Download Review-examII-2010

Review session for exam-II
Lectures 6-9
DNA Replication

Q1. An assay used to determine
carcinogenic potential is the
____________ test.
DNA Replication

Q2. The Watson and Crick model of
DNA is called __________-DNA
DNA Replication

Q3. E. coli DNA polymerase III:




can initiate replication without a primer.
is efficient at nick translation.
is the principal DNA polymerase in
chromosomal DNA replication.
requires a free 5'-hydroxyl group as a
primer.
DNA Replication

Q4. The primer for DNA synthesis is
an RNA molecule formed by the
enzyme _______________.
DNA Replication

Q5. The DNA strand that is replicated
continuously is known as the
_____________ strand.
DNA Replication
Q6. UV light causes damage to DNA by
forming __________________.
DNA Replication

Q7. The human, genetic skin disease,
caused by a mutation in components
of the human nucleotide-excisionrepair pathway is called
___________________.
DNA Replication

Q8. An Okazaki fragment is a:





fragment of DNA resulting from endonuclease
action.
fragment of RNA that is a subunit of the 30S
ribosome.
piece of DNA that is synthesized in the 3' ® 5'
direction.
segment of DNA that is an intermediate in the
synthesis of the lagging strand.
segment of mRNA synthesized by RNA
polymerase.
DNA Replication






Q9. What is the formula for linking?
A)Lk = Wr − Tw
B)Lk = Wr + Tw
C)Tw = Wr + Lk
D)All of the above.
E)None of the above.
DNA Replication

Q10. What is true about DNA
polymerases?





A)There are five structural classes.
B)All have finger and thumb domains that
wrap around the DNA.
C)All catalyze the same reaction, which
requires metal cofactors.
D)a and c.
E)a, b, and c.
DNA Replication

Q11. The proofreading function of DNA
polymerase involves all of the following
except:





a 3' ® 5' exonuclease.
base pairing.
detection of mismatched base pairs.
phosphodiester bond hydrolysis.
reversal of the polymerization reaction.
DNA Replication

Q12. At replication forks in E. coli:





DNA helicases make endonucleolytic
cuts in DNA.
DNA primers are degraded by
exonucleases.
DNA topoisomerases make
endonucleolytic cuts in DNA.
RNA primers are removed by primase.
RNA primers are synthesized by primase.
DNA Replication

Q13. The Ames test is used to:





detect bacterial viruses.
determine the rate of DNA replication.
examine the potency of antibiotics.
measure the mutagenic effects of various
chemical compounds.
quantify the damaging effects of UV light
on DNA molecules.
DNA Replication

Q14.The DNA below is replicated from
left to right. Label the templates for
leading strand and lagging strand
synthesis.


(5')ACTTCGGATCGTTAAGGCCGCTTTCTGT(3')
(3')TGAAGCCTAGCAATTCCGGCGAAAGACA(5')
DNA Replication

Q15. DNA replication in E. coli begins at a site in the DNA
called the (a) ___________. At the replication fork the (b)
___________ strand is synthesized continuously while the (c)
_________ strand is synthesized discontinuously. On the
strand synthesized discontinuously, the short pieces are called
(d) ____________ fragments. An RNA primer for each of the
fragments is synthesized by an enzyme called (e)
__________, and this RNA primer is removed after the
fragment is synthesized by the enzyme (f) ___________,
using its (g) _____________ activity. The nicks left behind in
this process are sealed by the enzyme (h) _____________.
DNA Replication

Q16. Briefly describe the biochemical role of
the following enzymes in DNA replication in
E. coli:






(a) DNA helicase;
(b) primase;
(c) the 3' ® 5' exonuclease activity of DNA
polymerase;
(d) DNA 1igase;
(e) topoisomerases;
(f) the 5' ® 3' exonuclease activity of DNA
polymerase I.
DNA Repair

Q17. The high fidelity of DNA replication is
due primarily to immediate error correction
by the 3' —> 5' exonuclease (proofreading)
activity of the DNA polymerase. Some
incorrectly paired bases escape this
proofreading, and further errors can arise
from challenges to the chemical integrity of
the DNA. List some of repair mechanisms
that the cell can use to help correct such
errors.
Exploring genes

Q18. 2’,3’-dideoxyribonucleotides are used in Sanger
sequencing methods. Which of the following best describes
the mechanism by which 2’,3’-dideoxyribonucleotides cause
chain termination in these reactions?





