Download Analysis and nucleotide sequence of an origin of DNA replication in

Gene, 87 (1990) 45-51
Elsevier
45
GENE 03399
Analysis and nucleotide sequence of an origin of DNA replication in Acinetobacter calcoaceticus and its
use for Escherichia coli shuttle plasmids
(Recombinant DNA; palindrome; ~-galactosidase; shuttle vector; gene bank; trpE)
Michael Hunger, Robert Sehmueker, VeerabrahmaKishan and Wolfgang Hillen
Lehrstuhlfiir Milcrobiologie. Institutflir Milo'obiologie und Biochemie der Friedrich-Alexander Universit~t Erlangen-Narnberg. Staudtstr. 5.8520
Erlangen (F.R. G.)
Received by T.A. Bickle: 4 September 1989
Revised: 23 September 1989
Accepted: 25 September 1989
SUMMARY
A shuttle plasmid for Acinetobacter calcoaceticus and Escher/chia coli has been constructed from a cryptic A. calcoaceticus
Iwoffl plasmid and pBR322. It is transformed to A. calcoaceticus BD413 by natural competency, yielding about 106 transformants per/~g of plasmid DNA. The Apa and Tca genes of pBR322 are functional in A. calcoaceticus. A gene bank was
constructed from chromosomal A. calcoaceticus DNA and the shuttle plasmid. Direct transformation to A. calcoaceticus
yielded about 95% recombinants, indicating a sixfold enrichment of recombinant plasmids compared to E. coll. One clone
complementing a trpE mutation carried a 20-kb insertion and transformed with a 30-fold higher efficiency when compared
to the vector. A deletion analysis of the shuttle plasmid indicates that 2.2 kb is necessary for autonomous replication and
stable maintenance in A. calcoaceticus. No rearrangements of the DNA or loss of plasmids are found in that organism, even
in the absence of selective pressure, when this sequence is present. A further insertionai inactivation analysis creating lacZ
transcriptional fusions suggests that the origin of replication (or/) is contained within about 1350 bp. Analysis of ~-galactosidase production in A. calcoaceticus indicates that only a weak promoter activity is directed out of one end of this or/. Its
sequence contains A + T-rich regions, an 18-bp element with nearly perfect palindromic symmetry and eleven repeats of the
consensus sequence, AAAAAATAT, eight of which are clustered within 360 bp. However, no open reading frames or
significant homologies to other ori were found.
INTRODUCTION
Members of the genus Acinetobacter are widely distributed, versatile bacteria with the ability to degrade many
organic carbon sources (Juni, 1978). A number of genes
Correspondence to: Dr. W. Hillen, Lehrstuhl flir Mikrobiologie,
Staudtstrasse 5, D8520 Erlangen (F.R.G.) Tel. (913 I) 858081;
Fax (9131)858082.
Abbreviations: A., Acinetobacter; Ap, ampicillin; pGal, ~.galactosidase;
bp, base pair(s): cfu, colony forming units; kb, kilobase(s) or 1000 bp;
Kin, kanamycin; LB, Luria-Bertani broth; nt, nucleotide(s); ORF, open
reading flame; ori, origin(s) of DNA replication; R, resistance; Tc, tetracycline; wt, wild type.
03"/8-1119/90/$03.50© 1990ElsevierScience PublishersB.V.(BiomedicalDivision)
from Acinetobacter species have been recently cloned and
characterized mainly by mating procedures (Goosen et al.,
1987; Cleton-Jansen et al., 1988). This involves primary
cloning in a suitable host strain followed by mobilization of
the recombinant plasmids.
In this article we describe the isolation of a plasmid from
A. calcoaceticus Iwoffi and the construction of shuttle vectors by fusions with pBR322. The resulting shuttle plasmids
were stable, small and could be used for direct cloning of
gene banks from A. calcoaceticus in that organism. This
resulted in enrichment of recombinant plasmids and preference of large insertions, which facilitates cloning experiments considerably in comparison to mating procedures.
Furthermore, no cloning in intermediate hosts with poten-
46
tial instability ofgenes is necessary and the shuttle plasmids
can be prepared from E. coil in high yields. The sequence
required for stable maintenance in A. calcoaceticus is
defined by deletion and insertion analyses, its promoters
determined by the expression of i a c Z fusions in
A. calcoaceticus and the nt sequence of the replicon is
presented.
