Download Deficiency γ-α Genetic Basis of Human Complement C8

Genetic Basis of Human Complement C8α-γ
Deficiency
This information is current as
of June 18, 2017.
Takeshi Kojima, Takahiko Horiuchi, Hiroaki Nishizaka,
Yasuo Fukumori, Tetsuki Amano, Kohei Nagasawa,
Yoshiyuki Niho and Kenshi Hayashi
J Immunol 1998; 161:3762-3766; ;
http://www.jimmunol.org/content/161/7/3762
Subscription
Permissions
Email Alerts
This article cites 46 articles, 22 of which you can access for free at:
http://www.jimmunol.org/content/161/7/3762.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 1998 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
References
Genetic Basis of Human Complement C8a-g Deficiency1
Takeshi Kojima,* Takahiko Horiuchi,2* Hiroaki Nishizaka,* Yasuo Fukumori,†
Tetsuki Amano,‡ Kohei Nagasawa,§ Yoshiyuki Niho,* and Kenshi Hayashi¶
T
he eighth component of complement (C8) plays an important role in the function of membrane attack complex
(MAC)3 that is generated on target cells upon activation
of the complement system. MAC is generated by sequential addition of C5b, C6, C7, C8, and C9 molecules, which results in the
transmembrane pore and eventual cell lysis. After binding to C8,
C5b-7 complex, by itself transiently bound to membrane surface
and nonfunctional, is endowed with the ability to cause membrane
damage and polymerization of C9 that greatly accelerate MAC
activity (1). C8 is a 151-kDa molecule consisting of three nonidentical polypeptide chains: a (Mr 5 64 kDa), b (Mr 5 64 kDa),
and g (Mr 5 22 kDa) (2). Genetic studies of C8 polymorphisms
established that a-g and b are encoded at different loci (3–5). The
genes for C8a and C8b are located on chromosome 1p32 (6, 7),
whereas the gene for C8g is located on chromosome 9q (8). The a
and b subunits of C8 show an overall structural homology to C6,
C7, and C9 (9). The g subunit shows structural homology to protein HC (10). The a subunit is composed of 553 amino acid residues (11), has a domain that interacts with b subunit (12), and
comprises the binding site for C9 on C5b-8 (13). The a subunit
also has several membrane surface-seeking domains and a possible
*First Department of Internal Medicine, Faculty of Medicine, Kyushu University,
Fukuoka, Japan; †Department of Research, Osaka Red Cross Blood Center, Osaka,
Japan; ‡Third Department of Internal Medicine, Faculty of Medicine, Okayama University, Okayama, Japan; §Department of Internal Medicine, Saga Medical School,
Saga, Japan; and ¶Institute of Genetic Information, Kyushu University, Fukuoka,
Japan
Received for publication October 21, 1997. Accepted for publication May 27, 1998.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported in part by grants-in-aid from the Ministry of Education,
Science, and Culture of Japan (08670522), the Fukuoka Cancer Society, and the
Yokoyama Foundation.
2
Address correspondence and reprint requests to Dr. Takahiko Horiuchi, First Department of Internal Medicine, Faculty of Medicine, Kyushu University, Fukuoka
812-8582, Japan. E-mail address: [email protected]
Abbreviations used in this paper: MAC, membrane attack complex; C8a-gD, C8a-g
deficiency; SSCP, single-strand conformation polymorphism.
3
4
Throughout this paper, nucleotide and amino acid residues numbering for C8a is
according to Rao et al. (11).
Copyright © 1998 by The American Association of Immunologists
transmembrane domain (11). The b subunit also has a domain that
interacts with target membranes and a domain that specifically
mediates recognition and binding of C8 to C5b-7 (14). The g subunit is composed of 182 amino acid residues and is disulfide linked
to the a subunit (10, 15). However, the g subunit is not essential
for hemolytic activity, as evidenced by the fact that a C8 derivative
composed of only a and b is functionally equivalent to the normal
protein (12). Individuals with inherited deficiencies of the component of MAC frequently suffer from recurrent neisserial infections,
predominantly meningococcal infections of rare serotypes (16 –
18). Two functionally distinct C8 deficiency states have been described, depending on which of the C8 subunits (a-g or b) is
defective. The C8a-g deficiency (C8a-gD) is predominantly reported in Blacks, Hispanics, and Japanese, whereas C8bD has
been reported primarily in Caucasians (19 –21). Molecular defects
leading to inherited deficiencies of C8b as well as the other components of MAC such as C5, C6, C7, and C9 have been described
recently (22–29). However, defects causing C8a-gD have not been
reported as yet. In the present study, we investigated the genetic
basis of C8a-gD in two unrelated Japanese subjects, using exonspecific PCR/single-strand conformation polymorphism (SSCP)
analysis of C8a and C8g genes (30), followed by direct DNA
sequencing anomalously migrating exons to identify mutations.
