* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Unit 7 packet pt 5
Eukaryotic transcription wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
DNA repair protein XRCC4 wikipedia , lookup
Restriction enzyme wikipedia , lookup
Agarose gel electrophoresis wikipedia , lookup
DNA profiling wikipedia , lookup
Genetic engineering wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Epitranscriptome wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Genomic library wikipedia , lookup
Transcriptional regulation wikipedia , lookup
SNP genotyping wikipedia , lookup
Biochemistry wikipedia , lookup
Real-time polymerase chain reaction wikipedia , lookup
Gene expression wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Genetic code wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Community fingerprinting wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Molecular cloning wikipedia , lookup
Non-coding DNA wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Point mutation wikipedia , lookup
DNA supercoil wikipedia , lookup
Biosynthesis wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Name: ProteinSynthesisFairyTale Date: Period: FairyTale: "Onceuponatimethereweretwofraternaltwinbrothers:DonaldN.ArmstrongandRonaldN Armstrong.Donaldwasthesmarterofthetwo,andhewasasuccessfulinventorwithmanypa AlthoughRonaldwasnotassmartashisbrother,hewasextremelyloyal.OnedayDonaldcam withanideaforasolarpoweredcar.Giventheever-presentpossibilityofenergyshortage,an efficientsolarpoweredcarwouldbeingreatdemand.However,Donaldreallydidn'twanttol hiscomfortableestate.Hecertainlycouldn'ttakeachancebyusinge-mailorafaxtosendhis thefactory.Theymightbestolenbyindustrialspies!Donaldknowshisloyalbrotherwoulddo anythingforhim,soheaskshimtobeamessengerandcarrytheplanstothefactory.Atthefa theassemblylineissetupandfactoryworkersbringthepartstoassembletheprototype.The provestobeenormouslysuccessful.TheArmstrongbrothersbuyanevenbiggerestateandliv happilyeverafter!" 1.InproteinsynthesiswhatwouldDonaldrepresent? 2.WhatwouldRonaldrepresent? 3.Whatdoestheestaterepresent? 4.Whatdotheplansrepresent? 5.Whatdoesthefactoryrepresent? 6.Whatdothefactoryworkersrepresent? 7.Whatdoesthecarrepresent? 27 DNAStrucure,History,andReplicationReviewGuide 1.Whatisanucleotide?Whatarethe3parts? 2.Givethe4nucleotidesfoundinDNA.Indicatetheirfamilyandthestructureofeachfamily. 3.HowisDNAlikeatwistedladder?Whatmakesupthesides?Therungs?Whatholdsthe2sides together? 4.StateChargaff’sbasepairrules.WhatisthecomplimentarystrandtothefollowingDNAsegment: AAATTCCGGAGCTTAACGGTA? 5.WhenisDNAreplicated?WhyisDNAreplicationimportant? 6.Givethe2typesofenzymesinvolvedinDNAreplicationandtheirfunctions. 7.Summarizetheexperiments/findingsofthefollowingscientists(fromyournotesandyour reading): • JamesWatson • FrancisCrick • EdwinChargaff • RosalindFranklin 28 RNA,TranscriptionandTranslationReview 1.WhatistheprocessbywhichthegeneticcodeofDNAiscopiedintoastrandofRNA? 2.Whatisacodonandwhatisitspurpose?Whatdoesitcodefor? 3.WhataresomesimilaritiesanddifferencesbetweenRNAandDNA? 4.WhatistheprocessofdecodingmRNAintoapolypeptidechain?Inotherwords,howdoesagene becomeprotein? 5.Whatisananticodonandwhatisitspurpose? 6.Whatarethestepsoftranscription? 7.Wheredoestranscriptiontakeplace?Wheredoestranslationtakeplace? 8.Whatarethestepsoftranslation? 9.Whatarethe3typesofRNAandwhataretheirfunctions? 10.Duringtranscriptionwhatisformed?Duringtranslationwhatisformed? 11.Howmanycodonsspecify1aminoacid? 12.WhatbaseismissingonRNA,&whatotherbasereplacesit? 13.UracilwillpairwithwhatotherbaseonDNA? 14.IsRNAdoubleorsinglestranded? 29 15.WhichtypeofRNAcopiesDNA’sinstructionsinthenucleus? 16.WhatdoestRNAtransport? 17.Inwhatpartofacellareproteinsmade? 