MATERIALS AND METHODS
Restriction endonucleases were purchased from
Boehringer, Mannheim. Bethesda Research Laboratories,
Eggenstein and N.E. Biolabs, Schwalbach. T4 DNA ligase
and calf intestine phosphatase were from Boehringer,
Mannheim. All reactions and polyacrylamide and agarose
gel electrophoresis were done as described previously
(Hillen et al., 1982). Plasmid DNA from E. coli and
A. calcoaceticus grown in LB broth (Table I) was isolated
on a small scale by the method of Birnboim and Doly (1979)
and in large amounts as described (Hillen et al., 1981) and
purified by CsCI density-gradient centrifugation.
RESULTS AND DISCUSSION
(a) Construction of a shuttle plasmid for Acinetobacter
calcoaceticus and Escherichia coli
A cryptic plasmid, pWH 1277, about 4.5 kb, was isolated
from A. calcoaceticus lwoffi, linearized with P m l l and
ligated with Pmll-cleaved pBR322. The ligation products
were transformed to E. coil R R I and the resulting plasmid
was called p W H 1266. The physical structure of p W H 1266
is shown in Fig. 1. As derived from a restriction analysis the
entire sequence of the cryptic A . calcoaceticus plasmid is
present in p W H 1266. Purified D N A prepared from E. coil
was used to transform A. calcoaceticus BD413. Transformants were selected on LB plates containing Ap or Tc
indicating that both pBR322-derived resistance genes are
expressed and functional in A . calcoaceticus. Plasmid
TABLE I
Bacterial strains and plasmids
Strain
Genetic features
Reference or source
--
Juni (1972)
Juni (1972)
Legler (1970)
A. calcoaceticus a
BD4 (DSM586)
BD413 (DSM588)
Iwo~ (DSM30013)
trpE
--
£. coil b
RRI
Plasmlds
pBR322
pWH 1266
pWHI267
pWH1268
pWH1269
pWH 1270
pWHI271
pWHI272
pWHI273
pWHI274
pWH 1281-1295
pWH 1296
pWHI297
F - , hsdS 20, (r~ mg ) reed +, ara.14, proA 2, lacY l , gaIK2, rpsL20 (Sma), xyl. 5,
mtl.I, supE44
Apa, Tca
Apa, Tca
Apa
Apa, Tca
ApR, Toa
Apa, TcR
Apn, Tca
Apa, Tca
Apa, Tca
Apa,Tcn
Apa, TcR, Kina
TcR
ApR, TcR
Fusion of pBR322 and pWHI277 at/hull
Deletion of the BamHI.BgllI fragment from pWHI266
Deletion of the NdeI fragment from pWH1266
Hincll.BgllI A from pWH1277 in/~ull of pBR322
Hincll-Bglll B from pWHI277 in/h,ulI of pBR322
AccI C from pWHI277 in Pvull of pBR322
Accl A from pWHI277 in Pmll of pBR322
Accl B from pWHI277 in Pmll of pBR322
Substitution of NdeI B of pWH 1273 by Ndel B of pWHI270
Insertion and replacement derivatives of pWHI266 creating lacZ fusions
EcoRl deletion of pWHI281
Insertion element deleted from pWHI289
Bolivar et al. (1977)
Bolivar et al. (1977)
This work, Fig. 1
This work, Fig. 2
This work, Fig. 2
This work, Fig. 2
This work, Fig. 2
This work, Fig. 2
This work, Fig. 2
This work, Fig. 2
This work, Fig. 2
This work, Fig. 3
This work, Fig. 3
This work, Fig. 3
a A. calcoaceticusBD4 was used as a donor of chromosomal DNA with the wt t~'p£ gen# (Juni, 1972).A. cal¢oaceticus BD413 carries the trp£ marker
and exhibits natural competency0uni, 1972).It was used as a recipient for cloningexperiments in A¢inetobacter.A. cal¢oaceticuslwojO/iturned out to contain
a cryptic plasmid which was used to construct the shuttle vector. A. calcoaceticu~strains were grown in Erlenmeyer flasks at 30°C on a New Brunswick
Gyrotory Shaker (350 rpm) in LB (I0 mg peptone/5 rag yeast extract/10 mg NaCI, all per ml, pH 7A). Ap (I00/~8/ml) and Tc (I0/Ag/ml) were added
for selection. Transformants of A. oakoaceticus complemented by the gene bank were selected on minimal medium containing: 15 mg agar/6 mg
Na2HPO4.2H20/3 mg KH2PO41~).9mg NaCI/I mg NH4CI/0.25 mg MgSO4.7 H20/2 mg glucose/100 #g Ap, all per ml. DSM, Deutsche Sammlungder
Mikroorganismen.
b E. coli RRI was generally used for transformations as described (Cohen et al., 1972).