Although there were no mutations detected in the C8g gene by this
method in either case, a homozygous (case 1) and a compound
heterozygous mutation (case 2) were identified in the C8a gene. A
homozygous G to T transversion in the exon 2/intron 2 splice
junction (IVS211G3 T) of the C8a gene that would cause splicing error was detected in case 1. In case 2, a heterozygous mutation
identical with that of case 1 as well as a heterozygous C to T
transition in exon 9 at the first nucleotide of CGA codon for Arg394
(R394X) of the C8a gene were detected.
Materials and Methods
C8a-gD subjects
Two unrelated individuals were included in this study. Case 1 was a 63yr-old Japanese male who was admitted to Okayama University Hospital
(Okayama, Japan) with macrocytic hyperchromic anemia. He had inactive
pulmonary tuberculosis and ulcerative colitis. Total hemolytic activity
0022-1767/98/$02.00
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
Deficiency of the a-g subunit of the eighth component of complement (C8a-gD) is frequently associated with recurrent neisserial
infections, especially meningitis caused by Neisseria meningitidis. We here report the molecular basis of C8a-gD in two unrelated
Japanese subjects. Screening all 11 exons of the C8a gene and all 7 exons of the C8g gene and their boundaries by exon-specific
PCR/single-strand conformation polymorphism demonstrated aberrant single-stranded DNA fragments in exon 2 of C8a gene in
case 1 and in exons 2 and 9 of C8a gene in case 2. Nucleotide sequencing of the amplified DNA fragments in case 1 revealed a
homozygous single-point mutation at the second exon-intron boundary, inactivating the universally conserved 5* splice site consensus sequence of the second intron (IVS211G3 T). Case 2 was a compound heterozygote for the splice junction mutation,
IVS211G3 T, and a nonsense mutation at Arg394 (R394X). R394X was caused by a C to T transition at nucleotide 1407, the first
nucleotide of the codon CGA for Arg394, leading to a stop codon TGA. No mutations were detected in the C8g gene by our method.
Our results indicate that the pathogenesis of C8a-gD might be caused by heterogeneous molecular defects in the C8a gene. The
Journal of Immunology, 1998, 161: 3762–3766.
The Journal of Immunology
3763
Table I. Primer sequences for the analysis of C8a gene
Exons
Start
(bp)a
59 Oligonucleotide Sequence
(59 to 39)
Start
(bp)b
39 Oligonucleotide Sequence
(59 to 39)
Fragment Size
(bp)
1
2
3
4
5
6
7
8
9
10
11
227
223
268
228
248
226
229
226
247
245
236
GGGTGAGTTTCCAACATCAGA
GCATGGATCTTCCCTTTCTT
GCTGCACAAGTCTTGGTTGA
AGGAGCAGCCACAGTCTCTT
AAAACCCAGCATCCACTAGC
CTAATATCTATCCTTT
TTGCTTTATTCAATGGCGGT
TGTGTTTCTCTGTCTCCCTG
GGGCTTTTTGGGAAATGAGT
TAGATAGAGCCCAGGGAGGG
GCTAACCTTCTCCTCCCTGG
150
125
146
145
140
123
156
138
150
148
1129c
ACCAGGTGATTCCTACGTGC
CCCAAACCGGTTGTAAGTGT
TCACTTTTGACAGGCACAGC
GACAAATCATTCCCTGCTCC
TACACCACAGTGGCCTCAGA
ACACAGACCTTATGT
CCATGACCTGGTGTCTGTGT
ATCCATCACCTTTGCCAGAT
ACTTTCATTCCTCATGGACG
CTTTGAGCTGGGACAGGCT
GGAAGCTGGCAGAACAAAGA
250
142
259
221
278
250
326
190
255
316
317
a
The 59 site of the oligonucleotide was defined as N bp upstream (2N) from the 59 site of the exon.
