Download Mitochondrial DNA - MrsWrightsSciencePage

Mitochondrial DNA

… and its’ use in Forensics
Biology Recap

What is the Mitochondria?

The Mitochondria are often considered the Cell
Power house

They generate much of the Eukaryotic Cell’s
ATP --- (remember ATP is the cell’s energy
molecule)
Mitochondria are responsible for…




Cell Energy Production
Cell Growth
Cell Signaling ( sending cell messages)
Cell Death or Apoptosis

Some Human cells have 1 mitochondria

Others have MANY

Can you think of a human cell that might have
hundreds of Mitochondria?
A Muscle Cell!
This is a close up of
Cardiac Muscle fibers
There are hundreds of
Fibers in a single cell
Each M stands for
Mitochondria
Endosymbiotic Theory


The theory that mitochondria and chloroplasts
at some point in time were separate organisms
from a human cell.
They were engulfed by a cell and became a
symbiont
Biologists believe this is how
mitochondria and chloroplasts came
to be
What is the evidence for this theory?

Well mitochondria and chloroplasts both are
separately bound organelles.

More Importantly both chloroplasts and
mitochondria have their own DNA
Mitochondria resemble certain kinds
of bacteria

They even have a circular DNA molecule or
plasmid
Mitochondrial DNA Molecule is
15,000 – 17,000 base pairs long
In mammals all mitDNA consists of
the same 37 genes




13 genes for proteins
22 genes for transfer DNA (tDNA)
1 for the small subunit of the ribosome
1 for the Large subunit of the ribosome
In humans all the Mitochondrial
DNA comes from 1 parent

The Mother
Why is this?

The egg cell has between 100,000 and 1,000,000
copies of mitDNA

The sperm cell only has 10

(when the sperm cell fertilizes the egg, the 10
copies of mitDNA from the sperm are left
behind, erasing the mitDNA from his side of
the family)
Mitochondrial DNA allows scientists
to do a maternal lineage

…or trace a person’s ancestors based on
mitDNA

In order to run a paternal lineage scientists
would have to trace the Y chromosome… this is
a much larger task--- the Y Chromosome is 58
million base pairs long!
Who were the Romanovs?






What happened to the family and their remains?
How did they discover the bodies?
How did they prove the remains in the bog
belonged to the Romanovs?
Which Romanovs matched the MitDNA from
Prince Philip? Which were missing?
Who was Anna Anderson?
Was Anna Anderson princess Anastasia?
Southern Blot

This is the combination of Gel Electrophoresis
and a specific way of probing for a specific
DNA sequence

So you separated your sample by size, How can
you find Gene X?
Method Part 1

Perform a RFLP and run your samples on a Gel
Electrophoresis to separate your sample by size
Part 2: Blot your sample onto a
nitrocellulose membrane

Once your DNA samples are on the membrane,
denature it

You can do this by adding a base such as NaOH
Your double stranded DNA will
become Single stranded DNA
Step 3: Once this is done you can
add your detecting probe to bind
with your DNA

A Probe is a specific sequence of DNA
For Example

ATTACGATCCCCATCCACC

If we add a probe that has the sequence
AGGGG….where will this bind?

If we add a flourescent marker to our AGGGG
tag, then wherever the marker binds there will
be a glowing band… like this
Step 4: Wash away excess Probe
Step 5: Detection



Usually this is a visualization of your specific
DNA sequence
Audioradiography ( if you used a radio active
probe)
Or Luminence if you used a flourescent probe

The main purpose of the Southern Blot is to
take a bunch of unknown DNA sequences, and
find a specific gene or sequence
Left is Gel Electrophoresis, Right
is a Southern Blot…a specific
DNA sequence was found
Southern Blot would be used


In cases where a suspect is known to have a
known genetic defect, such as Cystic Fibrosis
Any specific DNA sequence that would provide
evidence
The Polymerase Chain
Reaction (PCR)
Or DNA photo copying
Why would anyone want to make
more copies of DNA?

PCR allows us to take a very tiny amount of
DNA and multiply this into millions of copies

It lets us decode tiny, trace amounts of DNA –
Like in the Amanda Knox case.