18.WhatisRNApolymerase&tellitsfunction. 19.ArebothstrandsofDNAcopiedduringtranscription? 20.AsRNApolymerasemovesalongtheDNAtemplatestrand,whatisbeingadded? 21.WhathappenstothenewlymademRNAmoleculefollowingtranscriptioninthenucleus? 22.Howmanydifferentkindsofaminoacidsmakeupproteins? 23.Nametheaminoacidcodedforbyeachofthesecodons: a.UUA b.AUU c.UGU d.AAA e.GAG f.UAA 24.Whatcodonstartsproteinsynthesis?Whataminoaciddoesthestartcodonalwayscarry? 25.Whatcodonsstopproteinsynthesis? 26.WhatcodononmRNAwouldbindwiththeseanticodons: a.AAA b.GGA c.UAC d.CGU 27.Whattypeofbondsaretheonesthatattachaminoacidstoeachotherinagrowingpolypeptide? 30 Name:__________________ Period:______Date:________ Protein Synthesis Lab 1. Onepersoninyourgroupshouldgotothe‘nucleus’tableoftheclassroomandtranscribe oneoftheDNAsegmentsintomessengerRNA(mRNA). 2. ThemRNAmessagewillbebroughtbacktothe‘ribosome’tablewhereyourpartneris sitting. TheotherpartnerinyourgroupwillthenturnthemRNAmessageintothe complementaryanticodonseriesoftransferRNA(tRNA) 3. OncethetRNAsequencehasbeendeterminedyouwillneedtofindoutwhichaminoacid goeswitheachanit-codon.YouwillneedtodecodethemRNAcodonsusingthedecoder tabletofindoutwhichaminoacidgoeswiththecomplementarytRNAanti-codon. 4. WhenyouhavefoundwhichaminoacidgoeswiththetRNAmoleculeyouwillgototheamino acidtableandflipthataminoacidcardandfindawordontheback.Writethatword inthe appropriatesentenceblankoftheDNAsegmentyoupickedinthenucleus. 5. ContinuetranslatingthemRNAmessageuntilyouhavecompletedthesentence. 6. RepeatwithotherDNAsegmentsuntilyoufinishallyourassignedsegments. (Youshould onlydoonesentenceatatimeoryouwillgetallsortsofmessedup.) AminoAcidbasedecodertable–usewithmRNAcodons!(nottRNAcodons) 31 AnalysisQuestions: 1. Whydidyouhavetostayinthe‘nucleus’towritedownthemRNA? 2. Whichpartofthisactivityrepresentstranscription? 3. Whichpartofthisactivityrepresentstranslation? 4. Whathappensintheribosomesduringproteinsynthesis? 5. Whatdoesthefinalsentencerepresentintermsofproteinsynthesis? 6. Whatdoeseachwordrepresentintermsofproteinsynthesis? 7. AllDNAsequencesstartedwithTACandendedwithATC,ATT,orACT.Why? 8. HowmanymutatedDNAsegmentsdidyouhave?WhatcouldamutatedDNAsegmentcause? 32 DNA, RNA, and Snorks Name: ____________________________ Introduction: In this simulation, you will examine the DNA sequence of a fictitious organism - the Snork. Snorks were discovered on the planet Dee Enae in a distant solar system. Snorks only have one chromosome with eight genes on it. Your job is to analyze the genes of its DNA and determine what traits the organism has and then sketch the organism (You can be creative here). For simplicity, the gene sequences are much smaller than -real- gene sequences found in living organisms. Each gene has two versions that result in a different trait being expressed in the snork. DNA samples were taken from volunteer snorks. The DNA was then transcribed to its complimentary RNA strand, and you have been given a copy. Your job is to analyze the RNA sample and determine the phenotype (how the organism looks) based on the sequence. Use your RNA codon wheel to determine the amino acids. Remember that AUG is a start codon, and it signifies the beginning of each gene. UAA is a stop codon and signifies the end of a gene. Genes Amino Acid Sequence Description Gene 1 - body covering a.) val - ser - leu hairless b.) val - ser - lys hairy a.) tyr - pro - glu - glu - lys plump b.) val - pro - thr - glu - lys skinny a.) leu - leu - leu - pro 3 legged b.) leu - leu - ser - ala 2 legged a.) ala - val - val round head b.) val - ala - ala square head a.) his - ile tail b.) his - his no tail a.) ser - pro - val blue pigment (hair/skin) b.) val - phe - tyr red pigment (hair/skin) a.) asp - ile - leu - leu - pro - thre small slanted eyes b.) asp - ile - pro - pro - pro - thre large round eyes a.) val - asp - asp - ala circular mouth b.) asp - asp - asp - ala rectangular mouth a.) phe - ser - gly pointed standing-up ears b.) phe - phe - gly rounded floppy ears a.) arg - tyr - cys - lys long spaghetti like arms b.) arg - arg - asp - thre short stumpy arms Gene 2 - body style Gene 3 - legs Gene 4 - head shape Gene 5 - tails Gene 6 - body pigment Gene 7 - eyes Gene 8 - mouth Gene 9 - ears Gene 10 - arms Draw your snork on the back of this page. Be sure to include the type of snork you selected. 33 Type of Snork: _______________________________________ 34 Why? DNA Structure and Replication How is genetic information stored and copied? Ladder Model of DNA Helix Model of DNA 1 Deoxyribonucleic acid or DNA is the molecule of heredity. It contains the genetic blueprint for life. For organisms to grow and repair damaged cells, each cell must be capable of accurately copying itself. So how does the structure of DNA allow it to copy itself so accurately? Nitrogencontaining base Model 1 – The Structure of DNA Phosphate Nucleotide Deoxyribose sugar Adenine Nitrogen Bases Thymine Guanine Cytosine a. What are the three parts of a nucleotide? 1. Refer to the diagram in Model 1. b. What kind of sugar is found in a nucleotide? c. Which nucleotide component contains nitrogen? d. Name the four nitrogen bases shown in Model 1. a. Circle a single nucleotide on each side of the ladder model of DNA. 2. DNA is often drawn in a “ladder model.” Locate this drawing in Model 1. DNA Structure and Replication b. What part(s) of the nucleotides make up the rungs of the “ladder”? c. What parts of the nucleotides make up the sides (backbone) of the “ladder”? d. Look at the bottom and top of the “ladder” in Model 1. Are the rungs parallel (the ends of the strands match) or antiparallel (the ends of the strands are opposites)? 3. On the ladder model of DNA label each of the bases with the letter A, T, C or G. 4. Refer to Model 1. When one nucleotide contains adenine, what type of base is the adenine attached to on the opposite nucleotide strand? 5. The two strands of DNA are held together with hydrogen bonds between the nitrogen bases. These are weak bonds between polar molecules. How many hydrogen bonds connect the two bases from Question 4? 6. Refer to Model 1. When one nucleotide contains cytosine, what type of base is the cytosine attached to on the opposite nucleotide strand? 7. How many hydrogen bonds connect the two bases from Question 6? 8. With your group, use a complete sentence to write a rule for how the bases are arranged in the ladder model of DNA. Read This! T C C A G POGIL™ Activities for High School Biology 10. The ladder model of DNA is a simplified representation of the actual structure and shape of a DNA molecule. In reality, the strands of DNA form a double helix. Refer to the double helix diagram in Model 1 and describe its shape using a complete sentence. A 9. Fill in the complementary bases on the strand below according to the base-pair rule. Erwin Chargaff (1905–2002), an Austrian-American biochemist, investigated the ratio of nucleotide bases found in the DNA from a variety of organisms. From his research, as well as research by Rosalind Franklin and Maurice Wilkins, Watson and Crick developed the complementary base-pair rule during their race to discover the structure of DNA. The complementary base-pair rule states that adenine and thymine form pairs across two strands, and guanine and cytosine form pairs across two strands. 