2’,3’-dideoxyribonucleotides act as allosteric inhibitors of DNA
polymerase.
2’,3’-dideoxyribonucleotides act as suicide inhibitors of DNA
polymerase.
2’,3’-dideoxyribonucleotides destabilize DNA by base-catalyzed
hydrolysis.
2’,3’-dideoxyribonucleotides cannot be incorporated into
elongating DNA molecules.
2’,3’-dideoxyribonucleotides can be incorporated into DNA but
prevent subsequent chain elongation.
Exploring genes

Q19. Assume that a mRNA molecule
has the following sequence:

5’AUGCUCACUUCAGGGAGAAGC

What are the coding and template
strands of the DNA?
Exploring genes

Q20. Name the following steps in the
flow of genetic information?




DNA----- DNA
DNA----- RNA
RNA---- DNA
RNA---- Protein
RNA synthesis

Q21. In which direction does mRNA
synthesis by RNA polymerase occur?





5’  3’
3’  5’
NC
CN
AU
RNA synthesis

Q22. Which of the following best describes
the TATA box?





It is a sequence in chromosomes that marks
replication origins.
It is a sequence in the promoter region of genes
that marks transcription start sites.
It is a sequence in primary transcripts that
marks cleavage and polyadenylation sites.
It is a sequence in primary transcripts that
marks splice sites.
It is a sequence in mRNAs that marks
translation start sites.
RNA synthesis
Q23. Which of the following best characterizes the
termination of transcription?






The sequence signals for termination of transcription are
contained within the transcript itself.
The transcriptional termination sequence is a site in the
DNA approximately 30 base pairs downstream of the
actual termination point.
Transcription terminates when the polymerase reaches a
stop codon.
Transcription terminates when the polymerase reaches
the promoter of the adjacent downstream gene.
Transcription terminates when the polymerase reaches
the start codon of the adjacent downstream gene.
RNA synthesis

Q24. Which of the following enzymes
catalyzes the synthesis of DNA at the ends
of linear chromosomes, using an RNA
template complexed with the enzyme?





DNA ligase
DNA polymerase
Helicase
Nuclease
Telomerase
RNA synthesis

Q25. Which of the following best describes
the structure of the mRNA cap?





guanosine, attached via a 5’-3’ monophosphate
linkage
guanosine, attached via a 5’-5’ triphosphate
linkage
7-methylguanosine, attached via a 5’-3’
monophosphate linkage
7-methylguanosine, attached via a 5’-3’
triphosphate linkage
7-methylguanosine, attached via a 5’-5’
triphosphate linkage
RNA synthesis

Q26. Spliceosomes are primarily
composed of which of the following
types of RNA?





miRNA
siRNA
snRNA
rRNA
tRNA
DNA repair

Q27. Which of the following
processes involves DNA ligase?





Homologous recombination
Nucleotide-excision repair
Telomere extension
Topoisomerization
Transcription
DNA, RNA, tRNA general

Q28. Which of the following most
accurately describes the relative
abundance (by total mass) of RNA species
inside cells?





mRNA < rRNA < tRNA
mRNA < tRNA < rRNA
rRNA < tRNA < mRNA
tRNA < mRNA < rRNA
tRNA < rRNA < mRNA
DNA, RNA, tRNA general

Q29. How many amino acids are
there in the standard genetic code?





3
4
16
20
64
DNA, RNA, tRNA general
Q30. Which of the following best describes the
degeneracy of the genetic code?






Some codons are specified by multiple amino acids;
these amino acids are usually similar in chemical
properties.
Some amino acids are specified by multiple codons;
these codons usually differ only at the first position.
Some amino acids are specified by multiple codons;
these codons usually differ only at the second position.
Some amino acids are specified by multiple codons;
these codons usually differ only at the third position.
Some amino acids are specified by multiple codons;
these codons are usually unrelated in sequence.
DNA, RNA, tRNA general

Q31. The insertion of one nucleotide in the
coding sequence of a gene is most likely to
lead to which of the following mutations?





Frameshift mutation
Missense mutation
Nonsense mutation
Silent mutation
Transversion mutation
Exploring genes

Q32. Which of the following reactions is
catalyzed by reverse transcriptase?





3’  5’ polymerization of DNA from an RNA
template
3’  5’ polymerization of RNA from a DNA
template
3’  5’ polymerization of RNA from a
polypeptide template
5’  3’ polymerization of DNA from an RNA
template
5’  3’ polymerization of RNA from a
polypeptide template
Protein synthesis
Q33. Which of the following best characterizes the
relationship between amino acids and tRNAs?






