Download PDF - Blood Journal

RED CELLS
Functional and comparative analysis of globin loci in pufferfish and humans
Nynke Gillemans, Tara McMorrow, Rita Tewari, Albert W. K. Wai, Carola Burgtorf, Dubravka Drabek, Nicki Ventress, An Langeveld,
Douglas Higgs, Kian Tan-Un, Frank Grosveld, and Sjaak Philipsen
To further our understanding of the regulation of vertebrate globin loci, we have
isolated cosmids containing ␣- and
␤-globin genes from the pufferfish Fugu
rubripes. By DNA fluorescence in situ
hybridization (FISH) analysis, we show
that Fugu contains 2 distinct hemoglobin
loci situated on separate chromosomes.
One locus contains only ␣-globin genes
(␣-locus), whereas the other also contains a ␤-globin gene (␣␤-locus). This is
the first poikilothermic species analyzed
in which the physical linkage of the ␣- and
␤-globin genes has been uncoupled, supporting a model in which the separation
of the ␣- and ␤-globin loci has occurred
through duplication of a locus containing
both types of genes. Surveys for transcription factor binding sites and DNaseI
hypersensitive site mapping of the Fugu
␣␤-locus suggest that a strong distal
locus control region regulating the activity of the globin genes, as found in mammalian ␤-globin clusters, may not be
present in the Fugu ␣␤-locus. Searching
the human and mouse genome databases
with the genes surrounding the pufferfish
hemoglobin loci reveals that homologues
of some of these genes are proximal to
cytoglobin, a recently described novel member of the globin family. This provides evidence that duplication of the globin loci
has occurred several times during evolution, resulting in the 5 human globin loci
known to date, each encoding proteins
with specific functions in specific cell
types. (Blood. 2003;101:2842-2849)
© 2003 by The American Society of Hematology
Introduction
The large amount of intergenic sequences makes genome analysis a
difficult task in most higher vertebrates. Current research has
indicated the pufferfish (Fugu rubripes and the closely related
Spheroides nephelus) as an ideal species for just this task because it
has a relatively compact genome of 400 Mb, approximately 7.5
times smaller than the human genome.1,2 Nevertheless, the Fugu
genome contains a complement of genes similar to that found in
humans.3-5 As a consequence, genes occur approximately once
every 8 kb in the Fugu genome. Thus, it provides a suitable model
for the comparison with gene loci from higher vertebrates. In our
laboratory, we study the regulation of the human ␤-globin gene
cluster. This locus is found on the short arm of chromosome 11 and
contains 5 genes that are arranged in the same order in which they
are expressed during development: 5⬘-⑀ (embryonic) G␥-A␥ (fetal)
␦-␤ (adult)–3⬘. The ␣-globin genes are in a separate locus on the
short arm of chromosome 16, close to the telomeric end. Two
␣-like and 2 ␤-like polypeptides together form the tetrameric
oxygen-carrying hemoglobin molecule. In poikilothermic jawed
vertebrates (fish, amphibians, and reptiles), the ␣- and ␤-globin
genes are found closely linked in the same locus. It is thought that a
common ancestral globin gene gave rise to distinct ␣- and ␤-globin
genes through gene duplication events, followed by the separation
of the ␣- and ␤-genes to different chromosomes as they are found
in today’s homoiothermic vertebrates (birds and mammals).6 In
humans, the genes are in very different chromosomal environments. The ␣-globin genes are located in a gene-rich telomeric
region of chromosome 16 with a constitutively open chromatin
structure in all cell types. The genes have methylation-free CpG
islands, and the major regulatory element (␣-MRE) is a single
erythroid-specific DNaseI hypersensitive site located in the intron
of a ubiquitously expressed gene, some 40 kb telomeric to the
␣-genes.7 The ␤-globin cluster is AT-rich, has no CpG islands, and
adopts an open chromatin structure in erythroid cells only.8 The
major regulatory element called the locus control region (LCR) is
located approximately 20 kb upstream of the structural genes and
contains 5 erythroid-specific DNaseI hypersensitive sites.9 Thus,
there are considerable differences in the regulatory mechanisms of
these 2 loci. It is therefore interesting to determine the structure of
the globin loci in more primitive vertebrates. Here, we describe the
isolation of cDNAs encoding ␣- and ␤-globin from F rubripes. We
have used these cDNAs to isolate the genomic loci of these genes.
Surprisingly, the genes have split onto separate chromosomes in the
pufferfish, as demonstrated by DNA–fluorescence in situ hybridization (FISH) analysis. Sequence analysis of the cosmid containing
the ␤-globin gene reveals close linkage with 2 ␣-globin genes, ␣3
and ␣4; we refer to this locus as the ␣␤-locus. Another ␣-globin
cDNA is derived from a globin locus on a different chromosome.
This locus contains 2 ␣-globin genes, ␣1 and ␣2, but no ␤-globin
gene,10 and is therefore referred to as the ␣-locus.
To find potential regulatory elements in the ␣␤-locus, we have
performed DNaseI hypersensitive site analysis in Fugu erythroid
cells, searched for transcription factor binding sites that are
From the MGC Department of Cell Biology, Erasmus MC, Rotterdam, The
Netherlands; Department of Pharmacology, University College Dublin, Belfield,
Ireland; Department of Biology, Imperial College of Science, Technology and
Medicine, London, United Kingdom; MPI für Molekulare Genetik, Ihnestrasse,
Berlin, Germany; MRC Molecular Haematology Unit, Institute of Molecular
Medicine, John Radcliffe Hospital, Oxford, United Kingdom; and Department of
Zoology, University of Hong Kong, China.
Supported by the Dutch Organization for Scientific Research NWO.
Submitted September 1, 2002; accepted November 1, 2002. Prepublished
online as Blood First Edition Paper, November 27, 2002; DOI 10.1182/blood2002-09-2850.
2842
N.G. and T.M. contributed equally to this work.
Reprints: Sjaak Philipsen, Erasmus MC Department of Cell Biology, PO Box
1738, 3000 DR Rotterdam, The Netherlands; e-mail: [email protected].
The publication costs of this article were defrayed in part by page charge
payment. Therefore, and solely to indicate this fact, this article is hereby
marked ‘‘advertisement’’ in accordance with 18 U.S.C. section 1734.
© 2003 by The American Society of Hematology
BLOOD, 1 APRIL 2003 䡠 VOLUME 101, NUMBER 7
BLOOD, 1 APRIL 2003 䡠 VOLUME 101, NUMBER 7
hallmarks of the mammalian distal regulatory elements LCR and
␣-MRE, and analyzed expression of the ␣␤-locus in transgenic
mice. These analyses suggest that the ␣␤-locus may not contain a
strong distal element regulating the activity of the globin genes.