The 59 site of the oligonucleotide was defined as N bp downstream (1N) from the 39 site of the exon except in the case of exon 11.
c
The 59 site of the oligonucleotide was defined as N bp downstream (1N) from the TGA (stop) codon.
b
polymerase in a 25-ml total reaction volume. Reaction products were purified by Microcon 100 (Amicon, Beverly, MA) and directly sequenced
using the Amplicycle sequencing kit (Perkin-Elmer/Cetus) and radiolabeled primers according to the manufacturer’s instructions. Primers were
labeled using T4 polynucleotide kinase (New England Biolabs, Beverly,
MA) and [g-32P]ATP (ICN) at 37°C for 20 min.
Results
Detection of C8a and C8g gene mutation by PCR/SSCP
analysis
The primers for exon-specific PCR for all 11 exons of the C8a gene and all
7 exons of the C8g gene were synthesized on the basis of the flanking
intronic sequences (31, 32) and are listed in Table I and Table II. Genomic
DNA was purified from PBMC as previously described (33). Exon-specific
PCR was conducted using 50 ng of genomic DNA as template, 0.2 mM of
each primer, 25 mM dNTP including 2 mCi [a-32P]dCTP (ICN, Irvine,
CA), and 0.125 U Taq polymerase in a 5-ml total reaction volume. Thirty
cycles consisting of 1 min at 94°C and 2 min at 60°C were conducted using
a thermal cycler PJ2000 (Perkin-Elmer/Cetus, Norwalk, CT). The PCR
products were subjected to electrophoresis on 5% nondenaturing acrylamide gels at 4°C without glycerol or at 25°C containing 5% glycerol,
using 45 mM Tris-borate and 1 mM EDTA buffer, pH 8.3, at 13 V/cm.
DNA fragments were visualized by exposing the gels to Fuji RX5 film
(Fuji, Kanagawa, Japan).
SSCP analysis of all 11 C8a exon-specific PCR fragments resulted
in the detection of aberrant bands in exon 2 of case 1 and in exons
2 and 9 of case 2. As shown in Figure 1a, the exon 2-specific PCR
fragments of case 1 displayed two bands at 4°C without glycerol
migrating differently from those of the C8-sufficient control run in
parallel. Case 2 displayed the mixed pattern of case 1 and the
control. Additionally, in case 2 the exon 9-specific PCR fragments
displayed three bands at 4°C without glycerol, one of which migrated differently from those of C8-sufficient controls (Fig. 1b).
Analysis of the PCR fragments of the C8 deficiency cases at 25°C
with glycerol did not show any difference compared with those of
controls (data not shown). These results suggest that in case 1, a
homozygous C8a gene mutation, resides in exon 2, while in case
2 a compound heterozygous mutation exists in exons 2 and 9. No
other aberrant bands were detected in any other exons of the C8a
and C8g genes in either of the C8a-gD cases.
Genomic DNA sequencing of PCR fragments
Determination of the splice junction mutation in intron 2
DNA fragments of interest were excised from PCR/SSCP acrylamide gels,
purified on SUPREC-01 columns (Takara Shuzo, Otsu, Japan), and reamplified by PCR reagent kit (Perkin-Elmer/Cetus), according to the manufacturer’s instructions, for 20 cycles consisting of 1 min at 95°C and 2 min
at 60°C by using 2 mM of each primer, 200 mM dNTP, and 0.625 U Taq
The DNA fragment detected by PCR/SSCP analysis of C8a exon
2 from case 1 (Fig. 1a, fragment a) as well as the DNA fragment
from a control (Fig. 1a, fragment b) were directly sequenced in its
entirety. The nucleotide sequence was identical with that reported
PCR/SSCP analysis
Table II. Primer sequences for the analysis of C8g gene
Exons
Start
(bp)a
59 Oligonucleotide Sequence
(59 to 39)
Start
(bp)b
39 Oligonucleotide Sequence
(59 to 39)
Fragment Size
(bp)
1
2
3
4
5
6, 7
246c
228
267
252
280
246
TGCTACCCTTGGCCTCC
CTCGAGTTCTCCCATGGTCT
TGTGGCCTGGACTAGGATTC
GGATGACGCAGCCACTGT
CAGGGGACACACAGACCC
CACTCTCTGGCTGATGTCCA
1168
1111
175
196
168
1103d
CAGACCATGGGAGAACTCG
GAATCCTAGTCCAGGCCACA
GCCACAGTAGCCATGTCAGA
AGTGTGTCCCCATGGCTC
AGGGGTCAGGCTGGACAT
CCTGATCTGAGGCTGGTTTC
352
276
213
256
250
281
a
The 59 site of the oligonucleotide was defined as N bp upstream (2N) from the 59 site of the exon except in the case of exon 1.
