* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download DNA - department of computer & electrical engineering and
Metagenomics wikipedia , lookup
Non-coding RNA wikipedia , lookup
Nucleic acid tertiary structure wikipedia , lookup
SNP genotyping wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
Human genome wikipedia , lookup
Genetic engineering wikipedia , lookup
Designer baby wikipedia , lookup
Cancer epigenetics wikipedia , lookup
DNA polymerase wikipedia , lookup
History of RNA biology wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Microevolution wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Genomic library wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Point mutation wikipedia , lookup
DNA vaccination wikipedia , lookup
Genome editing wikipedia , lookup
Molecular cloning wikipedia , lookup
Epigenomics wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
DNA supercoil wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Non-coding DNA wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Helitron (biology) wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
History of genetic engineering wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Primary transcript wikipedia , lookup
COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering Outline Cell DNA DNA Structure DNA Sequencing RNA (DNA-> RNA) Protein Life begins with Cell Cells are fundamental working units of every living system. A cell is the smallest structural unit of an organism that is capable of independent function Unicellular organism (Any living being consisting of a single cell): mainly bacteria Multicellular organism (Organisms consisting of more than one cell): Plant and animal All cells have some common features Membrane, cytoplasm Cell is able to survive and multiply independently in appropriate environment There are estimated about 6x1013 (60 trillions) cells in a human body, of about 210 distinct cell types Cells may have different sizes: a human red blood cell may be 5 microns in diameter while some neurons are about 1 m long (from spinal cord to leg) Name a cell visible with naked eyes.. Cell The basic unit of life Every living thing is made of cells. Every cell comes from a pre-existing cell All of life’s functions are cellular Living organisms (on Earth) require ability to Separate inside from outside (lipids) Build 3D machinery to perform biological functions (proteins) Store information on how to build machinery (DNA) Organisms – Eukaryotes and Prokaryotes Every organism is composed of one of two radically different types of cells: prokaryotic cells or eukaryotic cells. Prokaryotic cells are simpler than eukaryotic cells Prokaryotes are (mostly) single cellular organisms Eukaryotic cell has a nucleus, separated from the rest of the cell by a membrane Eukaryotes can be single cellular (Yeast) or multicellular (animals, plants) Organisms – Eukaryotes and Prokaryotes Prokaryotes Eukaryotes Single cell Single or multi cell No nucleus Nucleus No organelles Organelles One piece of circular DNA Chromosomes No mRNA post Exons/Introns splicing transcriptional modification Structure of a Eukaryotic Cell • Nucleus contains chromosomes, which are the carrier of the genetic material • Organelles like centrioles, lysosomes, golgi complexes are enclosed compartments within the cell and are responsible for particular biological processes • Area of the cell outside the nucleus and the organelles is called the cytoplasm Composition of Cells Cell membrane Boundary between cell and outside world Cell membranes consist of two layers of lipid molecules with hydrophobic ends facing in (keeps water out) Nucleus Contain genetic material Separated from the rest of the cell by a nuclear membrane The nucleus 1. nuclear envelope 2. nucleolus 3. chromosomes chromosomes All Cells have common Cycles Growth of a single cell and its subsequent division is called the cell cycle M: Mitosis Prokaryotes, particularly bacteria, are extremely successful at multiplying. Multicellular organisms typically begin life as a single cell. The single cell has to grow, divide and differentiate into different cell types to produce tissues and in higher eukaryotes, organs All cells come from pre-existing cells Molecular Biology: Studying life at the molecular level DNA Protein RNA mRNA rRNA tRNA Protein synthesis Protein transcription Protein translation Molecules of Life All Life depends on 3 critical molecules – DNA, RNA, and Protein All 3 are specified linearly DNA and RNA are constructed from nucleic acids (nucleotides) Can be considered to be a string written in a four-letter alphabet (A C G T/U) Proteins are constructed from amino acids Strings in a twenty-letter alphabet of amino acids Central dogma of molecular biology DNA RNA protein phenotype DNA, RNA, Protein Self replication and genetic code DNA DNA → DNA (Replication) RNA DNA → RNA (Transcription / Gene Expression) Protein RNA → Protein (Translation) Outline Cell DNA DNA Structure DNA Sequencing RNA (DNA-> RNA) Protein DNA (Deoxyribonucleic Acid ) Structure Physical structure Double (stranded) helix Sugar & phosphate groups form backbone Complementary bases (A-T, C-G) connected by hydrogen bond 5’ = end w/ free phosphate group 3’ = end w/ free oxygen group DNA Composition Sequence of nucleotides Deoxyribonucleotide = deoxyribose sugar + phosphate group + base Nucleotide Bases Nucleotides The five-carbon sugar (a pentose) in nucleotides has two types