Both pufferfish globin loci are flanked by a highly conserved
gene encoding a protein homologous to Drosophila rhomboid. The
observation that a mammalian homologue of this gene, C16orf8, is
found closely linked to the mammalian ␣-globin genes strongly
supports the hypothesis that the ␣- and ␤-globin loci have evolved
from a single ancestral hemoglobin locus. Furthermore, we have
found a short region of homology between the pufferfish hemoglobin loci and human chromosome 17. This region contains a
C16orf8 homologue closely linked to a gene encoding a recently
identified novel member of the globin family, called cytoglobin11 or
histoglobin.12 Collectively, our data indicate that duplication of
the globin loci occurred several times in evolution. Each locus
then diverged from the ancestral locus, resulting in the 5 human
globin loci known to date, with characteristic features regarding
chromosomal environment, flanking genes, function, and expression pattern.
Materials and methods
GLOBIN LOCI IN PUFFERFISH AND HUMANS
2843
homology searches were performed against the public databases using the
BLAST computer programs17 (http://www.ncbi.nlm.nih.gov/BLAST/, http://
www.ensembl.org); the private database of the Celera company (Rockville,
MD; human and mouse genomes); and the Fugu genomic and cDNA
databases (http://fugu.hgmp.mrc.ac.uk/Analysis/). The loci drawn in Figure
5 represent the consensus of the public and private databases (human,
mouse, and Fugu genome; January 2002) and published papers (April
2002). Genscan was used to find potential exons (http://genes.mit.edu/
GENSCAN.html). Alignments of human and Fugu sequences were made
with the BLAST 2 sequences program (http://www.ncbi.nlm.nih.gov/blast/
bl2seq/bl2.html). To increase the sensitivity of the searches, the Fugu contig
was divided into 1.1-kb subsequences with 100-bp overlaps. Alignments of
C16orf8 orthologues were visualized with VISTA (Lawrence Berkeley
National Laboratory, Berkeley, CA).18 The accession number of the
␣␤-locus is AY170464.
Preparation of Fugu metaphase spreads
Live pufferfish (fingerlings 4-10 cm in size) were purchased from Green
Science, Yamaguchi, Japan. Chromosome spreads were prepared as previously described.19 Briefly, the pufferfish were intraperitoneally injected
with 0.1% colchicein (approximately 0.1 mL/10 g fish), the fish were killed
after 6 to 8 hours, and the kidneys were isolated. Kidney cell suspensions
were subjected to hypotonic treatment, and, after fixation, the cells were
dropped onto slides and stained with Giemsa.
Construction of the genomic cosmid library
In situ hybridization of Fugu interphase nuclei and metaphase
spreads
High-molecular-weight DNA was isolated from adult Fugu blood (a kind
gift from Dr Ichiro Nakayama, Tamaki, Japan) and was partially digested
with MboI. The DNA was size-fractionated by centrifugation through a salt
gradient, and DNA fragments in the 20- to 40-kilobase (kb) size range were
ligated to the arms of the pTCF cosmid cloning vector.13 Ligation reactions
were packaged with in vitro packaging extracts followed by infection of
HB101 host cells. The resultant cosmid library was plated on ampicillincontaining LB-agar, and filters derived from this library were screened for
the presence of cosmids containing the ␣- and ␤-globin genes. In addition,
we used a gridded cosmid library constructed in the lawrist 4 vector.14
DNA-FISH was performed on interphase nuclei and chromosomal spreads
from the pufferfish using biotin- or digoxigenin-labeled plasmid probes
containing the Fugu ␣- and ␣␤-cosmid DNAs. Preparation of the samples
and hybridizations were carried out as described by Mulder et al.19 The
hybridized biotin probe was detected with 2 layers of avidin–fluorescein
isothiocyanate (FITC), and the hybridized digoxigenin probe was detected
with an anti-digoxigenin antibody followed by a Texas red–labeled
secondary antibody. DNA was counterstained with DAPI.
DNaseI hypersensitive site mapping
Isolation and characterization of cosmid clones
Fugu ␣1- and ␤-globin cDNA clones were isolated from a cDNA library
made from adult Fugu blood, using salmon ␣- and ␤-globin cDNAs as
probes.15 These cDNA clones were then used to screen the genomic cosmid
libraries. Two positive cosmids were obtained with the ␣1-globin probe and
one with the ␤-globin probe. The cosmids were subjected to restriction
mapping, subcloning, and sequencing.
Transgenic mice
The ␤-cosmid was digested with EcoRI, and the 22-kb DNA fragment
containing the globin genes (Figure 4A) was purified on a salt gradient. It
was then used at a concentration of 2 ␮g/mL to generate transgenic mice.16
DNA isolated from tail clips was used to identify transgenic founder mice
by Southern blotting. Transgenic F1 offspring were mated to wild-type FVB
mice, and expression of the pufferfish ␤-globin gene was analyzed by
reverse transcription–polymerase chain reaction (RT-PCR) of RNA isolated
from yolk sac (day-11.5 embryos), fetal liver (day-13.5 fetuses), and
peripheral blood (adult mice). Primers used were TGGACTGATCAAGAGCGC (sense) and GTCCATGTTCTTCACAGC (antisense); expected
product size on cDNA was 215 base pair (bp). No amplification product was
expected on genomic DNA because the sense primer bridges exon 1 and 2.
DNA sequencing and analysis
Subclones from the ␤-globin cosmid were sequenced on an ABI automated
sequencer. Overlapping subclones were then used to assemble the sequences into a contig. Final gaps in the sequence were closed by direct
sequencing of cosmid DNA with custom-designed primers. Sequence
Nuclei were isolated from frozen F rubripes tissues as described.20 In some
instances, mouse fetal livers were added as a source of carrier nuclei. A
time-course (0-10 min) of DNaseI digestion was performed at 37°C.20 The
reactions were stopped by the addition of sodium dodecyl sulfate (SDS) to
1% final concentration and EDTA (ethylenediaminetetraacetic acid) to 5
mM final concentration. After purification, the DNA was digested with
SphI, SacI, or XhoI, fractionated on 0.8% agarose gels, and Southern
blotted. Blots were hybridized with various probes from different regions of
the ␣␤-locus to cover the entire locus on overlapping restriction fragments.
