* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Gene Finding - Brigham Young University
Extrachromosomal DNA wikipedia , lookup
Gene desert wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Epigenetics in learning and memory wikipedia , lookup
Point mutation wikipedia , lookup
Essential gene wikipedia , lookup
Primary transcript wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Genetic code wikipedia , lookup
Public health genomics wikipedia , lookup
Short interspersed nuclear elements (SINEs) wikipedia , lookup
Oncogenomics wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Gene expression programming wikipedia , lookup
Quantitative trait locus wikipedia , lookup
Transposable element wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Genomic library wikipedia , lookup
Genomic imprinting wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Metagenomics wikipedia , lookup
Non-coding DNA wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Ridge (biology) wikipedia , lookup
Human genome wikipedia , lookup
Genome (book) wikipedia , lookup
Pathogenomics wikipedia , lookup
Biology and consumer behaviour wikipedia , lookup
History of genetic engineering wikipedia , lookup
Designer baby wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Gene expression profiling wikipedia , lookup
Microevolution wikipedia , lookup
Genome editing wikipedia , lookup
Minimal genome wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Gene Finding Finding Genes • Prokaryotes – Genome under 10Mb – >85% of sequence codes for proteins • Eukaryotes – Large Genomes (up to 10Gb) – 1-3% coding for vertebrates Introns • Humans – – – – 95% of genes have introns 10% of genes have more than 20 introns Some have more than 60 Largest Gene (Duchenne muscular dystrophy locus) spans >2Mb (more than a prokaryote) – Average exon = 150b – Introns can interrupt Open Reading Frame at any position, even within a codon – ORF finding is not sufficient for Eukaryotic genomes Open Reading Frames in Bacteria • Without introns, look for long open reading frame (start codon ATG, … , stop codon TAA, TAG, TGA) • Short genes are missed (<300 nucleotides) • Shadow genes (overlapping open reading frames on opposite DNA strands) are hard to detect • Some genes start with UUG, AUA, UUA and CUG for start codon • Some genes use TGA to create selenocysteine and it is not a stop codon Eukaryotes • Maps are used as scaffolding during sequencing • Recombination is used to predict the distance genes are from each other (the further apart two loci are on the chromosome, the more likely they are to be separated by recombination during meiosis) • Pedigree analysis Gene Finding in Eukaryotes • Look for strongly conserved regions • RNA blots - map expressed RNA to DNA • Identification of CPG islands – Short stretches of CG rich DNA are associated with the promoters of vertebrate genes • Exon Trapping - put questionable clone between two exons that are expressed. If there is a gene, it will be spliced into the mature transcript Computational methods • Signals - TATA box and other sequences – TATA box is found 30bp upstream from about 70% of the genes • Content - Coding DNA and non-coding DNA differ in terms of Hexamer frequency (frequency with which specific 6 nucleotide strings are used) – Some organisms prefer different codons for the same amino acid • Homology - blast for sequence in other organisms Genome Browser • http://genome.ucsc.edu/ • Tables • Genome browser Non-coding RNA genes • Ribosomal rRNA, transfer tRNA can be recognized by stochastic context-free grammars • Detection is still an open problem QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Hidden Markov Models (HMMs) • Provide a probabilistic view of a process that we don’t fully understand • The model can be trained with data we don’t understand to learn patterns • You get to implement one for the first lab!! State Transitions Markov Model Example. --x = States of the Markov model -- a = Transition probabilities -- b = Output probabilities -- y = Observable outputs -How does this differ from a Finite State machine? -Why is it a Markov process? QuickTime™ and a TIFF (Uncompressed) decompressor are needed to see this picture. Example • Distant friend that you talk to daily about his activities (walk, shop, clean) • You believe that the weather is a discrete Markov chain (no memory) with two states (rainy, sunny), but you cant observe them directly. You know the average weather patterns Formal Description states = ('Rainy', 'Sunny') observations = ('walk', 'shop', 'clean') start_probability = {'Rainy': 0.6, 'Sunny': 0.4} transition_probability = { 'Rainy' : {'Rainy': 0.7, 'Sunny': 0.3}, 'Sunny' : {'Rainy': 0.4, 'Sunny': 0.6}, } emission_probability = { 'Rainy' : {'walk': 0.1, 'shop': 0.4, 'clean': 0.5}, 'Sunny' : {'walk': 0.6, 'shop': 0.3, 'clean': 0.1}, } Observations • Given (walk, shop, clean) – What is the probability of this sequence of observations? (is he really still at home, or did he skip the country) – What was the most likely sequence of rainy/sunny days? Matrix Rainy Sunny walk .6*.1 .4*.6 shop .7*.4 .4*.4 .3*.3 .6*.3 clean .7*.5 .4*.5 .3*.1 .6*.1 Sunny, Rainy, Rainy = (.4*.6)(.4*.4)(.7*.5) The CpG island problem • Methylation in human genome – “CG” -> “TG” happens in most places except “start regions” of genes and within genes – CpG islands = 100-1,000 bases before a gene starts • Question – Given a long sequence, how would we find the CpG islands in it? Hidden Markov Model X=ATTGATGCAAAAGGGGGATCGGGCGATATAAAATTTG Other CpG Island Other How can we identify a CpG island in a long sequence? Idea 1: Test each window of a fixed number of nucleitides Idea2: Classify the whole sequence Class label S1: OOOO………….……O Class label S2: OOOO…………. OCC … Class label Si: OOOO…OCC..CO…O … Class label SN: CCCC……………….CC S*=argmaxS P(S|X) = argmaxS P(S,X) S*=OOOO…OCC..CO…O CpG HMM is just one way of modeling p(X,S)… A simple HMM 0.7 P(B)=0.5 P(I)=0.5 0.5 Parameters 0.3 B Initial state prob: p(B)= 0.5; p(I)=0.5 I P(x|B) P(x|I) 0.5 State transition prob: p(BB)=0.7 p(BI)=0.3 p(IB)=0.5 p(II)=0.5 P(x|HOther)=p(x|B) P(x|HCpG)=p(x|I) P(a|B)=0.25 P(t|B)=0.40 P(c|B)=0.10 P(g|B)=0.25 P(a|I)=0.25 P(t|I)=0.25 P(c|I)=0.25 P(g|I)=0.25 Output prob: P(a|B) = 0.25, … p(c|B)=0.10 … P(c|I) = 0.25 … A General Definition of HMM HMM ( S ,V , B, A, ) Initial state probability: N states S {s1 ,..., sN } { 1 ,..., N } N i 1 i 1 i : prob of starting at state si State transition probability: M symbols V {v1 ,..., vM } A {aij } Output probability: B {bi (vk )} 1 i N, 1 k M 1 i, j N N a j 1 aij : prob of going si s j M b (v ) 1 k 1 i k bi (vk ) : prob of " generating " vk at si ij 1 P(x|B) How to “Generate” a Sequence? 0.7 P(x|I) 0.5 0.3 P(a|B)=0.25 P(t|B)=0.40 P(c|B)=0.10 P(g|B)=0.25 B P(B)=0.5 a c g t B I I I I I I B P(a|I)=0.25 P(t|I)=0.25 P(c|I)=0.25 P(g|I)=0.25 I 0.5 t P(I)=0.5 … B model Sequence B I B states B I I B …… Given a model, follow a path to generate the observations. How to “Generate” a Sequence? P(x|B) 0.7 0.5 0.3 P(a|B)=0.25 P(t|B)=0.40 P(c|B)=0.10 P(g|B)=0.25 B 0.5 a c g t t 0.5 B 0.3 I 0.25 a 0.5 0.25 c P(a|I)=0.25 P(t|I)=0.25 P(c|I)=0.25 P(g|I)=0.25 I P(B)=0.5 0.5 I 0.25 g 0.5 Sequence B 0.25 t model P(I)=0.5 … I P(x|I) 0.4 t P(“BIIIB”, “acgtt”)=p(B)p(a|B) p(I|B)p(c|I) p(I|I)p(g|I) p(I|I)p(t|I) p(B|I)p(t|B) HMM as a Probabilistic Model t2 o2 t3 o3 t4 … o4 … Observation variable: O1 O2 O3 O4 … Hidden state variable: S1 S2 S3 S4 … Time/Index: t1 Data: o1 Sequential data Random variables/ process State transition prob: p(S1 , S2 ,..., ST ) p(S1 ) p( S2 | S1 )... p( ST | ST 1 ) Probability of observations with known state transitions: p(O1 , O2 ,..., OT | S1 , S2 ,..., ST ) p(O1 | S1 ) p(O2 | S2 )... p(OT | ST ) Joint probability (complete likelihood): Init state distr. Output prob. p(O1 , O2 ,..., OT , S1 , S2 ,..., ST ) p( S1 ) p(O1 | S1 ) p( S2 | S1 ) p(O2 | S2 )... p( ST | ST 1) p(OT ST ) Probability of observations (incomplete likelihood): p(O1 , O2 ,..., OT ) p(O1 , O2 ,..., OT , S1 ,...ST ) S1 ,...ST State trans. prob.