The 59 site of the oligonucleotide was defined as N bp downstream (1N) from the 39 site of the exon except in the case of exon 6, 7.
The 59 site of the oligonucleotide was defined as N bp upstream (2N) from the ATG (initiation) codon.
d
The 59 site of the oligonucleotide was defined as N bp downstream (1N) from the TGA (stop) codon.
b
c
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
(CH50) was undetectable, and a subsequent analysis of complement components revealed that C8 protein was also undetectable in his serum (,0.5
mg/dl) by single radial immunodiffusion assay. Total hemolytic activity
was restored to 75% of the normal range by adding purified C8, but not by
adding serum from a C8a-gD patient. Case 2 was a 42-yr-old Japanese
female who was found to be C8a-gD during a large scale screening for
inherited deficiencies of late acting complement components among
healthy blood donors in Osaka, Japan (21). The serum C8 concentration in
case 2 was below the detectable level either by hemolytic assay for C8
activity or by single radial immunodiffusion assay. The C8 hemolytic activity of case 2 was effectively restored by the addition of the purified
C8a-g subunit (21). Therefore, these two cases were classified as C8a-gD.
They had no history of meningitis or systemic neisserial infections. We
were unable to perform family studies in either case.
3764
GENETIC BASIS OF HUMAN COMPLEMENT C8a-g DEFICIENCY
quence of fragment a revealed C to T transition at nucleotide 1407
(Fig. 3a). Nucleotide 1407 is the first nucleotide of the codon CGA
for Arg394 of the C8a gene. The C to T transition generates a
termination codon, TGA, which would cause the truncation of the
encoded C8a protein (Fig. 3b).
Discussion
previously (30), except that nucleotide 30811 was a T instead of
a G (IVS211G3 T; Fig. 2a). Nucleotide 30811 is the first nucleotide of the C8a intron 2. The G to T transversion in intron 2
(IVS211G3 T) would cause the truncation of the C8a protein by
a splicing error (Fig. 2b). Direct sequencing of the C8a exon 2
showed that case 2 was heterozygous for the mutation
IVS211G3 T that was identified in case 1 (data not shown).
Determination of the mutation in exon 9
Two single-stranded DNA fragments detected by PCR/SSCP analysis of the C8a exon 9 (Fig. 1b, fragments a and b) from case 2
were isolated from the gel and sequenced in their entirety. The
nucleotide sequence of fragment b was identical with the corresponding sequence of the normal C8a gene. The nucleotide se-
FIGURE 2. Definition of C8a-intron 2 mutation in cases 1 and 2. a,
Partial nucleotide sequences of the SSCP bands. The sequences of fragment b from Figure 1a is identical with the corresponding sequence of the
normal C8a gene. Fragment a from Figure 1a displays G to T transversion
in exon 2/intron 2 splicing junction (IVS211G3 T). b, Nucleotide sequence and deduced amino acid sequence (one-letter code) around the
IVS211G3 T mutation. This mutation destroys the highly conserved sequence at the 59 splice site of intron 2 of C8a gene.
We describe here the molecular basis of C8a-gD in two unrelated
Japanese subjects. This is the first description of the molecular
defects leading to C8a-gD. A homozygous splice junction mutation in the first case and a compound heterozygous mutation in the
second case consisting of the same splice mutation and a nonsense
mutation were shown to be the causes of the deficiency.
C8D appears to have an ethnic predominance. The C8bD is
exclusively identified in Caucasians, whereas C8a-gD has been
found mostly in non-Caucasians (19 –21). A review of complement deficiencies published in 1984 described 31 C8D individuals
in 22 kindreds (19). Twelve of the 31 C8D subjects had one or
more episodes of meningococcal disease. Among the 31 C8D
subjects, six individuals in five kindreds (four Blacks and one
Hispanic) were confirmed to be C8a-gD. In Japan, four C8a-gD
individuals, one of whom was case 2 in the present study, were
identified among sera from 145,640 healthy blood donors in
Osaka (21).
