* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Protein Synthesis Review Concepts • Protein synthesis occurs in two
Nutriepigenomics wikipedia , lookup
DNA polymerase wikipedia , lookup
Polyadenylation wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Transfer RNA wikipedia , lookup
RNA silencing wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Molecular cloning wikipedia , lookup
Oncogenomics wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Nucleic acid tertiary structure wikipedia , lookup
Cancer epigenetics wikipedia , lookup
DNA vaccination wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Epigenomics wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
History of genetic engineering wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
DNA supercoil wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Messenger RNA wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Microevolution wikipedia , lookup
History of RNA biology wikipedia , lookup
Non-coding DNA wikipedia , lookup
Expanded genetic code wikipedia , lookup
Helitron (biology) wikipedia , lookup
Non-coding RNA wikipedia , lookup
Frameshift mutation wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Epitranscriptome wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Genetic code wikipedia , lookup
Protein Synthesis Review Concepts • Protein synthesis occurs in two stages: transcription and translation • Transcription is the process in which information is copied from DNA to RNA • Translation is the process in which information from RNA codes for amino acids • Cells with the same DNA can specialize by expressing only part of the DNA sequence • The interaction of DNA and regulatory proteins, such as repressors, controls gene expression. Vocabulary – define 10 of the following words (know all of them) amino acid anticodon codon DNA mRNA mutation nucleus point mutation ribosome RNA polymerase start codon stop codon translation tRNA cancer frame-shift mutation nucleotide promoter rRNA transcription Diagrams 1. Draw and label a diagram of transcription showing DNA, mRNA and RNA polymerase. 2. Draw and label a diagram of translation showing a ribosome, mRNA, tRNA, and a polypeptide chain with at least 3 amino acids joined by peptide bonds. Questions 1. How are DNA and RNA different? 2. How does your genotype determine your phenotype (include DNA, RNA & protein)? 3. Use the following DNA sequence to go through the steps of finding the amino acid sequence (show all your work and look for a start codon): GACTACAAATTTCCCGGGATCGAC 4. How are codons and anticodons related? 5. What is the significance of the order of amino acids in a protein? 6. If all of your cells have the same DNA, how come they are different? 7. How do mutations cause problems for an organism? 8. What are some things that can cause mutations (mutagens)? 9. Why are mutations, or mistakes in DNA, worse than mistakes in RNA or a protein? 10. How are gene mutations different from chromosomal mutations? 11. How can oncogenes cause cancer?