47
Barn HI
Pvu II
(
Nd.l~
Pvull ~
~ Pvull
Pvull
0
BamHI
"°°'l
I
A©cl
B9111 Ndel~[
4 Hin©ll
Acc I
Fig. 1. Construction of the shuttle plasmid pWH1266 for "E. coil and
A. calcoaceticus. The cryptic A. calcoaceticus-derived plasmid, pWH 1277,
is shown with some relevant restriction sites, and pBR322 is displayed
with the relevant genetic markers. The pWH 1266 shuttle vector resulted
from fusion of both plasmids at their PvulI sites. The pWH 1277-derived
portion is indicated by the heavy line. Only restriction sites relevant for
experiments presented in this article are shown.
pBR322, however, does not replicate in A. cakoaceticus.
Plasmid DNA from twelve independent candidates was
purified and digested with PvuII (data not shown). All of
them turned out to be identical to the E. coli-derived
pWHI266. The same result was obtained when plasmids
from E. coil transformed with A. calcoaceticus-derived
pWH1266 were analyzed. These results indicate that the
shuttle plasmid pWH 1266 is able to transform both strains
without undergoing frequent rearrangements. Further
restriction mapping of pWH 1266 revealed the locations of
cleavage sites indicated in Fig. 1. No cleavage sites were
found for Xhol, KpnI, XbaI, and Sacl. In addition,
pWH 1277 contains no recognition sites for BamHI, EcoRl,
EcoRV, HindIll, PstI, ClaI, SalI, AatI, Smal, NruI, Nael,
StuI, Hpall, HaeII, HaelIl and Thai.
(b) Optimization of the transformation rates of Acinetobaeter calcoaeeticus for the shuttle plasmid
A fresh overnight culture ofA. calcoaceticus BD413 was
diluted 1000-fold in 20 ml LB and shaken at 30°C. Several
times 0.2 ml of the culture were transformed with 500 ng
pWH1266 and transformants were scored on LB plates
containing 100/~gAp/ml. Competency is observed from the
early log phase to the stationary phase. A maximum of
competency is found in the late log phase of growth with
about 6 × l0 s transformants per 500 ng of plasmid DNA.
This procedure is slightly different from the reported
protocol (Singer et al., 1985). 500ng of plasmid DNA
proved to be saturating under these conditions, pWHI266
prepared from E. coil and A. calcoaceticus showed the same
transformation efficiency.This indicates that no restriction
barrier exists in A. calcoaceticus BD413 for E. coli-derived
DNA. The yields of plasmid preparations from E. coli (up
to 1/tg/ml) indicated that pWH 1266 has a high copy number, while it appears to be a low copy number plasmid in
A. calcoaceticus (yielding about 10 ng/ml).
(c) Molecular cloning of the trpE gene from Acinetobacter
calcoaceticus
Total DNA from A. calcoaceticus BD4 was prepared,
1/tg partially cleaved with Sau3A and ligated with 20 ng
BamHI-finearized pWHI266. The figation products were
transformed into E. coil and A. calcoaceticus BD413 .,rpE,
and scored for Tc sensitivity. In E. coli about 16% and in
A. calcoaceticus about 95~o of the transformants were
Tc-sensitive. It is concluded that A. caicoaceticus shows a
sixfold preference for these recombinant plasmids. The
experiment yielded 2 x l0 4 primary transformants in
A. calcoaceticus BD413 as determined on LB plates
containing Ap. The bulk of transformed cells were selected
on minimal medium plates with Ap, resulting in 20 colonies.
Restreaking on minimal plates with Ap yielded 16 candidates. From these the plasmid DNA was prepared from
3 ml overnight cultures and retransformed to A. calcoaceticus BD413 trpE. The transformants were plated on
LB-Ap plates and minimal medium Ap plates. Four plasmids yielded roughly the same number of transformants on
both plates indicating that the trpE complementation was
physically linked to Ap resistance. The sizes of the insertions varied between 10 and 30 kb. Restriction mapping
indicated that the vector portion did not undergo any
noticeable rearrangement during the cloning experiments.