These probes were made by PCR using the following primer pairs: probe 1,
CCGACAAGCGTTGCAGTAAT and ATTCTCCTTTGGCCTGCTTC
(product 1082 bp); probe 2, TTCAGACAGGCTAGAATGCC and CGTATGTGGCTTGTTCCCTT (product 605 bp); probe 3, AAGCTGTGTTCTTGACTGGG and ACCAGGAGTTGCTTTGGAAC (product 1098 bp);
probe 4, TGACAACTCGCTGGTAACTG and TCCACAAGGTCCCTGTATTC (product 554 bp); probe 5, TCAGTGGCGACATTTCACCT and
GGAAGGTTCATTTGCACACG (product 970 bp); probe 6, AGCTTGACTCCCGATGAACT and AGAATCTGCCTCGAAGAAGC (product
974 bp); probe 7, GCAGCAGGTTCTCAATCATC and TAGACACCCAAAGCCTTGAC (product 711 bp).
Expression analysis
One microgram total RNA, isolated from various tissues of adult mice, was
reverse transcribed with an oligo-dT primer followed by PCR reactions on
one fifth of the total synthesis. Primers used are 5⬘-GGCACACACCAAGAGTTCAGG-3⬘ and 5⬘-GCACGGTAGCCACAGCAGTA-3⬘ for cytoglobin (293-bp product). Primers for cyclophilin A (5⬘-TCACCATTTCCGACTGTGGAC-3⬘ and 5⬘-ACAGGACATTGCGAGCAGATG-3⬘) were used as
2844
GILLEMANS et al
BLOOD, 1 APRIL 2003 䡠 VOLUME 101, NUMBER 7
an internal control (99-bp product). PCR cycles used were determined to be
within the linear range of the reactions.
Results
Isolation of cDNAs encoding F rubripes globins
To begin to analyze the globin genes of the pufferfish, we prepared
RNA from peripheral blood and used this to construct a cDNA
library. This library was screened under low-stringency conditions
with salmon ␣- and ␤-globin cDNA probes.15 Twenty-four positive
clones were picked and were analyzed by restriction mapping
followed by sequencing and database searches. This resulted in the
isolation of cDNAs encoding Fugu ␣- and ␤-globin proteins
(Figure 1). The ␣-globin cDNA is designated ␣1-globin in this
paper. BLAST searches of the Fugu cDNA database revealed many
perfect matches with our ␣1-globin cDNA and many imperfect
matches with another ␣-globin cDNA. For ␤-globin, we found
many highly similar cDNAs aligning with our ␤-globin cDNA,
indicating that these are all derived from the same gene and
suggesting that Fugu contains only one functional ␤-globin gene.
The deduced amino acid sequence of the Fugu ␣- and ␤-chains
predicts that they would form a Bohr-type hemoglobin tetramer.24
Chromosomal clones containing the F rubripes
␣- and ␤-globin genes
The Fugu pTCF cosmid library was screened with the Fugu ␣1and ␤-globin cDNAs as probes. Two cosmids that hybridized
strongly with the ␣1-globin probe (␣-cosmids) were recovered.
One of the ␣-cosmids was rearranged and is not further considered.
In addition, we screened the gridded Fugu lawrist 4 cosmid
library14 with the ␤-globin probe. This resulted in the isolation of
one cosmid (ICRFc66E1840; ␣␤-cosmid; see below) strongly
hybridizing with this probe. Restriction mapping and Southern
hybridizations failed to demonstrate the presence of overlapping
DNA fragments between the ␣- and ␣␤-cosmids, suggesting that
their inserts are not closely linked in the Fugu genome.
DNA-FISH analysis of F rubripes ␣- and ␣␤-globin loci
To investigate whether the 2 globin cosmids are physically linked
in F rubripes, we used DNA-FISH on interphase nuclei and
metaphase chromosome spreads.19 To obtain metaphase spreads of
pufferfish chromosomes, fish were injected intraperitoneally with
colchicein and were killed 6 to 8 hours later. Because the kidney is
the site of hematopoiesis in fish, it is likely to contain relatively
large numbers of dividing cells. We therefore used kidney cells to
prepare metaphase spreads according to standard procedures.19 We
used ␣- and ␣␤-cosmid DNA probes to evaluate the chromosomal
localization of the 2 globin loci. In nuclei, we found 2 red spots
with the ␣-cosmid and 2 green spots with the ␣␤-cosmid. Confocal
Figure 2. Globin loci of the pufferfish F rubripes are located on different
chromosomes. (A) Nuclei were prepared from peripheral blood of adult Fugu, fixed
onto poly-L-lysine–coated slides and subjected to DNA-FISH with Fugu ␣- (red) and
␣␤-cosmid (green) probes. Four representative images, obtained by confocal
scanning laser microscopy, are shown. The ␣- and ␣␤-cosmid signals are always
clearly separated from each other. (B) Metaphase spreads of kidney cells isolated
from colchicein-treated Fugu rubripes fingerlings were hybridized with Fugu ␣-cosmid
(red) and ␣␤-cosmid (green) probes. Two chromosomes from one metaphase spread
are shown. Both probes hybridize to the telomeric end of the p arm of one of the Fugu
chromosomes. The chromosome with the red ␣-cosmid signal is much larger that the
chromosome with the green ␣␤-cosmid signal. Original magnification ⫻ 100.
microscopy shows that these spots are always clearly separated,
and we did not observe colocalization of the red and green signals
(Figure 2A). Although these data do not exclude that the loci are on
the same chromosome, it shows that they are not closely linked in
the pufferfish genome. The analysis of spread metaphases was
more difficult because of the low frequency of dividing cells and
the inefficiency of probe hybridization. Nevertheless, specific
hybridization signals could be detected and categorized into
chromosomes bearing green signals and chromosomes bearing red
signals. Both signals were observed at the telomeric ends of the
chromosomes. However, colocalization of red and green signals on
the same chromosome was never found. Furthermore, the red
␣-cosmid signal is present on a much larger chromosome than the
green ␣␤-cosmid signal (Figure 2B). We conclude that the ␣- and
␣␤-cosmids represent 2 hemoglobin loci that have separated onto
different chromosomes in the pufferfish.
F rubripes ␣3-, ␣4-, and ␤-globin genes
Because the work in our laboratory is focused on the analysis of the
human ␤-globin gene cluster, we analyzed the pufferfish cosmid
containing the ␤-globin gene in more detail. We sequenced the
␤-globin gene and flanking sequences. We found that the cosmid
contains one ␤-globin gene that matches our ␤-globin cDNA
perfectly. In addition, we found that 2 putative ␣-globin genes flank
the ␤-globin gene. To validate the assignment of the Fugu globins
as either ␣-type or ␤-type proteins, alignments of human and Fugu
globins are shown in Figure 1.