To identify the molecular defects causing C8a-gD we adapted a
two-step procedure with PCR-SSCP analysis as a first step followed
by a second step of sequencing the aberrant bands. In the first step, all
11 exons of the C8a and the 7 exons of the C8g gene were amplified
by PCR, and the resulting DNA fragments were analyzed by SSCP.
This approach enabled us to detect target exons and avoid sequencing
the entire coding region of the C8a and C8g genes of the deficient
individuals. The strategy provides a rapid, sensitive, and simple
method to investigate the whole coding region of genes and has
been successfully used by our group for the molecular analysis
of C6-, C7-, and C9-deficient individuals (24, 25, 29).
We have identified a possible RNA splicing defect in both cases.
The mutation is a single-base G to T transversion destroying the
highly conserved sequence at the 59 splice site of intron 2 of the
C8a gene. Since the G at position 11 of the splice site sequence
is completely conserved in eukaryotes (34), this mutation undoubtedly affects maturation of RNA. A widely accepted model for vertebrate pre-mRNA splicing proposed that exons are recognized
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
FIGURE 1. PCR/SSCP analysis of C8a-gD individuals. a, Exon-specific PCR/SSCP for exon 2 using genomic DNA from case 1 (lane 1), case
2 (lane 2), and a C8-sufficient control (lane C). b, Exon-specific PCR/SSCP
for exon 9 using genomic DNA from case 1 (lane 1), case 2 (lane 2), and
C8-sufficient control (lane C). Electrophoresis was performed in 5% polyacrylamide gel without glycerol at 4°C. Aberrantly migrating DNA fragments (fragment a) as well as those from the normal control (fragment b)
were purified separately from the gel, amplified by PCR, and subjected to
nucleotide sequencing.
FIGURE 3. Definition of the C8a-exon 9 mutation in case 2. a, Partial
nucleotide sequences of the SSCP bands. The sequence of fragment b from
Figure 1b is identical with the corresponding sequence of the normal C8a
gene. Fragment a from Figure 1b displays C to T transition at nucleotide
1407. b, Nucleotide sequence and deduced amino acid sequence (one-letter
code) around the mutation. The translated C8a protein is truncated at
amino acid residue 394 that is different from that of the native protein.
The Journal of Immunology
FIGURE 4. Schematic diagram of the molecular structure of normal
C8a (adapted from Ref. 9) and the positions of mutations in cases 1 and 2.
Modules are designated, according to the recommendations of a recent
workshop (53), as follows: T1, thrombospondin, type 1; LA, low density
lipoprotein receptor, type A; EG, epidermal growth factor.
References
1. Müller-Eberhard, H. J. 1986. The membrane attack complex of complement.
Annu. Rev. Immunol. 4:503.
2. Steckel, E. W., R. G. York,, J. B. Monahan, and J. M. Sodetz. 1980. The eighth
component of human complement: purification and physicochemical characterization of its unusual subunit structure. J. Biol. Chem. 255:11997.
3. Alper, C. A., D. Marcus, D. Raum, B. H. Petersen, and T. J. Spira. 1983. Genetic
polymorphism in C8 b-chains: evidence for two unlinked genetic loci for the
eighth component of human complement (C8). J. Clin. Invest. 72:1526.
4. Raum, D., M. A. Spence, D. Balavitch, S. Tideman, A. D. Merritt, R. T. Taggart,
B. H. Petersen, N. K. Day, and C. A. Alper. 1979. Genetic control of the eighth
component of complement. J. Clin. Invest. 64:858.
5. Rittner, C., W. Hargesheimer, and E. Mollenhauer. 1984. Population and formal
genetics of human C81 (a-g) polymorphism. Hum. Genet. 67:166.
6. Theriault, A., E. Boyd, K. Whaley, J. M. Sodetz, and J. M. Connor. 1992. Regional chromosomal assignment of genes encoding the a and b subunits of human complement protein C8 to 1p32. Hum. Genet. 88:703.
7. Rogde, S., B. Olaisen, T. Gedde-Dahl, Jr., and P. Teisberg. 1986. The C8A and
C8B loci are closely linked on chromosome 1. Annu. Hum. Genet. 50:139.
8. Kaufman, K. M., J. V. Snider, N. K. Spurr, C. E. Schwartz, and J. M. Sodetz.
1989. Chromosomal assignment of genes encoding the a, b, and g subunits of
human complement protein C8: identification of a close physical linkage between
the a and the b loci. Genomics 5:475.