One candidate, pWHI275, contained a 20-kb insertion.
The transformation efficiency of pWH1275 in A. calcoaceticus was compared to that ofpWH 1266 and turned out
to be 30-fold higher (data not presented). This result,
together with the high insertion rate and the large insertion
sizes, indicates that recombinant plasmids are enriched by
transforming the ligation mixtures directly to A. calcoaceticus. It is not clear at present whether this is related to
the chromosomal DNA from A. calcoaceticus in the recombinant plasmids or may just reflect a preference for large
plasmid sizes. However, this property is of considerable
advantage for direct cloning experiments.
(d) Identification of the region necessary for stable, autonomous replication in ,4cinetobacter calcoaceticus
A deletion analysis of the DNA from A. calcoaceficus in
pWH 1266 was done to defme sequences necessary for stable replication and maintenance. This was carried out either
by deleting parts ofpWH 1266 or by subcloning DNA fragments in pBR322. The restriction sites relevant for these
approaches are indicated in Fig. 1 and the physical structures of the derived plasmids are described in Fig. 2. The
plasmids pWH 1267through pWH 1274were initially cloned
in E. coil, prepared and characterized by restriction mapping. They were then used to determine their efficiency to
transform A. calcoacetlcus BD413 and quantitate their stability. The results of these experiments are presented in
Table II.
Only one deletion plasmid, pWHI274, shows the same
transformation efficiency as pWH1266. This plasmid
contains the 2.2-kb Accl-HinclI fragment from the cryptic
plasmid inserted into the PmlI site ofpBR322. The size of
pWH 1274 is about 6.5 kb, smaller than most of the broadhost-range plasmids. No transformants were found for
pWHI267 containing a BamHI-BglIl deletion (from
pWH 1266) and for pWH 1268 containing the deletion of the
small Ndel fragment (from pWH 1266) (see Figs. 1 and 2).
pWHI269 through pWHI273 yielded between 100 and
1000 transformants. These transformants, however, grew
only to small colonies in comparison to those carrying
pWHI266 or pWHI274. It is not obvious why these constructions gave rise to transformants while pWH 1268 carrying nearly the same A. calcoacetlcus DNA as pWH 1272
TABLE 11
Transformation efficiencies and stability of the derivatives of plasmid
pWHI266
Plasmida
pWHI266
pWH1267
pWHI268
pWHI269
pWHI270
pWHI271
pWHI272
pWHI273
pWHI274
pWHI296
pWHI297
Transformation
efficiency
(T/500 ng) b
Growth':
No
6×10 s
0
0
5 × 102
8 × 10'
7 × 102 "
1 x 10s
6 × 102
4 × l0 s
6 × l0 s
6×10 s
1×106
--No growth
No growth
No growth
No growth
3 × l0 s
1 × 106
1 × 106
1× 106
StabilityC
NA/No
(¢ru/ml)
1.1 +0.11
-----5 × 10 -s + 1.5 x 10 - s
1.0 :t: 0.12
0.32 + 0.14 °
1.0 +0.5
a See Figs. 1 and 2. For pWH1296 and pWH1297 see RESULTS AND
DISCUSSION, section d.
b The transformation efficiency is expressed as the number of transformants (T) obtained with 0.5/~g plasmid DNA per 2 x 108 cells of
A. calcoaceticus BD413. A freshly prepared overnight culture of
A. calcoaceticus was diluted 1000-fold in 20 ml LB and grown to an Asso
of 3.0. 0.2 ml of the culture was removed, the appropriate amount of
plasmid DNA was added, the culture was shaken at 30°C at 350 rpm for
1 h and plated out on LB-Ap plates.
c To determine the stability of plasmids, the respective A. calcoaceticus
strains were grown overnight in LB with 100/~g Ap/ml or 10 ~g Tc/ml,
diluted 1000-fold in LB without an antibiotic and grown into the stationary phase. This was reached after roughly ten generations. The cultures were then titrated on LB plates (No) and LB plates with Ap (or Tc
in the case ofpWHl296) (NA). The stability of the plasmid is defined by
the ratio NA/No.