The activation of an amino acid by formation of an aminoacyltRNA is coupled to the hydrolysis of ATP to AMP + 2 Pi.
The conformation of an aminoacyl-tRNA facilitates the direct
interaction between the amino acid and its appropriate codon in
the mRNA-ribosome complex.
Formation of the ester linkages between a tRNA and its
corresponding amino acid is catalyzed by the tRNA itself.
A tRNA binds to its appropriate amino acid through a covalent
linkage of the amino acid’s side chain to the base of the
nucleotide immediately 5’ of the anticodon.
A tRNA is a six-nucleotide RNA molecule consisting of an
anticodon followed by a CCA sequence that accepts amino
acids.
Exploring genes

Q34. Double stranded regions of RNA:




A. do not occur
B. can be observed in the lab but not in
cells
C. can form between two selfcomplementary regions of the same
single strand of RNA
D. have the two strands arranged in
parallel
Exploring genes

Q35. A major component of RNA but
not of DNA is:





A. adenine
B. guanine
C. cytosine
D. uracil
E. Thymine
Exploring genes

Q36. For the oligoribonucleotide
pACGUAC:





A. the nucleotide at the 5’ end is a pyrimidine
B. the nucleotide at the 3’ end has a
phosphate at its 3’ hydroxyl
C. the nucleotide at the 5’ end has a
phosphate at its 5’ hydroxyl
D. all of the above are true
None of the above is true
DNA replication


Q37. Which enzyme is catalyzing the
following reaction?
(DNA)n + dNTP----> (DNA)n+1 +Ppi

Write two important functions of this enzyme.
Exploring genes

Q38. The biological role of restriction
enzymes is to:





aid recombinant DNA research.
degrade foreign DNA that enters a bacterium.
make bacteria resistant to antibiotics.
restrict the damage to DNA by ultraviolet light.
restrict the size of DNA in certain bacteria.
Exploring genes
Q39. Certain restriction enzymes produce
cohesive (sticky) ends. This means that they:






A. cut both DNA strands at the same base pair.
B. cut in regions of high GC content, leaving ends that
can form more hydrogen bonds than ends of high AT
content.
C. make a staggered double-strand cut, leaving ends with
a few nucleotides of single-stranded DNA protruding.
D. make ends that can anneal to cohesive ends
generated by any other restriction enzyme.
E. stick tightly to the ends of the DNA they have cut.
DNA replication
Q40. The proofreading function of DNA
polymerase involves all of the following
except:





a 3' ® 5' exonuclease.
base pairing.
detection of mismatched base pairs.
phosphodiester bond hydrolysis.
reversal of the polymerization reaction.
DNA repair

Q41. In base-excision repair, the first
enzyme to act is:





AP endonuclease.
Dam methylase.
DNA glycosylase.
DNA ligase.
DNA polymerase.
DNA replication
Q42. Describe briefly how Sanger’s
dideoxy method works for sequencing
DNA.
DNA replication
Q43. A suitable substrate for DNA
polymerase is shown below. Label the
primer and template, and indicate which end
of each strand must be 3' or 5'.



To observe DNA synthesis on this substrate in
vitro, what additional reaction components must
be added?
DNA-dependent synthesis of RNA
Q44. Which of the following statements about E.
coli RNA polymerase (core enzyme) is false?






In the absence of the s subunit, core polymerase has little
specificity for where initiation begins.
The core enzyme contains several different subunits.
The core enzyme has no polymerizing activity until the s
subunit is bound.
The RNA chain grows in a 5' ® 3' direction.
The RNA product is complementary to the DNA template.
DNA-dependent synthesis of RNA

Q45. “Footprinting” or DNase protection is
a technique used to identify:





a region of DNA that has been damaged by
mutation.
E. coli cells that contain a desired, cloned piece
of DNA.
the position of a particular gene of a
chromosome.
the position of internally double-stranded
regions in a single-stranded DNA molecule.
the specific binding site of a repressor,
polymerase, or other protein on the DNA.
RNA processing

Q46. A branched (“lariat”) structure is
formed during:




attachment of a 5' cap to mRNA.
attachment of poly(A) tails to mRNA.
processing of preribosomal RNA.
splicing of introns.
RNA processing
Q47. Splicing of introns in nuclear mRNA
primary transcripts requires:





a guanine nucleoside or nucleotide.
endoribonucleases.
polynucleotide phosphorylase.
RNA polymerase II.
small nuclear ribonucleoproteins (snurps).
DNA-dependent synthesis of RNA

Q48. Write the sequence of the
messenger RNA molecule
synthesized from a DNA template
strand having the sequence:
(5')ATCGTACCGTTA(3')
Protein synthesis
Q49. Which of the following are features of the
wobble hypothesis?





