalently
attach short pieces of DNA that contain stretches of thymine (i.e., TTTTTTTTTTTT) to
the column matrix. This is called a poly-dT column. When a cell extract is poured over
the column, mRNA binds to the column, while other types of RNA do not.
A.
Explain how you would use a poly-dT column to obtain a purified
preparation of mRNA from eukaryotic cells. In your description, explain why mRNA
binds to this column and what you would do to release the mRNA from the column.
B.
Can you think of ways to purify other types of RNA, such as tRNA or
rRNA?
Answer:
A.
mRNA molecules would bind to this column because they have a polyA tail. The
string of adenine nucleotides in the polyA tail is complementary to stretch of thymine in
the poly-dT column, so the two would hydrogen bond to each other. To purify mRNAs,
one begins with a sample of cells; the cells need to be broken open by some technique
such as homogenization or sonication. This would release the RNAs and other cellular
macromolecules. The large cellular structures (organelles, membranes, etc.) could be
removed from the cell extract by a centrifugation step. The large cellular structures would
be found in the pellet, while soluble molecules such as RNA and proteins would stay in
the supernatant. At this point, you would want the supernatant to contain a high salt
concentration and neutral pH. The supernatant would then be poured over the poly-dT
column. The mRNAs would bind to the poly-dT column and other molecules (i.e., other
types of RNAs and proteins) would flow through the column. Because the mRNAs would
bind to the poly-dT column via hydrogen bonds, to break the bonds, you could add a
solution that contains a low salt concentration and/or a high pH. This would release the
mRNAs, which would then be collected in a low salt/high pH solution as it dripped from
the column.
B.
The basic strategy is to attach a short stretch of DNA nucleotides to the column
matrix that is complementary to the type of RNA that you want to purify. For example, if
an rRNA contained a sequence 5’–AUUCCUCCA–3’, a researcher could chemically
synthesize an oligonucleotide with the sequence 3’–TAAGGAGGT–5’ and attach it to
the column matrix. To purify rRNA, one would use this 3’–TAAGGAGGT–5’ column
and follow the general strategy described in part A.