The ␣-cosmid contains the ␣1- and ␣2-globin genes but no gene
encoding a ␤-globin polypeptide.10 We therefore refer to our
␣-globin genes as the ␣3- and ␣4-globin genes and to our globin
locus as the ␣␤-locus. Because the ␣3-globin gene aligns perfectly
with ␣-globin cDNAs in the Fugu cDNA database, we conclude
Figure 1. Alignments of human and Fugu ␣- and
␤-globin proteins. The (deduced) amino acid sequences of human (h) and Fugu (f) alpha and beta
globins were aligned with the multalin program.21 The
alignments are displayed with the aid of the boxshade
program to illustrate the classification of the Fugu proteins as ␣- or ␤-globins. Residues found specifically in ␣or ␤-type globins are shown by color. The consensus line
is for all 6 globins: . indicates moderately conserved
residue; :, well-conserved residue; *, identical residue in
all 6 globins.
BLOOD, 1 APRIL 2003 䡠 VOLUME 101, NUMBER 7
Figure 3. The ␣␤-cosmid contains ␣- and ␤-globin genes. Restriction mapping
and Southern hybridization were used to determine the location of the ␤-globin gene,
and an area of approximately 35 kb surrounding the gene was sequenced. BLAST
searches and alignments revealed the presence of 3 putative globin genes. (A) The
␣3-, ␣4-, and ␤-globin genes are closely linked and directed in opposite transcriptional orientations. Arrows indicate the transcription start sites. Genes are shown as
boxes with exons in black. (B) Promoter area of the ␣3-globin gene and (C) promoter
area of the ␤-globin gene. The beginning of exon 1 is boxed. Putative TATA boxes and
an inverted CACC motif are highlighted with a gray background.
that it is a functional gene. The ␣3-/␣4- and ␤-globin genes are in
the opposite transcriptional orientation (Figure 3A). The introns of
these globin genes are relatively small (88-551 bp), as would be
expected in the pufferfish, but the classical 3 exon/2 intron structure
of the vertebrate globin genes is conserved.6 The splice donor and
acceptor sites conform to the GT/AG rule, and we find canonical
poly-adenylation signals in all 3 genes (data not shown). The ␣4
globin gene is most closely related to the ␣d-globin gene of birds,
the minor adult ␣-globin.25 Given that the gene lacks a TATAA box
in the canonical position and there are no perfect matches in the
Fugu cDNA database, we consider it possible that this gene is no
longer active.
We find a number of distinctive hallmarks in the promoters of
the Fugu ␣3- and ␤-globin genes (Figure 3B-C). Both promoters
contain noncanonical TATA-box motifs at the expected positions.
Perhaps the most interesting observation is the presence of an
inverted CACC-box motif (TGGGTGGGG) in the ␤ promoter. In
mammals, this motif is essential for high-level ␤-globin expression26,27 through the interaction with the erythroid-specific transcription factor, EKLF.28-30 This suggests that expression of the Fugu
␤-globin gene is also regulated by an EKLF homologue. To
functionally characterize the Fugu ␣␤-locus, we isolated a 22-kb
EcoRI fragment containing the globin genes (Figure 4A) and used
it to generate transgenic mice. Two founder mice transmitted the
transgene to their offspring. Although these lines appeared to
contain intact copies of the transgene as judged by Southern blot
analysis, we could not detect the expression of transgene-derived
␤-globin mRNA in embryonic, fetal, and adult erythroid cells (data
not shown). Thus, either the 22-kb fragment lacks elements
essential for globin gene activation or the evolutionary distance
precludes activation of the pufferfish ␣␤-locus in mice.
Search for distal regulatory elements
We searched for combinations of erythroid-specific transcription
factor binding sites (EKLF, GATA, NF-E2)10 to identify regulatory
elements of globin expression outside the promoters of the genes.
Although we found a clustering of potential NF-E2 binding sites
upstream of the ␣4-globin gene, positioned around 25.5 kb in
Figure 4A, these sites were part of a 27-bp sequence tandemly
repeated 3 times and located in an area of repetitive DNA (Figure
4A). Such an arrangement does not resemble previously characterized globin control elements, and the clustering of these sites is
possibly spurious because of the tandem repeats. BLAST alignments with other vertebrate globin loci did not reveal any clues to
the presence of regulatory elements. However, sequence conserva-
GLOBIN LOCI IN PUFFERFISH AND HUMANS
2845
tion in regulatory modules is usually very poor. We therefore used
DNaseI hypersensitive site (HS) mapping as an alternative approach to obtain information about potential regulatory elements in
the pufferfish ␣␤-locus. We isolated nuclei from peripheral blood
and digested these with increasing amounts of DNaseI to reveal the
presence of erythroid-specific DNaseI HS in the locus. As nonerythroid control tissue we used liver. We chose restriction digests and
PCR-generated hybridization probes suitable for HS mapping
(Figure 4A). Southern blots revealing hypersensitive sites at the
globin gene promoters are shown in Figure 4B. We found that the
promoters of the ␣3- and ␤-globin genes were in an open chromatin
conformation in erythroid cells only, in agreement with the notion
that these genes are actively transcribed in red blood cells. We did
not find hypersensitivity associated with the ␣4 promoter, in
agreement with our hypothesis that this promoter is no longer
functional. The repetitive sequences around 25.5 kb appear to be
hypersensitive to DNaseI digestion in erythroid cells, but some
hypersensitivity is also found in the control tissue (Figure 4B).
Thus, this might reflect an intrinsic property of these repetitive
sequences. In conclusion, the analysis of DNaseI sensitivity in the
pufferfish ␣␤-locus chromatin demonstrated the presence of erythroid-specific hypersensitive sites associated with the promoters
of the ␣3- and ␤-globin genes but has not revealed the presence of
strong erythroid hypersensitive sites at other positions in the
locus. This suggests that activation of the globin genes in the
pufferfish ␣␤-locus does not require the presence of distant
regulatory elements.
