Download Identification of Mga1, a G‐protein α‐subunit gene involved in

RESEARCH LETTER
Identi¢cation of Mga1, a G-protein a-subunit gene involved in
regulating citrinin and pigment production in Monascus ruber M7
Li Li1, Yanchun Shao1,2, Qi Li1, Sha Yang1 & Fusheng Chen1,2,3
1
College of Food Science and Technology, Huazhong Agricultural University, Hubei Province, China; 2National Key Laboratory of Agro-Microbiology,
Huazhong Agricultural University, Hubei Province, China; and 3Key Laboratory of Food Safety Evaluation of Ministry of Agriculture, Huazhong
Agricultural University, Hubei Province, China
Correspondence: Fusheng Chen, College of
Food Science and Technology, Huazhong
Agricultural University, Wuhan 430070,
Hubei Province, China. Tel./fax: 186 27 8728
2927; e-mail: [email protected]
Received 28 February 2010; revised 13 April
2010; accepted 13 April 2010.
Final version published online 25 May 2010.
DOI:10.1111/j.1574-6968.2010.01992.x
Editor: Richard Staples
MICROBIOLOGY LETTERS
Keywords
Monascus ruber; citrinin; pigment; G-protein
a-subunit.
Abstract
The filamentous fungi Monascus spp., which have been used in traditional
fermented food in Asia for centuries, are well-known producers of a group of
bioactive metabolites that are widely used as food additives and nutraceutical
supplements worldwide. However, its potential to produce the mycotoxin citrinin
poses a threat to food safety. Here, a G-protein a-subunit-encoding gene, Mga1
(Monascus G-protein alpha-subunit 1), which encodes a protein showing a high
degree of identity to Group I a-subunits of fungal heterotrimeric G-proteins, was
cloned from Monascus ruber M7. An Mga1-disrupted strain was obtained by
homologous recombination. The disruptant produced approximately nine times
more citrinin and 71% more pigments than the wild-type strain M7, indicating
that the G-protein a-subunit encoded by Mga1 is involved in a signal transduction
pathway regulating citrinin and pigment biosynthesis in M. ruber M7.
Introduction
Monascus spp. are mainly used for the production of red
fermented rice (RFR), which has been used extensively for
more than 1000 years as a food colorant and food preservative for meat and fish, as a folk medicine to promote
cardiovascular health, as well as fermentation starters to
brew rice wine and vinegar in Asia (Chen & Hu, 2005; Lin
et al., 2008). Nowadays, Monascus-related products are
being diversified and distributed worldwide due to the
identification of abundant economic metabolites produced
by Monascus spp., including cholesterol-lowering agents
(monacolins), an antihypertensive substance (g-aminobutyric acid) and an antioxidant (dimerumic acid) (Aniya
et al., 2000; Lin et al., 2008; Pattanagul et al., 2008).
However, the problem of safety emerged in 1995 when Blanc
et al. (1995a) identified monascidin A, an antibacterial
compound in RFR, as a nephrotoxic metabolite, citrinin.
Thus, control of the production of citrinin is essential to
increase the safety of Monascus-related products and extend
their applications. In the past decade, researchers have made
considerable progress towards improving Monascus-related
products using a process of optimization and traditional
2010 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
mutation breeding methods (Wang et al., 2004; Chen & Hu,
2005; Sayyad et al., 2007). Recently, some biosynthetic gene
clusters involved in the biosynthesis of secondary metabolites of Monascus spp., such as citrinin and monacolin K,
have been identified (Shimizu et al., 2007; Chen et al.,
2008b). Based on the genetic information, a genetic modification method has also been proposed (Fu et al., 2007; Jia
et al., 2010).
Secondary metabolite production is controlled at an
upper hierarchical level by many global mechanisms, in
which many proteins encoded by genes not linked to the
biosynthetic gene clusters are also involved in modulating fungal secondary metabolism, such as transcription factor, histone deacetylase, DNA methyltransferase,
signalling proteins such as MAP kinases and cAMPdependent protein kinase (Fox & Howlett, 2008). Heterotrimeric G-proteins, acting within G-protein signalling
pathways to regulate multiple physiological processes and
that generally respond to environmental cues such as pH,
temperature and nutrition, are also found to be involved in
the regulation of secondary metabolite production in some
toxigenic fungi (Hicks et al., 1997; Seo & Yu, 2006; Yu et al.,
2008).
FEMS Microbiol Lett 308 (2010) 108–114
109
Mga1 related to safety of Monascus products
Heterotrimeric G-proteins consist of three subunits:
Ga, Gb and Gg. They function as ‘molecular switches’ in
G-protein signalling pathways to regulate the duration and
intensity of the signal, eventually going on to regulate
downstream cell processes. Most characterized filamentous
fungi possess three Ga proteins belonging to three distinct
groups, Groups I, II and III, of which Group I is the most
extensively studied (Li et al., 2007). Accumulating evidence
has suggested that individual Group I Ga protein regulates
multiple pathways. For example, dominant activating mutations in fadA in Aspergillus nidulans blocked both sterigmatocystin production and asexual sporulation, and the
deletion of GzGPA1 in Gibberella zeae resulted in female
sterility and enhanced deoxynivalenol and zearalenone
production (Hicks et al., 1997; Yu et al., 2008).