a The NA/No ratio after growth under selective pressure was 0.38 ± 0.14;
thus no increased loss of plasmids occurs without selection.
eoo~
piasmlds
Pvull
Hlncll Accl Nd
Accl Ac
ull
pWH 1266
pWH 1267
pWH 1268
pWH 1269
pWH 1270
pWH 1271
pWH 1272
pWH 1273
pWH 1274
Fig.2. Physical maps of deletion derivatives from pWHI266. The
A. calcoaceticus.derived portion of pWH1266 (see Fig. !) with some
restriction sites is displayed on the top. The pBR322 derived sequences
of the deleted plasmids are omitted, pWH1269, 1270, 1273 and 1274
contain the pBR322 portion in opposite orientation as compared to the
other plasmids. The map is drawn to scale.
did not. However, since the small colonies were not viable
this effect was not studied further (see Table If). We concluded that the AccI-Hincll DNA fragment present in
pWH1274 encodes the ability to efficiently transform
A. calcoaceticus because deletions affecting this fragment
resulted in plasmid instability.
While the transformation efficiency was scored on
LB-Ap plates, the stability of the plasmids was determined
as described in the footnote to Table II. The transformants
containing pWH 1269 through pWH 1272 failed to grow in
overnight cultures in the presence of Ap while the transformant with pWH1273 grew only to a reduced density of
2.5 x l0 s cells per mi. This result indicates that the AccI
fragment present in pWH 1273 leads to a greater stability in
comparison to the other DNA segments. However, strains
transformed with either pWH1266 or pWHI274 grew in
overnight cultures to a higher density of about 1 x 109 cells
per ml. This result is confirmed by growing the respective
strains under non-selective conditions and scoring the pres-
49
ence of the Ap R phenotype afterwards. The results are also
given in Table II. While both pWH 1266 and pWH 1274 are
not segregated in the absence of selective pressure,
pWH1273 is only maintained in about one in 105 cells after
that growth period. This result confnmed that the 2.2-kb
AccI-Hincll D N A is important and sufficient for stable
replication in A. calcoaceticus, while plasmids with the
neighboring 1.3-kb AccI D N A (see Figs. I and 2) can replicate, but segregate rapidly without selection. This indicates
that the 0.7-kb Accl-HinclI D N A (see Fig. 1) contains an
important feature for maintenance.
Further characterization of the region necessary for
maintenance in A. calcoaceticus was done by an insertion
analysis using a lacZ indicator gene as shown in Fig. 3. It
was designed to (i) identify positions where insertion of a
D N A fragment interferes with replication and (ii) determine
the transcriptional activity at the insertion sites.
The replacement derivatives pWH 1293, pWH 1294, and
pWHI295 showed a loss of transformation ability to
Pvul~.~Accl Accl
Bglll
~f t
Accl
t
Hinc II
f
,2m~7
~
Pvull
~s,las,les,.m,eo t
f f
lae2~7
1290H
,'co[
,.4[
]
-
,.,[
---"
]
-
]
Fig. 3. Map ofthe insertion and substitution mutants ofpWHI26G.The
black bar represents the 1337-bp replicon region, the nt sequence of
which is shown in Fig, 4. Upward arrows indicate Sau3A sites. The order
was not established for Sau3A fragments designated in two regions
between arrows by their size in bp. The $au3A sites on the fight side are
in the pBR322 vector portion, pWHI266 was partially digested with
$au3A, ligated with the BamHl cleaved insertion sequence and transformed to E. coil RRI. Triangles indicate insertion sites of the BamHl
insertion element and brackets the deleted Sau3A fragments.The insertion element is a 4.7-kb DNA containing a promoterless lacZ reading
frame followedby the fd terminator and a KmRgene flanked by BamHI,
Sail and Pstl sites (Kokotek and Lotz, 1989). The arrows within the
triangles and brackets mark the direction of lacZ transcription. The
double arrows in pWH1289 indicates a double insertion of the lacZ
fragment. The numbers at the triangles and brackets are the respective
pWH plasmid designations. The resulting plasmids were prepared and
transformed to A. calcoaceticusBD413. Compared with pWHI266 all of
these plasmids yielded at least 100-fold fewer transformants (data not
shown). This result is not due to modifications of the on"sequence, as is
most clearly demonstrated by pWHI288 having the insertion in the
pBR322 portion. Furthermore, pWHI289, pWHI281 and pWHI291
were used to construct pWHI297, pWHI298 and pWHI299, respectively, by Pstl deletion of the insertion sequence. In all three cases this
resulted in the same transformation efficiencies as found for pWHI266.
