* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download BamHI - Courses
Oncogenomics wikipedia , lookup
DNA methylation wikipedia , lookup
DNA paternity testing wikipedia , lookup
DNA barcoding wikipedia , lookup
DNA sequencing wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Metagenomics wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Point mutation wikipedia , lookup
Genome evolution wikipedia , lookup
Genetic engineering wikipedia , lookup
Designer baby wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
Human genome wikipedia , lookup
DNA profiling wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Primary transcript wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Microevolution wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
SNP genotyping wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
DNA vaccination wikipedia , lookup
Microsatellite wikipedia , lookup
DNA polymerase wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Genomic library wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Molecular cloning wikipedia , lookup
Epigenomics wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Non-coding DNA wikipedia , lookup
DNA supercoil wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Genome editing wikipedia , lookup
Helitron (biology) wikipedia , lookup
BME 130 – Genomes Lecture 2 Mapping Genomes Genomics in the news An Aboriginal Australian Genome Reveals Separate Human Dispersals into Asia Morten Rasmussen1,2,*, Xiaosen Guo2,3,*, Yong Wang4,*, Kirk E. Lohmueller4,*, …Eske Willerslev1,2,† DOI: 10.1126/science.1211177 Studying DNA The toolkit DNA polymerases – synthesize DNA, usually from a template Nucleases – break DNA polymers by cleaving the phosphodiester bond Ligases – join DNA molecules together End-modifying enzymes – add labels and make compatible ends for further manipulation http://www.neb.com/nebecomm/products/categories.asp DNA polymerases Synthesize 5’ to 3’ (require free 3’ –OH) Some have exonuclease activity (as shown) Reverse transcriptase (from retro-virus) is a useful RNA-dependent DNA polymerase Nucleases Many kinds, but we mainly care about Type II DNA restriction endonucleases 5’ATGACGTAGGATCCCATTGCAG3’ 3’TACTGCATCCTAGGGTAACGTC5’ BamHI 5’ATGACGTAG3’ 5’GATCCCATTGCAG3’ 3’TACTGCATCCTAG5’ 3’GGTAACGTC5’ Restriction sites are often palindromes and restriction enzymes are often dimers. Coincidence? EcoRI DNA ligases End-modification enzymes Terminal deoxynucleotidyl transferase adds bases to end of DNA polymer Alkaline phosphatase removes phosphates from the 5’ ends of a DNA polymer T4 polynucleotide kinase adds phosphates to the 5’ ends of a DNA polymer Cloning vectors Name Maximum Insert size (kb) Plasmid ~5 Fosmid ~40 BAC ~200 Polymerase Chain Reaction Administrivia Website: http://courses.soe.ucsc.edu/courses/bme130/Fall11/01 Assign groups PubMed – your tax dollars at work: http://www.ncbi.nlm.nih.gov/pubmed Mapping genomes Repeat content of human RepeatMasker (rmsk) Summary Statistics item count 5,298,130 item bases 1,465,724,774 (50.59%) item total 1,467,396,988 (50.65%) smallest item 6 average item 277 biggest item smallest score 160,602 21 average score 1,417 biggest score 75,230 A map is useful for assembly, no matter how it’s done Restriction fragment length polymorphisms http://www.dna.gov/dna-databases/codis Single nucleotide polymorphisms dbSNP growth Currently (dbSNPv131): 32,017,159 human SNPs in dbSNP! Various ways to type SNPs (genotype) Genes as markers Remember Mendel? Establishing order of genes known to be linked – a genetic map No test crosses in humans, but… Generating a restriction map FISH map (Fluorescence in situ hybridization)