Figure 4. DNaseI hypersensitive site mapping of the F rubripes ␣␤-globin gene
domain. (A) Features of the F rubripes ␣␤-globin gene domain and strategy for
DNaseI hypersensitive site mapping. Arrows indicate the transcriptional direction of
the genes. Restriction sites used to cut genomic F rubripes DNA are indicated:
A, SacI; E, EcoRI; S, SphI; X, XhoI. The EcoRI sites were used to isolate the fragment
for transgenesis. Probes for Southern hybridization were generated by PCR amplification and are labeled 1 to 7. Repetitive sequences are denoted by gray bars: T
indicates homology with a human telomeric sequence (Z9627522); ?, unknown
repetitive element with homology to yeast tRNA-met (AL121 795,); R, areas with
multiple BLAST hits in the Fugu genome; R1, homology with reverse transcriptase/
rex1 transposon.23 The positions of strong erythroid-specific hypersensitive sites are
indicated by black arrowheads; weak hypersensitive sites are indicated by open
arrowheads. (B-C) Examples of Southern blot analysis of DNaseI hypersensitive
sites in F rubripes chromatin. Nuclei were isolated from the tissues indicated and
treated with increasing amounts of DNaseI. DNA was purified, digested with the
appropriate restriction enzymes, and subjected to Southern blotting. In panel B, the
DNA was digested with SphI, and the blot was hybridized with probe 5. Strong
hypersensitive sites coinciding with the promoters of the ␣3- and ␤-globin genes are
indicated by arrows. Arrowheads indicate weaker sites. In panel C, the DNA was
digested with SacI, and the blot was hybridized with probe 5. No hypersensitive sites
are observed in blood, kidney, or liver (not shown).
2846
GILLEMANS et al
Genes flanking the F rubripes ␣␤-locus
In mammals, the ␤-globin locus is flanked by genes encoding
odorant receptors.31 If this represents the archetypal ␤-globin locus,
a similar setting might be found for the Fugu ␣␤-locus. Using the
Genscan computer program, we found a number of potential exons
in the region downstream of the ␣3-globin gene. These exons are
highly homologous to the human full-length cDNA FLJ22357,
which is encoded by the C16orf8 gene located close to the human
␣-globin cluster (gene 5 in Flint et al10). Because some of the exons
and introns are extremely small (65 bp), the exon–intron structure
of this gene is not readily predicted by Genscan. We made use of
the FLJ22357 cDNA and deduced protein sequence to determine
the intron–exon structure of the Fugu gene. We find that the human
and pufferfish genes contain 18 exons and that all the exon–intron
boundaries are in the same positions. Furthermore, alignment of the
predicted proteins reveals that 72% of the amino acids are identical
and 83% are similar, with just 23 gaps in the alignment of the 855
amino acid (aa) proteins. This degree of conservation is much
higher than that observed for the hemoglobins (48%-49% identical
residues). We conclude that in the ␣␤-locus, a homologue of gene 5
is the first gene flanking the globin genes on the left (Figures 4A,
5). This is surprising because we have found previously that
homologues of genes telomeric to the human ␣-globin cluster are
present in the pufferfish ␣-locus in the order gene 4, gene 3.1, gene
5, gene 6, and gene 7, with gene 7 closest to the ␣-globin genes10
(Figure 5).
To the right of the ␣4-globin gene, we found potential exons
encoding parts of a protein with extensive homology to the human
leucine carboxyl methyltransferase (LCMT) enzyme. Using the
human LCMT cDNA sequence, we were able to identify the
remaining exons of the Fugu LCMT gene. Both genes contain 11
exons, and the exon–intron boundaries are well conserved between
the species. The Fugu LCMT gene is in the same transcriptional
orientation as the ␣-globin genes (Figure 4A). The putative LCMT
protein is highly conserved between human and Fugu: 65% of the
amino acids are identical, and 80% of the residues are similar.
Furthermore, optimal alignment does not require the introduction
of gaps in either the human or the Fugu sequence. This degree of
similarity is much higher than that observed with the hemoglobins,
BLOOD, 1 APRIL 2003 䡠 VOLUME 101, NUMBER 7
supporting the notion that the putative Fugu LCMT gene is
functional. We find that the human LCMT gene is located on
chromosome 16, some 30 Mb away from the ␣-globin locus. We
therefore conclude that the region of homology between the human
and Fugu globin loci stops immediately to the right of the ␣4 gene.
These data are consistent with previous reports showing that the
regions of homology between ␣-globin loci break down at comparable positions.10
Comparative analysis reveals the presence of a novel globin
locus in mammals
In the human genome, a paralogue of the C16orf8 gene, encoding
FLJ22341, is found on chromosome 17. The pufferfish hemoglobin
loci also contain genes highly homologous to the C16orf8 gene.
Multiple alignment of the human and pufferfish genes generated
with the aid of VISTA18 demonstrates the conservation of the
coding exons between the C16orf8-related genes (Figure 6).
Because the pufferfish globin loci are flanked by C16orf8 homologues, we searched the surroundings of the FLJ22341 gene on
human chromosome 17 for the presence of the other genes found in
the pufferfish ␣- and ␣␤-globin loci. This comparison yielded 2
remarkable results. First, the FLJ22341 gene is flanked on the left
by the AANAT gene, encoding the arylalkylamine N-acetyltransferase protein (NP_001079). This gene is present in a similar
position in the pufferfish ␣-locus, but not in the human ␣-locus
(Figure 5). Second, the gene immediately flanking the FLJ22341
gene on the right encodes a novel member of the globin family
(XM_05881811,12); the official name assigned to this globin is
cytoglobin (CYGB). Our expression analysis of cytoglobin in the
mouse (Figure 7A-B) confirms previous observations that it is
widely expressed11,12 but also reveals large differences in expression between tissues.
In the human and pufferfish ␣-loci, the MPG and C16orf35
genes are between the C16orf8 gene and the globin genes, but in
the pufferfish a␤-locus, the C16orf8 homologue is immediately
flanked by a globin gene (Figure 5). Thus, this order of genes is the
same between the cytoglobin locus on human chromosome 17 and
the pufferfish ␣␤-locus. Furthermore, this syntenic region on
human chromosome 17 is completely conserved with a syntenic
Figure 5. Genes flanking human and pufferfish globin
loci. Schematic drawings of the globin loci in human and
pufferfish genomes. The human ␣-globin locus serves as
the reference locus and is drawn to scale; flanking genes
referred to in the text are color coded. Nomenclature is
according to Flint et al.10 Key to the color code: magenta
indicates POLR3K; green, C16orf33; light orange,
C16orf8; lavender, MPG; purple, C16orf35; red, globins;
and peach, AANAT. Other genes are represented by dark
gray; odorant receptor genes in the human ␤-globin locus
are represented by light gray.
