* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Chapter 5
Holliday junction wikipedia , lookup
Gel electrophoresis wikipedia , lookup
DNA barcoding wikipedia , lookup
Gene expression wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
Transcriptional regulation wikipedia , lookup
DNA sequencing wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Maurice Wilkins wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Agarose gel electrophoresis wikipedia , lookup
Molecular evolution wikipedia , lookup
Point mutation wikipedia , lookup
Genomic library wikipedia , lookup
Transformation (genetics) wikipedia , lookup
DNA vaccination wikipedia , lookup
SNP genotyping wikipedia , lookup
Real-time polymerase chain reaction wikipedia , lookup
Non-coding DNA wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Molecular cloning wikipedia , lookup
DNA supercoil wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Community fingerprinting wikipedia , lookup
1 BIOCHEMISTRY 461 Dr. Bourque Chapter 5 Study Questions Key Fall 2010 Page 1 [10 pts] Restriction enzymes recognize DNA sequences that have 2-fold symmetry. The following DNA contains at least 5 restriction enzyme recognition sites. Find and draw a box around 5 possible recognition sequences that are either 4 or 6 base pairs in length. ATTGGATCCTTGGCCATCTAGAGCAGAATTCCGCGC TAACCTAGGAACCGGTAGATCTCGTCTTAAGGCGCG [12 pts] Shown are the DNA sequences recognized by the enzymes Bam HI, Hha III, and Hae I. Enzymes and cleavage sites: Bam HI 5'-G↓GATCC-3' 3'-CCTAG↑G-5' Hha I Hae III 5'-GCG↓C-3' 5'-GG↓CC-3' 3'-C↑GCG-5' 3'-CC↑GG-5' Indicate the fragments obtained from the given DNA sequence after cleavage with these enzymes. [Arrows or boxes work well to mark the sequences to indicate the cuts and fragments obtained by each enzyme] a) Bam HI fragments [2 pts] 5'-GAATTCCCGGCGCTTTG GATCCATGGCCATGGCCATT-3' 3'-CTTAAGGGCCGCGAAACCTAG GTACCGGTACCGGTAA-5' b) Hha I fragments [2 pts] 5'-GAATTCCCGGCG CTTTGGATCCATGGCCATGGCCATT-3' 3'-CTTAAGGGCC GCGAAACCTAGGTACCGGTACCGGTAA-5' c) Hae III fragments [4 pts] 5'-GAATTCCCGGCGCTTTGGATCCATGG 3'-CTTAAGGGCCGCGAAACCTAGGTACC CCATGG GGTACC CCATT-3' GGTAA-5' DNA fragments can be visualized in polyacrylamide gel electrophoresis by staining with ethidium bromide , which binds to double-stranded DNA and fluoresces an intense orange when irradiated by UV light. Restriction endonucleases cleave DNA at sites with inverted repeat sequences referred to as palendromic sequences. The biological role of restriction enzymes in bacteria is to A) repair DNA. D) All of the above. B) induce DNA crossover. E) None of the above. C) cleave foreign DNA. Which of the following DNA sequences contains an 8 base palindromic site? (Note: Only one strand is shown.) A) CAGTCC D) GAGAGAGA B) GCATCC E) GCATATGC C) CGATTAGC The first three bases of the 6-base recognition cleavage site of HindIII are AAG. What is the complete sequence of this 6 bp site? A) AAGAAG D) AAGCUU B) AAGCTT E) None of the above. C) AAGGAA Design a potential DNA-restriction enzyme site. Show both strands. Answer: Any palindromic site of four or more base pairs would be appropriate. How can DNA fragments of various sizes be separated? Answer: Electrophoresis is used to separate DNA. Fragments migrate according to size, with larger fragments migrating more slowly than smaller fragments. Agarose gels are used for larger fragments. Polyacrylamide is used for shorter fragments, and can resolve fragments differing by as little as one base. Several techniques for visualization can be used, including ethidium bromide staining, or autoradiography. What is a DNA probe and how is it used to identify a specific DNA restriction fragment? Answer: A DNA probe is used to identify specific DNA fragments. The probe sequence is complementary to the DNA sequence of interest, thus it can base pair, or hybridize, with the DNA strand. Probes can be small oligomers or long fragments. They are labeled for detection using radioactivity or another tag, such as fluorescent probes. 2 BIOCHEMISTRY 461 Dr. Bourque Chapter 5 Study Questions Key Fall 2009 [8 pts] Name 4 necessary and different features which make DNA sequencing possible by the chain termination of DNA synthesis method. Answer: two points each for any four of the following - Controlled random chain terminations for each base - one reaction for each base - dideoxyribonucleotides - DNA polymerase - gel electrophoresis which can resolve DNA fragments differing by one base - ability to label so that products of reaction are detectable - equimolar mixture of reaction products - other unique answers may also qualify for credit [2 pts] Show the expected full-length sequence of the growing DNA primer in this template-primer complex: (template) 3' - (base paired)-GGTCAATGACAC -5' (primer) 5' - 32P-(base paired)-CCAGTTACTGTGOH - 3' [8 pts] The above primer is extended by synthesis in DNA sequencing reactions in a typical chain termination sequencing experiment. The following illustration shows a DNA gel electrophoresis pattern of DNA fragments from which the 12-base sequence of the extended primer can be deduced. Label each lane correctly with the name of the dideoxynucleotide base (A,T,G, or C) that must be used to produce this data. [2 pts each for naming the lanes correctly] (Name the base for each gel lane below) _T_ _G_ _C_ _A_ (Larger) (Smaller) [2 points] Starting with 1 copy of a double-stranded DNA, how many copies of that DNA will there 3 be after 4 repetitive cycles of PCR (polymerase chain reaction) 16 copies [1 point] Current DNA sequencing methods use fluorescence labeling of dNTPs to permit automated detection of chain termination synthesis reaction products for all four DNA bases. [1 point] What absolutely necessary component of a chain termination DNA sequencing reaction mixture is missing from the following list: Primer dNTPs template DNA a dideoxy-NTP DNA polymerase a “label” to detect the reaction products [1 point] Chemical synthesis of small DNA molecules proceeds from the 3' [10 pts] to the 5' end. This question refers to the roles of the following enzymes/chemicals in construction of a cDNA library. Write the number of the description on the right hand column in the blank space to which it refers in the left hand column. __3___ DNA ligase (1) synthesizes the first strand of cDNA as a complement to the mRNA template (2) hydrolyzes the mRNA after synthesis of the first cDNA strand (3) links the cDNA to the vector DNA (4) Synthesizes the second strand of the cDNA (5) primes first cDNA strand synthesis __5___ oligo dT __2___ NaOH ___1__ Reverse transcriptase ___4__ DNA polymerase [1 pt each ] ANSWER TRUE OR FALSE F If a gene is inserted into a tetracycline antibiotic resistance gene in a plasmid, host cells containing the resulting recombinant DNA plasmid will grow in the presence of tetracycline. T An elephant hemoglobin cDNA can be expressed as a translatable mRNA in E.coli cells. Fill in the Blank Questions [12 pts - 1 pt for each answer] The enzyme that catalyzes the formation of a phosphodiester linkage at a break in a DNA strand is DNA ligase . Restriction endonucleases cleave DNA at sites with inverted repeat sequences referred to as palindromic sequences. 4 Complementary, single-strand overhangs that are produced by some restriction endonucleases are referred to as sticky ends or cohesive ends . The Sanger technique for sequencing DNA involves the use of 2',3'-dideoxy that terminate chain elongation. nucleotide analogs In solid-phase synthesis of oligonucleotides, the 2'deoxyribonucleotide-3'-phosphoramidite is added to the _5’_ end of the growing oligonucleotide. PCR is the abbreviation for Polymerase Chain Reaction which is an in-vitro DNA replication technique used to make multiple copies of a DNA molecule. Bacterial plasmid DNA and bacteriophage DNA are commonly used ___vectors___________ to introduce foreign DNA into a bacterium. The enzyme terminal transferase can be used to add nucleotides to the 3' end of DNA. Complimentary DNA (cDNA) is formed by the action of reverse transcriptase on __mRNA__. DNA fragments can be visualized in polyacrylamide gel electrophoresis by staining with ethidium bromide which binds to double-stranded DNA by intercalation (insertion) between base pairs and which fluoresces an intense orange color when irradiated by UV light. Multiple Choice Questions [2 pts each] 1. The biological role of restriction enzymes in bacteria is to A) repair DNA. D) All of the above. B) induce DNA crossover. E) None of the above. C) cleave foreign DNA. Ans: C 2. What do Southern, Northern, and Western blots detect, respectively? A) DNA, RNA, and protein D) protein, DNA, and RNA B) DNA, protein, and RNA E) RNA, protein, and DNA C) RNA, DNA, and protein Ans: A 3. Reagents necessary for sequencing by chain termination include A) template DNA, deoxyribonucleoside triphosphates (dNTPs), primer, dideoxy nucleotide analogs, DNA polymerase, and radioactive probe. B) template DNA, deoxyribonucleoside triphosphates (dNTPs), primer, dideoxy nucleotide analogs, and DNA polymerase. C) template DNA, deoxyribonucleoside triphosphates (dNTPs), primer, dideoxy nucleotide analogs, RNA polymerase. D) All of the above. E) None of the above Ans: B 5 4. Plasmids used in recombinant DNA technology typically A) possess a gene for antibiotic resistance. B) replicate independently of the host genome. C) are circular double stranded molecules. D) all of the above. E) a and b. Ans: D 5. A polylinker site contains A) many closely spaced restriction enzyme sites. B) links for antibiotic resistance. C) sequences allowing linkage to mRNA. D) All of the above. E) None of the above. Ans: A 6. Why are met and trp often used to design DNA probes from amino acid sequences? A) They have ony one possible codon sequence each.. B) Met is the first amino acid in the protein chain. C) Both are used often in proteins. D) All of the above. E) None of the above. Ans: A 7. For identification of a gene, to which strand of DNA must the probe be complementary? A) either strand D) only the template strand B) both strands E) None of the above. C) only the coding strand Ans: A 8. Reverse transcriptase is normally found in A) plants. D) All of the above. B) retrovirus. E) None of the above. C) mitochondria. Ans: B 9. The probe used to isolate a gene from a genomic library is often A) the ligand that binds to the protein. D) All of the above. B) its promoter region. E) None of the above. C) cDNA constructed from an mRNA of the gene. Ans: C 10. Genes can be inserted into eukaryotic cells by A) viruses. D) All of the above. B) chemical treatment. E) None of the above. C) microinjection. Ans: D 6 11. Animals that harbor a foreign gene as a result of recombinant gene manipulation are called A) transgenic. D) All of the above. B) mutants. E) None of the above. C) aliens. Ans: A Short-Answer Questions 1. A number of tools are critical to gene exploration. Name at least four. Answer: Tools include restriction enzyme analysis, blotting techniques (Southern and Northern), DNA sequencing, solid-phase synthesis of nucleic acid, PCR, computer analysis, other answers may be correct. 