9. Hobart, M. J., B. A. Fernie, and R. G. DiScipio. 1995. Structure of the human C7
gene and comparison with the C6, C8A, C8B, and C9 genes. J. Immunol. 154:
5188.
10. Haefliger, J. A., D. Jenne, K. K. Stanley, and J. Tschopp. 1987. Structural homology of human complement component C8g and plasma protein HC: identity
of the cysteine bond pattern. Biochem. Biophys. Res. Commun. 149:750.
11. Rao, A. G., O. M. Howard, S. C. Ng, A. S. Whitehead, H. R. Colten, and
J. M. Sodetz. 1987. Complementary DNA and derived amino acid sequence of
the a subunit of human complement protein C8: evidence for the existence of a
separate a subunit messenger RNA. Biochemistry 26:3556.
12. Brickner, A., and J. M. Sodetz. 1984. Function of subunits within the eighth
component of human complement: selective removal of the g chain reveals it has
no direct role in cytolysis. Biochemistry 23:832.
13. Stewart, J. L., and J. M. Sodetz. 1985. Analysis of the specific association of the
eighth and ninth components of human complement: identification of a direct role
for the a subunit of C8. Biochemistry 24:4598.
14. Monahan, J. B., and J. M. Sodetz. 1981. Role of the b subunit in interaction of
the eighth component of human complement with the membrane-bound cytolytic
complex. J. Biol. Chem. 256:3258.
15. Kolb, W. P., and H. J. Müller-Eberhard. 1976. The membrane attack mechanism
of complement: the three polypeptide chain structure of the eighth component
(C8). J. Exp. Med. 143:1131.
16. Fijen, C. A., E. J. Kuijper, A. J. Hannema, A. G. Sjöholm, and J. P. van Putten.
1989. Complement deficiencies in patients over ten years old with meningococcal
disease due to uncommon serogroups. Lancet ii:585.
17. Tedesco, F., P. Densen, M. A. Villa, B. H. Petersen, and G. Sirchia. 1983. Two
types of dysfunctional eighth component of complement (C8) molecules in C8
deficiency in man: reconstitution of normal C8 from the mixture of two abnormal
C8 molecules. J. Clin. Invest. 71:183.
18. Di Ninno, V. L., and V. K. Chenier 1981. Activation of complement by neisseria
meningitidis. FEMS Microbiol. Lett. 12:55.
19. Ross, S. C., and P. Densen. 1984. Complement deficiency states and infection:
epidemiology, pathogenesis and consequences of neisserial and other infections
in an immune deficiency. Medicine 63:243.
20. Tedesco, F. 1986. Component deficiencies. 8. The eighth component. Prog. Allergy 39:295.
21. Inai, S., Y. Akagaki, T. Moriyama, Y. Fukumori, K. Yoshimura, S. Ohnoki, and
H. Yamaguchi. 1989. Inherited deficiencies of the late-acting complement components other than C9 found among healthy blood donors. Int. Arch. Allergy
Appl. Immunol. 90:274.
22. Wang, X., D. T. Fleischer, W. T. Whitehead, D. L. Haviland, S. I. Rosenfeld,
J. P. Leddy, R. Snyderman, and R. A. Wetsel. 1995. Inherited human complement
C5 deficiency: nonsense mutations in exons 1 (Gln1 to stop) and 36 (Arg1458 to
stop) and compound heterozygosity in three African-American families. J. Immunol. 154:5464.
23. Würzner, R., M. J. Hobart, B. A. Fernie, D. Mewar, P. C. Potter, A. Orren, and
P. J. Lachmann. 1995. Molecular basis of subtotal complement C6 deficiency: a
carboxy-terminally truncated but functionally active C6. J. Clin. Invest. 95:1877.
24. Nishizaka, H., T. Horiuchi, Z.-B. Zhu, Y. Fukumori, K. Nagasawa, K. Hayashi,
R. Krumdieck, C. G. Cobbs, M. Higuchi, S. Yasunaga, Y. Niho, and
J. E. Volanakis. 1996. Molecular bases for inherited human complement component C6 deficiency in two unrelated individuals. J. Immunol. 156:2309.
25. Nishizaka, H., T. Horiuchi, Z.-B. Zhu, Y. Fukumori, and J. E. Volanakis. 1996.
Genetic bases of human complement C7 deficiency. J. Immunol. 157:4239.