BLOOD, 1 APRIL 2003 䡠 VOLUME 101, NUMBER 7
GLOBIN LOCI IN PUFFERFISH AND HUMANS
2847
Figure 6. Comparative analysis of C16orf8-related genes in pufferfish and human. (A) C16orf8 homologs found in the pufferfish ␣- and ␣␤-loci, and the human cytoglobin
locus on chromosome 17, were aligned with the C16orf8 gene of the human ␣-globin locus10 and visualized with the VISTA program. Because of the large size of the first intron,
the alignment starts near exon 2. The graphs depict homologies between 50% and 100%. (B) Homology distance matrix of the proteins encoded by the C16orf8 homologues of
pufferfish and human. FLJ22341 on human chromosome 17 has an N-terminal truncation. Therefore, the matrix was calculated using the part that all 4 proteins have in
common—that is, aa 208 to 855 of FLJ22357; aa 1 to 619 of FLJ22341; aa 210 to 855 of the pufferfish ␣-locus homologue, and aa 212 to 855 of the pufferfish ␣␤-locus
homologue.
region on mouse chromosome 11, confirming the common evolutionary origin of this area of the genome. Based on these
observations, we conclude that we have identified a novel globin
locus on human chromosome 17/mouse chromosome 11.
Discussion
The ␣- and ␤-globins in pufferfish
Here, we describe the isolation of ␣- and ␤-globin genes from the
pufferfish F rubripes. We present evidence that Fugu contains one
␤-globin gene and at least 2 functional ␣-globin genes. This
conclusion is supported by BLAST searches in the most recent
version of the Fugu genome5 (version 8.1.1; release date, July 18,
2002) that indicate the Fugu genome does not harbor hemoglobin
genes in addition to those contained in the ␣- and ␣␤-loci.
The presence of 3 functional hemoglobin genes has been
reported previously for the black rock cod, Notothenia coriiceps. It
has been suggested that these fish have no requirement for
hemoglobin molecules with different oxygen affinities because
there is little variation in temperature and oxygen levels in their
habitat.32,33 This could also apply to the pufferfish. The Fugu
␤-globin gene is closely linked to the ␣3- and ␣4-globin genes;
such close linkage is commonly observed in poikilothermic jawed
vertebrates. It is interesting that the ␣1- and ␣2-globin genes are
located in a different globin cluster on a separate chromosome. This
globin locus encodes only ␣-globin.10 To the best of our knowledge, this is the first example of the split of ␣- and ␤-globin genes
onto separate chromosomes in poikilothermic vertebrates. The
Fugu ␣-locus contains the ␣1- and ␣2-globin genes, of which the
␣1-globin is active. The ␣␤-locus contains the ␣3- and ␣4-globin
genes, of which the ␣3 gene is active. The ␣2 and ␣4 genes are
reminiscent of the rat ␥1 gene that has retained its coding capacity
but is not expressed because of an inactive promoter.34 We
hypothesize that these apparently superfluous globin genes have
been silenced to maintain a proper ␣/␤ chain ratio.
Regulation of globin gene expression
One of the aims of the present study was to gain insight in the
regulatory mechanisms underlying globin gene expression. We
anticipated that the small size of the Fugu globin clusters would
facilitate the elucidation of the requirements for high-level, erythroid-specific gene expression. However, we found no expression
of the Fugu ␣␤-cosmid globin genes in transgenic mice. Other
examples have been reported for the Fugu WT1 gene (N. Hastie,
personal communication, March 2000) and the Huntingtin gene.35
Possibly, the evolutionary distance between Fugu and mouse
precludes the activation of Fugu genes in the mouse.
The major regulatory elements of the mammalian hemoglobin
loci, ␣-MRE and LCR, are characterized by the presence of strong
DNaseI HSs in erythroid cells. We therefore performed DNaseI
hypersensitive site mapping of the Fugu ␣␤-locus and searched for
transcription factor binding sites to identify candidate regulatory
elements. We find erythroid-specific hypersensitive sites overlapping the promoters of the ␣3- and ␤-globin genes. We note that the
promoter of the Fugu ␤-globin gene contains an EKLF consensus
site, in a position similar to that found in the mammalian
␤-promoters. This binding site is required for high-level ␤-globin
expression in mammals through the interaction with the erythroidspecific EKLF transcription factor.30 In contrast, we do not find
evidence for the presence of distal regulatory elements in the
␣␤-locus, suggesting that activation of the globin genes in the
␣␤-locus may not require remote activating elements. It is intriguing that the region of homology with the putative ␣-MRE, located
in a conserved position (intron 5 of gene 7)10 in the Fugu ␣-locus, is
absent in the ␣␤-locus. A strong erythroid-specific DNaseI hypersensitive site coincides with this putative ␣-locus MRE (data not
shown), and we have previously shown that this element serves as
an enhancer in transfection experiments.10 Collectively, these data
argue that remote regulatory elements do exist in fish. Therefore, it
remains possible that such elements are part of the ␣␤-locus
outside the area analyzed in this study.
Evolution of hemoglobin loci
Figure 7. Expression analysis of cytoglobin. (A) RNA was isolated from the
indicated organs derived from adult mice, and expression of cytoglobin was
determined by RT-PCR. The number of PCR cycles was within the linear range of the
reaction (not shown). (B) To quantitate the amplicons, the bands were scanned on a
Molecular Dynamics Typhoon instrument (Sunnyvale, CA), and the relative expression levels of cytoglobin were calculated using cyclophilin A as a reference.
The physical separation of the ␣- and ␤-genes is thought to be
advantageous for the generation of novel ␣- and ␤- chain variants
because gene conversion events would suppress the separate
evolution of these 2 globins when the genes are in cis. Furthermore,
separation of the loci increases the flexibility of the spatio-temporal
regulation of globin gene expression, as exemplified by the
relatively recent recruitment of a fetal ␤-like globin gene in some
2848
GILLEMANS et al
euplacental mammals such as goats and humans.37 It is believed
that the ␣- and ␤-globins have evolved from an ancestral globin
gene through in cis gene duplication events. Later, the ␣- and
␤-globin genes split onto separate chromosomes through in trans
duplication of the locus followed by the elimination of the ␣-genes
from the ␤-locus and the ␤-genes from the ␣-locus, resulting in the
distinct ␣- and ␤-globin loci found in today’s birds and mammals.37
This model of the common evolutionary origin of the human ␣- and
␤-globin loci is strongly supported by our observation that C16orf8
homologues are linked to both Fugu hemoglobin loci. However,
the mammalian ␤-globin loci are flanked by olfactory receptor
genes.31 In Fugu, we find no evidence for homology with mammalian and chicken ␤-globin loci in the chromosomal regions around
the ␤-gene. Possibly, the locus duplication events leading to the
Fugu and mammalian hemoglobin loci have occurred independently during evolution. This is supported by the fact that thus far
no ␣-only or ␤-only loci have been found in the 2 major amphibian
lineages, frogs38 and salamanders (T.McM. and S.P., unpublished
data, May 2001). Alternatively, the loci may have arisen from the
same duplication event, with the present day ␤-globin loci in
homoiothermic vertebrates separated from their original flanking
genes through additional chromosomal rearrangements. The analysis of genes flanking the hemoglobin loci in amphibians might help
to distinguish between these 2 possibilities.
