Download Protein Synthesis Review Concepts • Protein synthesis occurs in two

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project

Document related concepts

RNA world wikipedia , lookup

Nutriepigenomics wikipedia , lookup

DNA polymerase wikipedia , lookup

Polyadenylation wikipedia , lookup

Nucleosome wikipedia , lookup

Bisulfite sequencing wikipedia , lookup

United Kingdom National DNA Database wikipedia , lookup

Gel electrophoresis of nucleic acids wikipedia , lookup

Transfer RNA wikipedia , lookup

RNA silencing wikipedia , lookup

Genealogical DNA test wikipedia , lookup

Replisome wikipedia , lookup

Molecular cloning wikipedia , lookup

Oncogenomics wikipedia , lookup

Genomics wikipedia , lookup

DNA damage theory of aging wikipedia , lookup

Nucleic acid tertiary structure wikipedia , lookup

Cancer epigenetics wikipedia , lookup

DNA vaccination wikipedia , lookup

No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup

Cre-Lox recombination wikipedia , lookup

Epigenomics wikipedia , lookup

Extrachromosomal DNA wikipedia , lookup

History of genetic engineering wikipedia , lookup

Nucleic acid double helix wikipedia , lookup

RNA wikipedia , lookup

DNA supercoil wikipedia , lookup

Vectors in gene therapy wikipedia , lookup

Messenger RNA wikipedia , lookup

Gene wikipedia , lookup

Cell-free fetal DNA wikipedia , lookup

Microevolution wikipedia , lookup

History of RNA biology wikipedia , lookup

RNA-Seq wikipedia , lookup

Mutagen wikipedia , lookup

Non-coding DNA wikipedia , lookup

Mutation wikipedia , lookup

Expanded genetic code wikipedia , lookup

Helitron (biology) wikipedia , lookup

Non-coding RNA wikipedia , lookup

Frameshift mutation wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Epitranscriptome wikipedia , lookup

Nucleic acid analogue wikipedia , lookup

Therapeutic gene modulation wikipedia , lookup

Deoxyribozyme wikipedia , lookup

Genetic code wikipedia , lookup

Primary transcript wikipedia , lookup

Point mutation wikipedia , lookup

Transcript
Protein Synthesis Review
Concepts
• Protein synthesis occurs in two stages: transcription and translation
• Transcription is the process in which information is copied from DNA to RNA
• Translation is the process in which information from RNA codes for amino acids
• Cells with the same DNA can specialize by expressing only part of the DNA sequence
• The interaction of DNA and regulatory proteins, such as repressors, controls gene expression.
Vocabulary – define 10 of the following words (know all of them)
amino acid
anticodon
codon
DNA
mRNA
mutation
nucleus
point mutation
ribosome
RNA polymerase
start codon
stop codon
translation
tRNA
cancer
frame-shift mutation
nucleotide
promoter
rRNA
transcription
Diagrams
1. Draw and label a diagram of transcription showing DNA, mRNA and RNA polymerase.
2. Draw and label a diagram of translation showing a ribosome, mRNA, tRNA, and a polypeptide
chain with at least 3 amino acids joined by peptide bonds.
Questions
1. How are DNA and RNA different?
2. How does your genotype determine your phenotype (include DNA, RNA & protein)?
3. Use the following DNA sequence to go through the steps of finding the amino acid sequence
(show all your work and look for a start codon): GACTACAAATTTCCCGGGATCGAC
4. How are codons and anticodons related?
5. What is the significance of the order of amino acids in a protein?
6. If all of your cells have the same DNA, how come they are different?
7. How do mutations cause problems for an organism?
8. What are some things that can cause mutations (mutagens)?
9. Why are mutations, or mistakes in DNA, worse than mistakes in RNA or a protein?
10. How are gene mutations different from chromosomal mutations?
11. How can oncogenes cause cancer?