This result indicates that the insertion sequence itselfis indeed responsible for the 100-foldreduced transformation efficiency.
A. calcoaceticus, indicating that the minimal repficon was
affected in these plasmids.
Taken together these results locate the ori for A. calcoaceticus in pWHI266 to about 1350 bp from the insertion
in pWHI281/1283 to that in pWHI282/1284. This conclusion was confirmed by stability tests of pWHI297
(pWHI289 after deletion of the insertion sequence) and
pWHI296 (EcoRl deletion of pWHI281 removing nearly
the entire insertion sequence and the pBR322 b/a region to
the E c o R l site). Strains with either plasmid were grown for
8 h without selection and the plasmids turned out to be
stable with no detectable loss within this time period (see
Table II). Thus, the 1350-bp segment marked in Fig. 3
contains all the sequences required for replication and
maintenance in A. calcoaceticus.
(e) Transcriptional activity of pWH1266 in Acinetobacter
calcoaceticus and E . coU
The expression of pGal from the lacZ gene in the insertion sequence was measured to determine promoter activity
in pWH 1266. The pGal activities are given in Table III. A
strong promoter directs transcription into the lacZ gene in
pWHI285. Since this part of the DNA is not required for
replication, this activity serves as a positive control, indicating that A. calcoaceticus promoters can be detected by
this method. It is interesting to note that this strong promoter is also active in E. coil RRI iacZAMI5, suggesting
that this A. calcoaceticus promoter may be also functional
in E. coll. This promoter activity is terminated in pWH 1287,
indicating the presence of a transcriptional terminator
between these insertions. The results obtained with
pWHI281 and pWHI282 show that no strong promoter
TABLE III
pGal activities in A. calcoacet/cusand £. coli
Plasmidsa
pGal activityu
A. calcoaceticus
E. coli
(BD413)
pWHI281
pWHI282
pWH1285
pWH!287
pWHI290
pWHI291
pWH1293
pWHI294
pWHI295
45 + 28
!.6 + 0.3
11890 +476
8 + !
1.7 + 0.4
100 + 61
n.d.
n.d.
14876 + 1018
n.d.
n.d.
n.d.
15 +
16 +
830 +
!.2
1.4
25
See Fig. 3.
b pGai activity is given in units as defined by Miller (1972).
A. calcoaceticusBD413without a plasmid gave 2.9 :!:0.4 units, n.d. ffi not
determined; -- = no transformunts in A. calcoaceticus.
a
50
GATCGTAGAAATATCTATGATTATCTTGAAGAACGCAACCCTATAGCAGCTATTGAAATTGATGATTTAATTGAAGAAAAGACAGATTTA 9O
GTTGTTGATAATI;GACTGATGGGGCGCACAGGCAGACAGAAAGATACTAGGGAGTTAGTGATACATCCGCATTATGTGGTTGTATATGAC 180
ATCACTGATATAATACGGATACTCAGAGTGCTACACACATCGCAGGAGTGGTCATGACTTACTCATGTACTTTGGATTATTTAGTGTTAT 270
AAAAT¢I;:TGATTTATAAAiTTTTTTTTGTTA.a_a_a_a_a.GATAAm'~TT~TTG
G G ~ A C C GTAATTTATGGGGTACAGAT 360
CTTCGATACTGACATATCGGCAATCGAAAGCATTAAGGTTTGACGACCGCTAATGATTTCACCACAGGGGCTTAATGTACCTGTCTTA.qA 45O
ACTCAATCTGT£CATGTGTGGGTGATGAGG 54O
TTCTAAGGTTTTAACTCGCTTTGTCAAGCA
TAGACCCCAAAAATTTAGCCAATGTCTGTA
GGACGCAATGAGTAGTCATTTAATTGGCGG 630
TACAGTGACGCTAGCACACATCGGAAAAACGCTATTACTAGGGGAACTGAACAGAGTAGC
TGATGTCATCCCTGATGCGAAAGCGACCGA 720
TTATGAGCGTGTTCAGGCGG
TGCTAT£AATCGTAATCATAACAGTGGCAGCTTGATACAG
TCCCTCCCTC 810
CCGACGGTACATCGAATGGGAATACTTTAG
GGTGATI'TTTAAGAATCGCT
CTAGGGTGAGTATTTCCCATTCAGCTCTGC