A naturally occurring tRNA exists in yeast that
can read both arginine and lysine codons.
A tRNA can recognize only one codon.
Some tRNAs can recognize codons that specify
two different amino acids, if both are nonpolar.
The “wobble” occurs only in the first base of the
anticodon.
The third base in a codon always forms a normal
Watson-Crick base pair.
Protein synthesis
Q50. Which of the following statements about tRNA
molecules is false?





A, C, G, and U are the only bases present in the
molecule.
Although composed of a single strand of RNA, each
molecule contains several short, double-helical regions.
Any given tRNA will accept only one specific amino acid.
The amino acid attachment is always to an A nucleotide
at the 3' end of the molecule.
There is at least one tRNA for each of the 20 amino
acids.
Protein synthesis
Q51. Which of the following statements about
the tRNA that normally accepts
phenylalanine is false? (mRNA codons for
phenylalanine are UUU and UUC.)





It interacts specificially with the Phe synthetase.
It will accept only the amino acid phenylalanine.
Its molecular weight is about 25,000.
Phenylalanine can be specifically attached to
an —OH group at the 3' end.
The tRNA must contain the sequence UUU.
Protein synthesis
Q52. Which of the following is not true of tRNA
molecules?





The 3'-terminal sequence is —CCA.
Their anticodons are complementary to the
triplet codon in the mRNA.
They contain more than four different bases.
They contain several short regions of double
helix.
With the right enzyme, any given tRNA
molecule will accept any of the 20 amino acids.
Protein synthesis
Q53. In the “activation” of an amino acid for protein
synthesis:





leucine can be attached to tRNAPhe, by the aminoacyltRNA synthetase specific for leucine.
methionine is first formylated, then attached to a specific
tRNA.
the amino acid is attached to the 5' end of the tRNA
through a phosphodiester bond.
there is at least one specific activating enzyme and one
specific tRNA for each amino acid.
two separate enzymes are required, one to form the
aminoacyl adenylate, the other to attach the amino acid
to the tRNA.
Protein synthesis
Q54. Formation of the ribosomal initiation
complex for bacterial protein
synthesis does not require:





EF-Tu.
formylmethionyl tRNAfMet.
GTP.
initiation factor 2 (IF-2).
mRNA.
Protein synthesis
Q55. In bacteria the elongation stage of
protein synthesis does not involve:





aminoacyl-tRNAs.
EF-Tu.
GTP.
IF-2.
peptidyl transferase.
Protein targeting and degradation
Q56. Which of the following is true about the sorting pathway for
proteins destined for incorporation into lysosomes or the
plasma membrane of eukaryotic cells?





Binding of SRP to the signal peptide and the ribosome
temporarily accelerates protein synthesis.
The newly synthesized polypeptides include a signal peptide at
their carboxyl termini.
The signal peptide is cleaved off inside the mitochondria by
signal peptidase.
The signal recognition particle (SRP) binds to the signal peptide
soon after it appears outside the ribosome.
The signal sequence is added to the polypeptide in a
posttranslational modification reaction.
Protein synthesis
Q57. Indicate whether the following statements are true
(T) or false (F).

___A ribosome is the complex within which protein
synthesis occurs.

___Ribosomes contain many separate proteins.

___The three ribosomal RNAs in a bacterial
ribosome are distributed in three separate, large
ribosomal subunits.

___There are four binding sites for aminoacyltRNAs on a ribosome.
Protein synthesis

The process of charging tRNAs with
their cognate amino acids involves
multiple proofreading steps to
increase the overall fidelity. Briefly
describe these steps.
Protein synthesis

The recognition of an amino acid by
its cognate aminoacyl-tRNA
synthetase is said to involve a
“second genetic code”. What is
meant by this?
Protein synthesis

In 1961, Howard Dintzis carried out an
experiment that defined the direction of
polypeptide chain growth during protein
synthesis in cells. The experiment involved
the analysis of hemoglobin molecules that
were being synthesized in reticulocytes in
the presence of radioactive amino acids.
Describe the analysis and how it
demonstrated the direction of chain growth.
Protein synthesis

A given mRNA sequence might be
translated in any of three reading
frames. Describe how prokaryotes
and eukaryotes determine the correct
reading frame.