Deoxyribose, which has a hydrogen atom attached to its #2 carbon atom (designated 2') : DNA Ribose, which has a hydroxyl group atom there: RNA DNA structure Why 5’ and 3’ Deoxyribonucleotide = deoxyribose sugar + phosphate group + base The deoxyribose sugar in DNA is a pentose, a five-carbon sugar. Four carbons and an oxygen make up the five-membered ring; the other carbon branches off the ring. The carbon constituents of the sugar ring are numbered 1'-4' (pronounced "one-prime carbon"), starting with the carbon to the right of the oxygen going clockwise. The fifth carbon (5') branches from the 4' carbon. DNA - Denaturation, Hybridization DNA For bioinformatics DNA can be represented as a sequence of letters (A,C,G,T) 5’ A T A C G T A 3’ 3’ T A T G C A T 5’ (matching strand, redundant) Terms Base pair (bp) – one pair of DNA bases (1 letter) Gene – section of DNA that produces a functional product Chromosome – physical linear sequence of DNA Genome – entire collection of DNA for an organism E Coli 1 chromosome 5 x 106 bases (5 Mbps) Drosophila 8 chromosomes 2 x 108 bases (200 Mbps) Human 48 chromosomes 3 x 109 bases (3 Bbps) DNA Replication DNA can be replicated DNA strands are split DNA polymerase (enzyme) reads one strand (template) Builds new (complementary) strand to form duplicate DNA DNA fascinating fact Each cell has 2m of DNA Average person has 75 trillion cells = 75 * 1012 Length of DNA in a person = 150 * 1012 m Each person has enough DNA to go to the sun and back 500 times Organization of DNA in chromosomes Histone proteins 3 bases/ amino acid 27,000 bases/ protein (1 gene) 3,000,000,000 base pairs/ genome 20,000 genes/ genome Human Genome Project homologous Genome Gene: Contiguous subparts of single strand DNA that are templates for producing proteins. Chromosomes: compact chains of coiled DNA Genome: The set of all genes in a given organism. Noncoding part: The function of DNA material between genes is largely unknown. Source: www.mtsinai.on.ca/pdmg/Genetics/basic.htm More Terminology The genome is an organism’s complete set of DNA. Human genome has 23 pairs of chromosomes. A bacteria contains about 600,000 DNA base pairs Human and mouse genomes have some 3 billion. Each chromosome contains many genes. Gene Basic physical and functional units of heredity. Specific sequences of DNA bases that encode instructions on how to make proteins. DNA sequences in the human genome DNA homologies 98.7% Outline Cell DNA DNA Structure DNA Sequencing RNA (DNA-> RNA) Protein DNA Sequencing (Sanger’s Dideoxy Method) Method for identifying short DNA sequences Algorithm Replicate DNA with (color-labeled) dideoxy-nucleotides Creates fragments of DNA Apply gel electrophoresis Separates fragments based on size Machine scans gel Records level of color found at each position Software calls bases Predicts base at each position Limitations Upper bound of 700-800 bases on sequence length Larger DNA sequences will need to be assembled DNA Sequencing Dideoxynucleotides Similar to normal nucleotide base Missing 3’ hydroxyl group terminates DNA sequence May be chemically modified to fluoresce under UV light DNA Sequencing Example for GCGAATGTCCACAACGCTACAGGTG Replicate DNA in the presence of dideoxy-Cytidine (ddC) Replication terminates when ddC is used instead of C Produces the following DNA fragments GC GCGAATGTC GCGAATGTCC GCGAATGTCCAC GCGAATGTCCACAAC GCGAATGTCCACAACGC GCGAATGTCCACAACGCTAC DNA Sequencing Gel electrophoresis Place DNA fragments in gel Apply electric field Speed of fragment is determined by size Smaller = faster Larger = slower After given time Fragments are separated in gel Fragments are sorted by size (number of bases) Gel electrophoresis DNA Sequencing DNA Sequencing Outline Cell DNA DNA Structure DNA Sequencing RNA (DNA-> RNA) Protein Central Dogma of Biology: DNA, RNA, and the Flow of Information Replication Transcription Translation Ribonucleic acid (RNA) Composition Sequence of nucleotides Ribonucleotide = ribose sugar + phosphate group + base Major difference between DNA and RNA RNA: usually single stranded RNA: ribose sugar, DNA: Deoxyribose sugar RNA: Uracil (U) instead of Thymine (T) DNA → RNA (Transcription / Gene Expression) RNA polymerase (enzyme) Finds gene initiation marker (codon) on DNA strand Reads DNA strand containing marker Builds (complementary) strand of messenger RNA (mRNA) Stops when gene end marker (codon) found Resulting RNA sequence = transcript Ribonucleotides The five-carbon sugar (a pentose) in nucleotides has two types Deoxyribose, which has a hydrogen atom attached to its #2 carbon atom (designated 2') : DNA Ribose, which has a hydroxyl group atom there: RNA Transcription Example (1) Transcription Example (2) Transcription Example (3) Transcription Example (4) Transcription Example What is Enzyme? Proteins that catalyze (i.e. accelerate) chemical reactions They are not living things Two types of Enzyme Join specific molecules together to form new molecules Break specific molecules apart into separate molecules Things about Enzyme Enzymes are specific: Performing only one specific job, about 3000 types enzymes identified so far Enzymes are catalysts: Can perform that same job over and over again, millions of times, without being consumed in the process. Enzymes are efficient: Enzymes are natural: Once they have done their job, enzymes break down swiftly and can be absorbed back into nature Outline Cell DNA DNA Structure DNA Sequencing RNA (DNA-> RNA) Protein