2 35 Model 2 – DNA Replication Direction of DNA helicase DNA helicase ______ Hydrogen bonds between nucleotides form. Free Nucleotides 3 11. Examine Model 2. Number the steps below in order to describe the replication of DNA in a cell. ______ Hydrogen bonds between nucleotides break. ______ Strands of DNA separate. ______ Free nucleotides are attracted to exposed bases on the loose strands of DNA. a. What type of biological molecule is DNA helicase? 12. Locate the DNA helicase on Model 2. b. What is the role of DNA helicase in the replication of DNA? 13. What rule is used to join the free nucleotides to the exposed bases of the DNA? 14. This type of replication is called semi-conservative replication. Considering the meaning of these words (semi—half; conserve—to keep), explain why DNA replication is called semi-conservative. DNA Structure and Replication 4 15. DNA molecules can be tens of thousands of base pairs in length. Mistakes in DNA replication lead to mutations, which may or may not be harmful to an organism. How does semi-conservative replication help prevent mutations during DNA replication? 31 27 28 31 Adenine 21 19 Cytosine Percentage of each type of base Guanine 22 19 29 Thymine 16. The proportions of the bases are consistent within a species; however they do vary between species. Using the base-pair rules, complete the following table to show the percentage of each type of base in the five different organisms. Organism Human Cow Wheat Salmon Yeast POGIL™ Activities for High School Biology 36 Name: ___________________________________________ Period: _______ DNA Model Activity D = deoxyribo N = nucleic A = acid DNA contains the information for carrying out all of the activities of a cell. How this information is coded or passed from cell to cell was at one time unknown. To break the code, you will do a paper lab to determine the structure of DNA and show how the genetic code is carried. You and each member of your class will color molecules called nucleotides. DNA is made up of repeating units of nucleotides. Directions • Color the nucleotides using the legend. • Label the nucleotides (sugar, phosphate, or A, G, T, C base). 1. Look at the nucleotides. What are the three common parts of a nucleotide? 1. 2. 3. 2. What is one part of a nucleotide that differs among the four different nucleotides? 3. List the four different types of nitrogen bases. 1. 2. 3. 4. Cut out the nucleotides. Manipulate the nucleotide pieces until you find the best fit. Join the nucleotide molecules in your group like a puzzle. Use tape to connect and reinforce the molecules. You now have a molecule of DNA. 4. In the space below, explain where the nucleotide molecules connect to each other. 5. A real DNA molecule consists of thousands of these pairs of nucleotides. What is the pairing arrangement of the nitrogen bases? 37 __________ pairs with __________ and __________ pairs with __________ 6. Are there always going to be an equal number of adenine and thymine in a molecule? Why? 7. Are there always going to be an equal number of guanine and cytosine molecules in a molecule of DNA? Why? 8. Scientists abbreviate the nitrogen bases by using the first letter of each base, so: A always binds to _____ C always binds to _____ The structure of DNA is actually in a double helix arrangement. Double helix means that the two long chains of nucleotides are arranged in a spiral-like twisted ladder. 9. The sides of the ladder are made up of alternating __________________ and __________________ molecules. The steps of the ladder are made up of __________________ held together by ______________ bonds. Bring your molecule to the front of the room and join it to the molecules of your classmates. We now have one large DNA molecule! 38