ATTAAACAAT 9OO
TGGTACTTTAATCAAAAGCACTACTA.qACATATGTTTTTAAAT[~AT
ATTGATATAGAGATAATATTAGTAAGAATA
A 990
TGAATATAGATAAATCATTGTTAAATAAAGATTAATTATTAAAATGAATGTATACTTATATATAAATCAATGATFIFAAAATATTTGATA
1080
AGAAAACTTTTCAAA&~ATATAATTGAGATTGTGTCATTTCGGTCAATTCTTAATATGTTCCACGCAAGTTTTAGCTATGGTGCTAAA
CAGAAATTTGCTGAAAAAGAACTTTTCACTGAACTGGTTAAAATGTAAGCAGCCTGAGAGCCGCCAJ~TlrTTAAAAACA.qACCGCCTT1170
)260
AATCATCTTCAAAAAATACC
TCTAAAACCTCACCATTTGCGTTTTAAGACCCATATTTCATCCTGCCCTTATGTTCCCATGCTGATAGCT
GCAAAATGTTAAAATCC
1337
ATA.qAGTGTCTGTAATCGCTTCCTATGACGTTCTAGGCTGTTGATAACTTTTGGAACAAC
Fig. 4. Nucleotide sequence of the or/region of pWHI266. The 1337-bp fragment is sufficient for replication and stable maintenance of plasmids in
A. calcoaceticus.It correspondsto the one indicated by the black bar in Fig. 3; the Sau3A site immediatelyfollowingthe 3'-end is not shown.The A + T-rich
regions are underlined,a palindromicelementis indicated by the heavyconvergentarrows and elevenrepeats with at least 7 nt ofthe consensus sequence
AAAAAATATare printed in bold letters. The Bglll site is at nt 357 and the Accl site at nt 950. Sequencingwas cloneby the dideoxy-chain-termination
method (Sanger et al., 1977)on both strands.
transcribes out of the sequence required for replication;
however, pWH 1281 shows a weak activity which is clearly
above background. In pWHI290 this activity is reduced to
background levels. The significance of this promoter activity
for replication is not clear. We conclude that fusions with
a promoterless lacZ gene can detect promoter activity in
A. calcoaceticus; however, a promoter activity likely to be
associated with the replication sequence was not found.
Bramhill and Kornberg, 1988; and references cited there).
This notion is supported by the reduced stability of
pWH 1273 (see Fig. 2 and Table II) which lacks D N A from
the Accl site at nt 950 in Fig. 4 including four of the nine
AAAAAATAT repeats.
(f) Specificity of the replicons on plasmid pWHI266
In plasmid pWH 1296, the ColE 1 on' was deleted without
decreasing the number of transformants obtained in
A. calcoaceticus (Table If). This indicates that the Cole I or/
had no activity in A. calcoaceticus which is confirmed by the
observation that pBR322 yields no transformants in
A. calcoaceticus. Attempts to transform pWHI296 into
E. coil RRI yielded no transformants. Therefore, it was
concluded that the replicon of the cryptic plasmid
pWH1277 showed no activity in E. coll.
We thank Mrs. B. Weins for helpful discussions, M. Will
and I. Schiessl for excellent technical assistance and Mrs.
R. Oster for typing the manuscript. This work was supported by the Fonds der chemischen Industrie. V.K. was
supported by a DAAD fellowship.
(g) Nucleotide sequence of the ori active in Acinetobacter
caleoaceticus
The nt sequence of the 1.35-kb fragment is shown in
Fig. 4. No ORFs were detected within the segment necessary for stable maintenance in A. calcoaceticus. This indicates that the ori region in plasmid pWH 1277 is not dependent on a plasmid specific replication protein as found for
most replicons (Gallic and Kado, 1988). However, other
features of a plasmid replicon were found in the sequence.