2. How can DNA fragments of various sizes be separated? Answer: Electrophoresis is used to separate DNA. Fragments migrate according to size, with larger fragments migrating more slowly than smaller fragments. Agarose gels are used for larger fragments. Polyacrylamide is used for shorter fragments, and can resolve fragments differing by as little as one base. Several techniques for visualization can be used, including ethidium bromide staining, or autoradiography. 3. What is a DNA probe? Answer: A DNA probe is used to identify specific DNA fragments. The probe sequence is complementary to the DNA sequence of interest, thus it can base pair, or hybridize, with the DNA strand. Probes can be small oligomers or long fragments. They are labeled for detection using radioactivity or another tag, such as fluorescent probes. 4. What are some important aspects that are the basis of the Sanger DNA sequencing method? Answer: Sanger sequencing is based upon replication of DNA under conditions in which the chain is terminated by controlled interruption, resulting in various sizes of DNA fragments. By including limited amounts of radioactive bases, strands differing by one base in length can be observed. By reading the bands, the sequence can be determined. (Fluorescent or dye tags can also be used in an automated process.) 5. Explain the basis of the polymerase chain reaction. Answer: Using primers that flank the sequence of interest and carrying out repetitive replication reactions can make copies of a particular DNA fragment. Template DNA, DNA polymerase, dNTPs, and other necessary reagents are added to the reaction mixture. The DNA is heated to separate the strands, cooled to allow the primers to anneal, and then replicated. The process is repeated many times, each time doubling the number of DNA copies present. The enzyme used is thermostable, and can withstand the repetitive heating and cooling steps. 7 6. Describe two ways PCR can be used in medical diagnosis. Answer: PCR can be used to identify the presence of infecting bacteria or viruses; can detect if certain mutations, such as those found in cancer cells, are present; and can be used as a diagnostic tool to investigate known gene mutations. [etc...] 7. Briefly outline the steps necessary to create a recombinant DNA molecule. Answer: Both the fragment of interest and the vector DNA are cut with restriction enzyme(s), which create complementary sticky ends. The pieces of DNA are allowed to anneal and DNA ligase is added to join the ends. 8. How is a single gene of interest identified on a plate containing many different gene library clones? Answer: By using a probe specific for the DNA of interest, the clone can be identified. The probe is designed to hybridize to the DNA of the clone that has been transferred to a membrane. The probe is labeled with radioactivity or another tag so that it can be easily detected and the proper clone identified and selected from the original plate. 10. A gene is inserted into an ampicillin resistance gene in a plasmid. Will cells containing the resulting recombinant plasmid be sensitive or resistant to ampicillin? Answer: When inserted into a gene, the new DNA interrupts the previous gene. Thus, the antibiotic gene is unlikely to be functional, the clone will be sensitive to the antibiotic (, and the clone will not grow. 11. Briefly outline how a cDNA library is made. Answer: Reverse transcriptase is used to convert mRNA molecules into DNA, and the RNA is then digested away by alkali. Terminal transferase is used to add several residues to the end of the fragment, such as G. Then, a complementary primer, such as polyC, can be used to synthesize the opposite strand. Linkers can be added so the fragment can be inserted into a vector, and then into a host, such as bacteria. 12. Why are foreign genes often inserted with a different promoter, such as using the metallothionein gene promoter 5' to a growth hormone gene? Answer: Promoters are selected that are easy to control, and can be turned on or off as desired. Thus, metallothionein, which is induced by the presence of heavy metals, can be mediated by altering metals concentrations. 13. How is gene disruption used to determine the function of a gene? Answer: If a gene is completely disrupted (also called gene knockout), a functioning protein is not made. By examining the knockout organism, clues to the protein's function can be made by observation and testing. 8 14. How is a gene gun used? Answer: DNA is coated onto tungsten pellets, and the microprojectiles are shot into the tissue at very high velocity. 15. What advantage can be gained by splicing together portions of two different genes? Answer: This technique allows the creation of novel bifunctional genes. Distinct functional domains are paired and aligned into one gene, often resulting in proteins with unique characteristics and activities. 9