26. Kaufmann, T., G. Hänsch, C. Rittner, P. Späth, F. Tedesco, and P. M. Schneider.
1993. Genetic basis of human complement C8b deficiency. J. Immunol. 150:
4943.
27. Saucedo, L., L. Ackermann, A. E. Platonov, A. Gewurz, R. M. Rakita, and
P. Densen. 1995. Delineation of additional genetic bases for C8b deficiency:
prevalence of null alleles and predominance of C3 T transition in their genesis.
J. Immunol. 155:5022.
28. Witzel-Schlömp, K., P. J. Späth, M. J. Hobart, B. A. Fernie, C. Rittner,
T. Kaufmann, and P. M. Schneider. 1997. The human complement C9 gene:
identification of two mutations causing deficiency and revision of the gene structure. J. Immunol. 158:5403.
29. Horiuchi, T., H. Nishizaka, T. Kojima, T. Sawabe, Y. Niho, P. M. Schneider,
S. Inaba, K. Sakai, K. Hayashi, C. Hashimura, and Y. Fukumori. 1998. A nonsense mutation at Arg95 is predominant in complement 9 deficiency in Japanese.
J. Immunol. 160:1509.
30. Hayashi, K. 1991. PCR-SSCP: a simple and sensitive method for detection of
mutations in the genomic DNA. PCR Methods Appl. 1:34.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
and defined as units during early assembly by binding of splicing
factors to the 39 end of the preceding intron, followed by a search
for a suitable 59 donor site sequence, (C/A)AG:GT(A/G)AGT (the
colon denotes the site of cleavage) (35–37). A point mutation at the
59 splice site at IVS211 results in two aberrant splicing patterns.
The first is the activation of cryptic sites either upstream in the
exon or downstream in the intron, which are ignored when the
authentic splice site is present (38, 39). Such junctional abnormalities are reported in many disorders, such as b-thalassemia (39),
human cystic fibrosis (40), and muscle phosphofructokinase deficiency (41). The second pattern is exon skipping. The exon adjacent to the mutation is not recognized by the splicing factors involved in splice site selection. Exon skipping occurs if no suitable
new 59 donor site can be identified by the spliceosome complex
within approximately 300 bp downstream of the 39 site (42). An
exon-skipping phenotype has also been demonstrated in many
cases of naturally occurring mutations (43– 48). As C8a transcripts
were not identified in PBMC from healthy controls or the C8D
individuals (our unpublished observation), we were unable to analyze the aberrant transcripts caused by the mutation,
IVS211G3 T. Another single molecular defect identified in case
2 was a heterozygous C to T transition at the first nucleotide of the
codon for Arg394 in exon 9. The mutation resulted in the generation of a termination codon. Nonsense mutations in human disease
genes frequently cause severe reduction in mRNA levels and even
when normally transcribed, truncated proteins are quickly degraded (49 –52). Even if translated, the mutant C8a gene encodes
a polypeptide lacking the carboxyl-terminal 29% of the molecular
size. As shown in Figure 4, this putative mutant C8a polypeptide
in case 2 would be missing the perforin region, the epidermal
growth factor-like region, and the thrombospondin region. In our
two cases, no mutations were detected in the C8g gene by our
method. This would be consistent with the report that the g subunit
has no direct role in the hemolytic activity of C8 (12). In conclusion, our result provides evidence that like most other complement
deficiencies, C8a-gD is caused by heterogeneous mutational
events.
3765
3766
GENETIC BASIS OF HUMAN COMPLEMENT C8a-g DEFICIENCY
44. Marvit, J., A. G. DiLella, K. Brayton, F. D. Ledley, K. J. Robson, and S. L. Woo.
1987. GT to AT transition at a splice donor site causes skipping of the preceding
exon in phenylketonuria. Nucleic Acids Res. 15:5613.
45. Kudo, S., and M. Fukuda. 1989. Structural organization of glycophorin A and B
genes: glycophorin B gene evolved by homologous recombination at Alu repeat
sequences. Proc. Natl. Acad. Sci. USA 86:4619.
46. Urlaub, G., P. J. Mitchell, C. J. Ciudad, and C. J. Chasin. 1989. Nonsense mutations in the dihydrofolate reductase gene affect RNA processing. Mol. Cell.
Biol. 9:2868.