Two A+T-rich regions (88%) were observed at nt
256-312 and 835-1017. Eleven repeats defmed by at least
? nt out of the 9-bp consensus sequence AAAAAATAT are
found. Eight ofthese are clustered between nt 835 and 1189
of the sequence shown in Fig. 4. A palindromic sequence at
nt 310-337 was also found. Repeat sequences were postulated to be essential for many replicons (Novick, 1987;
ACKNOWLEDGEMENTS
REFERENCES
Birnboim, H.C. and Doly, J.: A rapid alkaline extraction procedure for
screening recombinant plasmid DNA. Nucleic Acids Res. 7 (1979)
1513-1523.
Bolivar, F., Rodriguez, R.L., Greene, P.J., Betlach, M.C., Heyneker,
H.L., Boyer, H.W., Crosa, J.H. and Falkow, S.: Construction and
characterization of new cloning vehicles, II. A multipurpose cloning
system. Gene 2 (1977) 95-113.
Bramhill, D. and Kornberg, A.: A model for initiation at origins of DNA
replication. Cell 54 (1988) 915-918.
Cleton-Jansen, A.-M., Goosan, N., Wenzel, T.J. and Van de Putte, P.:
Cloning of the gene encoding quinoprotein glucose dehydrogenase
fromAcinetobactercalcoaceticus:evidencefor the presenceof a second
enzyme. J. Bacteriol. 170 (1988) 2121-2125.
Cohen, S.N., Chang, A,C.Y. and Hsu, L.: Nonchromosomal antibiotic
resistance in bacteria: genetic transformation of Escherlchla coli by
R-factor DNA. Proc. Natl. Acad. Sci. USA 69 0972) 2110-2114.
Gallic, D.R. and Kado, CJ.. Minimal region necessary for autonomous
replication of pTAR. J. Bacteriol. 170 0988) 3170-3176.
Goosen, N., Vermans,D.A.M. and Van de Putte, P.: Cloningofthe genes
involved in synthesis of enzyme pyrrolo-quinollne-quinon from
Acinetobacter calcoaceticus. J. Bacteriol. 169 (1987) 303-307.
Hillen, W., Klein, R.D. and Wells, R.D.: Preparation of milligram
51
amounts of 21 deoxyribonucleic acid restriction fragments. Biochemistry 20 (1981) 3748-3756.
Hillen, W., Klock, G., KalTenberger, J., Wray Jr., L.V. and Reznikoff,
W.S.: Purification of the Tet repressor and tet operator from the
transposon TnlO and characterization of their interaction. J. Biol.
Chem. 257 (1982) 6605-6613.
Juni, E.: Interspecies transformation of Acinetobacter: genetic evidence
for a ubiquitous genus. J. Baeteriol. 112 (1972) 917-931.
Juni, E.: Genetics and physiology ofAcinetobacter. Annu. Rev. Microbiol.
32 (1978) 349-371.
Kokotek, W. and Lotz, W.: Construction ofa lacZ-kanamycin-resistance
cassette, useful for site-directed mutagenesis and as a promoter
probe. Gene 84 (1989) 467--471.
Legler, F.: (.~er das Vorkommen, die Pathogenitit und die AntibiotikaEmpflndlichkeit des Ac.~omobacaer mucosus. Zbl. Bakt., !. Abt. Orig.
215 (1970) 466-474.
Miller, J.H.: Experiments in Molecular Genetics, Cold Spring Harbor
Laboratory, Cold Spring Harbor, NY, 1972, pp. 352-355.
Novik, R.P.: Piasmid incompatibility. Microbiol. Rev. 51 (1987) 381-395.
Sanger, F., Nieklen, S. and Coulson, A.R.: DNA sequencing with chain
terminating inhibitors. Proc. Natl. Acad. Sci. USA 74 (1977)
5463-5467.
Singer, J.T., Van Tuiji, JJ. and Finnerty, W.R.: Transformation and
mobilization of cloning vectors in Acre"eto/mcter ca/coacetfcus spp. J.
Bacteriol. 165 (1985) 301-305.
本文献由“学霸图书馆-文献云下载”收集自网络，仅供学习交流使用。
学霸图书馆（www.xuebalib.com）是一个“整合众多图书馆数据库资源，
提供一站式文献检索和下载服务”的24 小时在线不限IP 图书馆。
图书馆致力于便利、促进学习与科研，提供最强文献下载服务。
图书馆导航：
图书馆首页
文献云下载
图书馆入口
外文数据库大全
疑难文献辅助工具