Once we have billions of copies, we can
sequence the DNA strand and determine who
that DNA came from



PCR has allowed us to map segments of the
Human Genome that code for rare diseases…
this allows us to do genetic testing – on infants
and on you!
this also allows you to be able to find out if you
have the gene for Alzheimer's Disease, or
Parkinson’s Disease or Cystic Fibrosis or many
other genetic diseases

PCR is also a test used to determine if you have
the HIV virus in your blood cells.
Kary Mullis



The American Molecular Biologist who invented
PCR
1985
Won the Nobel Prize in Chemistry in 1993
How does PCR work?

4 Steps
Denaturing
 Annealing
 Extension
 Exponential Extension

Thermus aquaticus - a very tiny
bacteria!!



Thermus aquaticus lives in the nice warm hot
springs and thermal vents in Southwestern USA
These hot springs are between 75 and 80
degrees C
Taq has enzymes that function well at these high
temperatures

Looks like this!!--->

Taq Polymerase
Poly = many
 Ase = to make


This enzyme copies DNA
PCR Step 1: Denature your DNA
sample



Heat your DNA sample up to about 98 degrees
C, almost boiling for 20-30 seconds
This will make your two DNA strands come
apart
How else can you denature DNA?
Double stranded molecule pulls
apart at high temperatures
Step 2 Annealing of Primers


“Anneal” means “to bind”
Primers: regions of DNA that are the message to begin
DNA replication

Add these DNA segments to our Denatured DNA and
let them bind.

*This step also only takes 20-30 seconds*
Step 3: Elongation



Add the Taq polymerase
Add Extra nucleotides (A,T,C,and G)
Set heat for 75-80 degrees C

Time it takes to elongate depends - usually 5-15
minutes

DNA polymerase can elongate DNA at a rate of 1,000
bases/minute!!!
Step 4: Repeat!!!

We repeat these steps, 30-40 times to
EXPONENTIALLY CLONE our DNA
sample!!!
How many copies can you make?
So why is this useful?
>It takes billions of copies to sequence a gene
segment
STR - Short Tandem Repeats

This is the method currently used in the U.S. for
a “DNA Fingerprint”

Short
Tandem (or code)
Repeat


Tandem Repeats

A term used to explain a coded region that
repeats itself

Example
ATTGCATTGCATTGCATTGCATTGC

Short Tandem Repeats
Term used for application

Commonly used in Forensics

Repeats are usually between 2 and 10 base pairs

Forensic Scientists generally use 4-5 bp repeats
Tandem Repeats are generally
considered Introns

Introns are generally NONCODING DNA
segments or Junk DNA
Not all people have the same
number of Repeats on an STR
segment

Even if two people had similar repeats for one
region, there is a very slim chance that two
different people would have the same number of
repeats at each of the 13 coded, repeat regions
The Human Genome project has
discovered 13 Variable Repeat
regions on the Human Genome

Not including sex chromosomes

How does STR work?
A DNA sample would be treated
and the Repeat sequences would
be amplified using PCR

Once these regions have been amplified, they
are visualized by Gel Electrophoresis

This will tell you how many repeats there are of
a particular segment

Once a profile is created Scientists can send
results to CODIS
CODIS - Combined DNA Index
System

An FBI funded database that houses DNA
samples of Serial criminals and Sex offenders

FBI requires 10 of the 13 CODIS regions to be
uploaded to the Database
Over 4.5 million Profiles
Has positively identified 49,500 DNA samples
helping to solve of 50,500 investigations



The chances of two people having the same
DNA fingerprint at all 13 loci is 1 in 1 Billion
DNA Analysis in Forensics


Originally began with RFLP and Gel
Electrophoresis
The invention of PCR and STR brought about
the ability to sequence and compare small
regions of DNA

*Eventually it is possible that our DNA
sequencing technology will allow us to do direct,
accurate comparisons of very large DNA
segments and possibly even a whole genome*
DNA Use as Evidence






Compare suspect DNA to DNA left at Crime
Scene
Exonerate innocent people of a crime
Identify crime and catastrophe victims
Family lineages (paternal and maternal linkage)
Trace STD’s to rape victim / Track Disease
Trace Agricultural products back to a farm
DNA analysis at this point is not
100% effective
Identical twins share 100% DNA
People who are related have similar DNA - so we
have to be sure that the regions we are coding
are large enough to account for this
Human Mating is not random
Neither is Violent Crime - most violent crime is
committed by someone the victim knew.