Common evolutionary origin of human globin loci?
The comparative analysis of pufferfish and human globin loci is
consistent with a common evolutionary origin of the human globin
loci since we find short regions of homology flanking the ␣-globin
(pufferfish and human) ␣␤-globin (pufferfish) and cytoglobin
(human) clusters. The current annotation of the Fugu genome
indicates that neuroglobin, myoglobin, and cytoglobin genes are
present in this fish species, but it is unclear yet whether any of these
globin genes are also linked to AANAT or C16orf8 genes, or both
(S.P., unpublished observations, August 2002).
Recently, evidence has been presented that ancient genome
duplications contributed to the vertebrate genome.39,40 In agreement with these data, our work supports a model in which globin
loci have evolved through duplication events followed by diversifi-
BLOOD, 1 APRIL 2003 䡠 VOLUME 101, NUMBER 7
cation and specialization of the separate loci.37 Evidence for the
original chromosomal rearrangements that gave rise to human
myoglobin, neuroglobin, and ␤-globin loci may no longer be
recognized because other, unrelated genes now flank these loci
(Figure 5). In contrast, the cytoglobin locus has retained linkage
with the AANAT and C16orf8 genes, providing evidence of the
common evolutionary origins of this locus and the ␣- and ␣␤-loci.
Cytoglobin appears to be the most primitive of these loci because it
contains only one globin gene encoding a globin of ancient
origin.11,12 We therefore suggest that the cytoglobin locus reflects
the gene arrangement in an ancient vertebrate globin locus from
which the modern-day human myoglobin, cytoglobin, ␣-, and
␤-globin loci have been derived (see below; Figure 8). This notion
is supported by the observation that the C16orf8 homologues of the
human ␣-globin and the Fugu ␣- and ␣␤-loci are more closely
related to each other than to the C16orf8 homologue of the
cytoglobin locus (Figure 6B).
Model for the evolutionary origin of the human globin loci
Recently, a model of the evolution of vertebrate globins has been
proposed, based on a phylogenetic analysis of the globins.11 In
Figure 8, we have adapted this proposal to accommodate the
evolution of the human globin loci. The very early ancestor to
vertebrates contained a single ancestral globin gene. This globin
gene may already have been linked to ancestral AANAT and
C16orf8 genes, but there is no experimental evidence to support
such linkage. Based on the antiquity of neuroglobin, it has been
proposed that the last common ancestor to all vertebrates contained
2 globin loci.11 Thus, duplication of the ancestral globin locus
resulted in 2 globin loci, developing into loci encoding neuroglobin
and cellular globin. Our data support linkage of the cellular globin
locus to the C16orf8 and AANAT genes at this stage. Next,
duplication of the cellular globin locus resulted in separate cellular
and hemoglobin loci. Linkage of C16orf8 and AANAT genes to
cytoglobin and hemoglobin loci supports this mechanism. A further
duplication of the cellular globin locus allowed the development of
the myoglobin and cytoglobin loci. It is unclear from the pylogenetic data whether this occurred before the jawed vertebrates
diverged from the jawless vertebrates (agnathans: lampreys and
Figure 8. Model for the evolutionary origin of human
globin loci. Based on phylogenetic analysis, a model for
the evolution of the vertebrate globins has been proposed11 and provides the evolutionary time-scale for the
model depicted here. Genes are color coded; stippled
lines indicate physical lineage but uncertainty about the
order of the genes, the presence of additional genes, or
both. Gray bars indicate when bony fishes diverged from
agnathans, amphibians diverged from bony fishes, and
mammals diverged from reptiles.36
BLOOD, 1 APRIL 2003 䡠 VOLUME 101, NUMBER 7
GLOBIN LOCI IN PUFFERFISH AND HUMANS
hagfish),11,36 and it will therefore be of interest to determine
whether agnathans have both a myoglobin and a cytoglobin locus.
In the hemoglobin locus, gene duplication gave rise to a cluster
encoding several monomeric hemoglobins, as found in today’s
agnathans. This allowed the specialization of individual genes in
␣-type or ␤-type hemoglobins. Finally, additional locus duplication
events followed by deletions of globin genes resulted in hemoglobin loci with only ␣-type or ␤-type globins, typical of birds and
mammals. The presence of the ␣-locus, containing only ␣-type
globins, and the ␣␤-locus, containing both types of globins, in the
pufferfish supports this mechanism. Furthermore, this suggests that
the locus that gave rise to the human ␣-globin locus was already an
“␣-only” locus when amphibians diverged from bony fishes,
2849
approximately 400 million years ago, predicting that ␣-only loci
are also present in the amphibian and reptile lineages. Alternatively,
the ␤-gene might have been lost from these loci independently after
the divergence of bony fishes and amphibians.
Future directions
The model for the evolutionary origin of the human globin loci,
presented in Figure 8, makes several predictions that can be
experimentally tested through in silico analysis of globin loci in
agnathans, amphibians, and reptiles. In combination with in vitro
and in vivo assays, this “functional genomics” approach will
provide detailed insight into the evolution and regulation of
vertebrate globin gene clusters.
References
1. Brenner S, Elgar G, Sandford R, Macrae A, Venkatesh B, Aparicio S. Characterization of the pufferfish (Fugu) genome as a compact model vertebrate genome. Nature. 1993;366:265-268.
2. Schofield JP, Elgar G, Greystrong J, et al. Regions of human chromosome 2 (2q32-q35) and
mouse chromosome 1 show synteny with the
pufferfish genome (Fugu rubripes). Genomics.
1997;45:158-167.
3. Venkatesh B, Gilligan P, Brenner S. Fugu: a compact vertebrate reference genome. FEBS Lett.
2000;476:3-7.
4. Elgar G, Sandford R, Aparicio S, Macrae A, Venkatesh B, Brenner S. Small is beautiful: comparative genomics with the pufferfish (Fugu rubripes).
Trends Genet. 1996;12:145-150.
Weis S, Lehrach H. Gridded genomic libraries of
different chordate species: a reference library
system for basic and comparative genetic studies
of chordate genomes. Genomics. 1998;52:230232.
28.
15. Wagner A, Deryckere F, McMorrow T, Gannon F.
Tail-to-tail orientation of the Atlantic salmon alpha- and beta-globin genes. J Mol Evol. 1994;38:
28-35.
29.
16. Kollias G, Hurst J, deBoer E, Grosveld F. The human beta-globin gene contains a downstream
developmental specific enhancer. Nucleic Acids
Res. 1987;15:5739-5747.