47. Weil, D., M. Bernard, N. Combates, M. K. Wirtz, D. W. Hollister, B. Steinmann,
and F. Ramirez. 1988. Identification of a mutation that causes exon skipping
during collagen pre-mRNA splicing in an Ehlers-Danlos syndrome variant.
J. Biol. Chem. 263:8561.
48. Raben, N., J. Sherman, F. Miller, H. Mena, and P. Plotz. 1993. A 59 splice
junction mutation leading to exon deletion in an Ashkenazic Jewish family with
phosphofructokinase deficiency (Tarui disease). J. Biol. Chem. 268:4963.
49. Losson, R., and F. Lacroute. 1979. Interference of nonsense mutations with eukaryotic messenger RNA stability. Proc. Natl. Acad. Sci. USA 76:5134.
50. Urlaub, G., P. J. Mitchell, C. J. Ciudad, and L. A. Chasin. 1989. Nonsense mutation in the dihydrofolate reductase gene affect RNA processing. Mol. Cell. Biol.
9:2868.
51. Naeger, L. K., R. V. Schoborg, Q. Zhao, G. E. Tullis, and D. J. Pintel. 1992.
Nonsense mutations inhibit splicing of MVM RNA in cis when they interrupt the
reading frame of either exon of the final spliced product. Genes Dev. 6:1107.
52. Helenius, A., T. Marquardt, and I. Braakman. 1992. The endoplasmic reticulum
as a protein-folding compartment. Trends Cell Biol. 2:227.
53. Doolittle, R. F. 1995. The multiplicity of domains in proteins. Annu. Rev. Biochem. 64:287.
Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017
31. Michelotti, G. A., J. V. Snider, and J. M. Sodetz. 1995. Genomic organization of
human complement protein C8a and further examination of its linkage to C8b.
Hum. Genet. 95:513.
32. Kenneth, M. K., and J. M. Sodetz. 1994. Genomic structure of human complement protein C8g: homology to the lipocalin gene family. Biochemistry 33:5162.
33. Horiuchi, T., K. J. Macon, V. J. Kidd, and J. E. Volanakis. 1989. cDNA cloning
and expression of human complement component C2. J. Immunol. 142:2105.
34. Horowitz, D. S., and A. R. Krainer. 1994. Mechanisms for selecting 59 splice sites
in mammalian pre-mRNA splicing. Trends Genet. 10:100.
35. Robertson, B. L., G. J. Cote, and S. M. Berget. 1990. Exon definition may facilitate splice site selection in RNAs with multiple exons. Mol. Cell. Biol. 10:84.
36. Penotti, F. E. 1991. Human pre-mRNA splicing signals. J. Theor. Biol. 150:385.
37. Iida, Y. 1990. Quantification analysis of 59-splice signal sequences in mRNA
precursors: mutations in 59-splice signal sequence of human b-globin gene and
b-thalassemia. J. Theor. Biol. 145:523.
38. Padgett, R. A., S. M. Grabowski, M. M. Konarski, S. Seiler, and P. A. Sharp.
1986. Splicing of messenger RNA precursors. Annu. Rev. Biochem. 55:1119.
39. Kazazian, H. H., Jr. 1990. The thalassemia syndromes: molecular basis and prenatal diagnosis in 1990. Semin. Hematol. 27:209.
40. Jones, C. T., I. McIntosh, M. Keston, A. Ferguson, and D. J. Brock. 1992. Three
novel mutations in the cystic fibrosis gene detected by chemical cleavage: analysis of variant splicing and a nonsense mutation. Hum. Mol. Genet. 1:11.
41. Nakajima, H., N. Kono, T. Yamasaki, K. Hotta, M. Kawachi, M. Kuwajima,
T. Noguchi, T. Tanaka, and S. Tarui. 1990. Genetic defect in muscle phosphofructokinase deficiency: abnormal splicing of the muscle phosphofructokinase
gene due to a point mutation at the 59-splice site. J. Biol. Chem. 265:9392.
42. Talerico, M., and S. M. Berget. 1990. Effect of 59 splice site mutations on splicing
of the preceding intron. Mol. Cell. Biol. 10:6299.
43. Carstens, R. P., W. A. Fenton, and L. R. Rosenberg. 1991. Identification of RNA
splicing errors resulting in human ornithine transcarbamylase deficiency.
Am. J. Hum. Genet. 48:1105.