17. Altschul SF, Gish W, Miller W, Myers EW, Lipman
DJ. Basic local alignment search tool. J Mol Biol.
1990;215:403-410.
30.
31.
5. Aparicio S, Chapman J, Stupka E, et al. Wholegenome shotgun assembly and analysis of the
genome of Fugu rubripes [abstract]. Science.
2002;25:25.
18. Mayor C, Brudno M, Schwartz JR, et al. VISTA:
visualizing global DNA sequence alignments of
arbitrary length. Bioinformatics. 2000;16:10461047.
32.
6. Hardison R. Hemoglobins from bacteria to man:
evolution of different patterns of gene expression.
J Exp Biol. 1998;201:1099-1117.
19. Mulder MP, Wilke M, Langeveld A, et al. Positional mapping of loci in the DiGeorge critical region at chromosome 22q11 using a new marker
(D22S183). Hum Genet. 1995;96:133-141.
33.
7. Vyas P, Vickers MA, Simmons DL, Ayyub H,
Craddock CF, Higgs DR. Cis-acting sequences
regulating expression of the human alpha-globin
cluster lie within constitutively open chromatin.
Cell. 1992;69:781-793.
8. Arapinis C, Elion J, Labie D, Krishnamoorthy R.
Differences in DNase I sensitivity and methylation
within the human beta-globin gene domain and
correlation with expression. Eur J Biochem. 1986;
156:123-129.
9. Tuan D, Solomon W, Li Q, London IM. The “betalike-globin” gene domain in human erythroid cells.
Proc Natl Acad Sci U S A. 1985;82:6384-6388.
10. Flint J, Tufarelli C, Peden J, et al. Comparative
genome analysis delimits a chromosomal domain
and identifies key regulatory elements in the alpha globin cluster. Hum Mol Genet. 2001;10:371382.
11. Burmester T, Ebner B, Weich B, Hankeln T. Cytoglobin: a novel globin type ubiquitously expressed
in vertebrate tissues. Mol Biol Evol. 2002;19:416421.
12. Trent JT 3rd, Hargrove MS. A ubiquitously expressed human hexacoordinate hemoglobin [abstract]. J Biol Chem. 2002;13:13.
13. Grosveld FG, Lund T, Murray EJ, Mellor AL, Dahl
HH, Flavell RA. The construction of cosmid libraries which can be used to transform eukaryotic
cells. Nucleic Acids Res. 1982;10:6715-6732.
14. Burgtorf C, Welzel K, Hasenbank R, Zehetner G,
20. Ellis J, Tan-Un KC, Harper A, et al. A dominant
chromatin-opening activity in 5⬘ hypersensitive
site 3 of the human beta-globin locus control region. EMBO J. 1996;15:562-568.
21. Corpet F. Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res. 1988;16:
10881-10890.
34.
22. Knight SJ, Lese CM, Precht KS, et al. An optimized set of human telomere clones for studying
telomere integrity and architecture. Am J Hum
Genet. 2000;67:320-332.
35.
23. Volff JN, Korting C, Schartl M. Multiple lineages of
the non-LTR retrotransposon Rex1 with varying
success in invading fish genomes. Mol Biol Evol.
2000;17:1673-1684.
36.
24. Perutz M. Molecular anatomy and physiology of
hemoglobin. In: Steinberg MH, Forget BG, Higgs
DR, Nagel RL, eds. Disorders of Hemoglobin.
Cambridge, England: Cambridge University
Press; 2001:174-196.
37.
38.
25. Dodgson JB, Engel JD. The nucleotide sequence
of the adult chicken alpha-globin genes. J Biol
Chem. 1983;258:4623-4629.
26. Steinberg MH. Case report: effects of iron deficiency and the ⫺88 C3T mutation on HbA2 levels in beta-thalassemia. Am J Med Sci. 1993;305:
312-313.
27. Rosatelli MC, Oggiano L, Battista Leoni G, et al.
Thalassemia intermedia resulting from a mild
39.
40.
beta-thalassemia mutation. Blood. 1989;73:601605.
Perkins AC, Sharpe AH, Orkin SH. Lethal betathalassaemia in mice lacking the erythroid
CACCC-transcription factor EKLF. Nature. 1995;
375:318-322.
Nuez B, Michalovich D, Bygrave A, Ploemacher
R, Grosveld F. Defective haematopoiesis in fetal
liver resulting from inactivation of the EKLF gene.
Nature. 1995;375:316-318.
Wijgerde M, Gribnau J, Trimborn T, et al. The role
of EKLF in human beta-globin gene competition.
Genes Dev. 1996;10:2894-2902.
Bulger M, van Doorninck JH, Saitoh N, et al. Conservation of sequence and structure flanking the
mouse and human beta-globin loci: the betaglobin genes are embedded within an array of
odorant receptor genes. Proc Natl Acad Sci
U S A. 1999;96:5129-5134.
Cocca E, Ratnayake-Lecamwasam M, Parker
SK, et al. Genomic remnants of alpha-globin
genes in the hemoglobinless Antarctic icefishes.
Proc Natl Acad Sci U S A. 1995;92:1817-1821.
D’Avino R, Caruso C, Schinina ME, et al. The
amino acid sequence of the alpha- and betachains of the two hemoglobins of the Antarctic
fish Notothenia coriiceps neglecta. FEBS Lett.
1989;250:53-56.
Satoh H, Inokuchi N, Nagae Y, Okazaki T. Organization, structure, and evolution of the nonadult rat
beta-globin gene cluster. J Mol Evol. 1999;49:
122-129.
Sathasivam K, Baxendale S, Mangiarini L, et al.
Aberrant processing of the Fugu HD (FrHD)
mRNA in mouse cells and in transgenic mice.
Hum Mol Genet. 1997;6:2141-2149.
Colbert EH, Morales M. Introduction. In: Evolution
of the Vertebrates. 4th ed. New York, NY: John
Wiley-Liss; 1991:1-15.
Hardison R. Organization, evolution and regulation of the globin genes. In: Steinberg MH, Forget
BG, Higgs DR, Nagel RL, eds. Disorders of Hemoglobin. Cambridge, England: Cambridge University Press; 2001:95-116.
Patient RK, Elkington JA, Kay RM, Williams JG.
Internal organization of the major adult alphaand beta-globin genes of X. laevis. Cell. 1980;21:
565-573.
McLysaght A, Hokamp K, Wolfe KH. Extensive
genomic duplication during early chordate evolution. Nat Genet. 2002;31:200-204.
Abi-Rached L, Gilles A, Shiina T, Pontarotti P,
Inoko H. Evidence of en bloc duplication in vertebrate genomes. Nat Genet. 2002;31:100-105.