While substantial basic knowledge regarding the functional role of G-proteins has been gained from other fungi,
especially model filamentous fungi and pathogenic fungi,
our understanding of the biological significance of these
components in fermentation fungi is very limited (GarciaRico et al., 2007; Shao et al., 2009). A close phylogenetic
relationship, in the same class of secondary metabolites
belonging to polyketides, such as pigments, monacolins
and citrinin, was found between Monascus spp. and other
filamentous fungi, for example Penicillium and Aspergillus
spp.; therefore, we could anticipate similar, but more diverse
functions in the aspects of growth, development and
production of secondary metabolites for G-proteins in
Monascus spp., which might have implications for the
handling and control of this group of beneficial microorganisms in fermentation.
Materials and methods
Fungal strains and growth conditions
Monascus ruber wild-type strain M7 (Chen & Hu, 2005) was
used to clone the Ga-subunit gene and generate the Mga1
knockout strains. All strains were maintained on potato
dextrose agar (PDA) media at 28 1C. If required, hygromycin
B was added to a concentration of 30 mg mL1. For phenotypic characterization, conidial suspensions were prepared
on G25N agar medium and used as an inoculum, due
to the lack of sporulation of Mga1 deletion strains on
PDA. For liquid fermentation, a 1% spore suspension
(105 spores mL1) was inoculated in yeast extract sucrose
(YES) medium and incubated at 28 1C without agitation
(Blanc et al., 1995b).
DNA extraction and Southern hybridization
Fungal genomic DNA was isolated from mycelium grown on
cellophane membranes covering PDA plates using the
cetyltrimethylammonium bromide method (Shao et al.,
FEMS Microbiol Lett 308 (2010) 108–114
2009). Southern blot assays were performed using the DIGHigh Prime DNA Labeling & Detection Starter kit I (Roche,
Germany).
Cloning of the Mga1 gene
The procedure for amplifying the Ga-subunit gene is shown
in Fig. 1a. The degenerate primer set GAF/GAR (Table 1)
was designed based on conserved regions of various known
fungal homologues. The optimal annealing temperature was
determined by gradient PCR. PCR products of the predicted
size were cloned into pMD18-T (Takara, Japan) and sequenced. The sequences thus obtained were compared with
the GenBank database using the BLAST program (http://blast.
ncbi.nlm.nih.gov/Blast.cgi).
The 5 0 and 3 0 flanking regions of the corresponding Gasubunit gene fragment were amplified by single oligonucleotide nested (SON)-PCR (Antal et al., 2004). The inner and
outer primers of nested PCR for SON-PCR are listed in
Table 1.
Deletion of the Mga1 gene
For target gene deletion, a gene disruption construct, carrying a hygromycin B resistance gene (hph) flanked by DNA
sequences homologous to the sequences located at the 5 0 and
3 0 ends of Mga1 ORF, was amplified using the double-joint
PCR method (Fig. 2a) (Yu et al., 2004). Briefly, the 5 0 and 3 0
flanking regions (648 and 884 bp, respectively) of Mga1 ORF
were amplified with the primer pairs mgaK5f/mgaK5r and
mgaK3f/mgaK3r, respectively (Table 1). The 2.1 kb hph
marker cassette was amplified from the vector pSKH with
the primer pair hphF/hphR, containing XbaI- and XhoIrestricted sites, respectively (Table 1). The three amplicons
(the 5 0 and 3 0 regions, and the hph cassette) were mixed at a
1 : 1 : 2 molar ratio for the fusion reaction, and used as a
template for a second round of PCR with the primers
mgaK5f and mgaK3r. The fused disruption construct products were restricted with XbaI and XhoI and cloned into
the XbaI/XhoI sites of the binary Ti vector pCAMBIA3300
to generate plasmid pCMGA1. The plasmid pCMGA1 was
transformed to Agrobacterium tumefaciens EHA105 using
the freeze–thaw method. The transformed A. tumefaciens
was then used to carry out A. tumefaciens-mediated transformation of M. ruber M7 as described by Shao et al. (2009).
Citrinin and pigment analysis
The fermented broth was filtered using a filter paper. The
filtrate was extracted with an equal volume of toluene-ethyl
acetate-formic acid (7 : 3 : 1 by volume). After centrifuging
at 9724 g for 10 min, the organic phase was collected to
analyze the citrinin concentration by HPLC. HPLC was
performed on a Waters system fitted with a Phenomenex
2010 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
110
L. Li et al.
Fig. 1. Cloning of Ga-subunit gene Mga1. (a) Scheme for amplifying the Ga-subunit gene. The ORF of Mga1, as well as its transcription direction, is
indicated by a gray arrow. GAF and GAR are degenerate primers designed to amplify the conserved region of the Ga-subunit gene; A51 and A52 are
nested SON-PCR primers to amplify the 5 0 end; A31 and A32 are nested SON-PCR primers to amplify the 3 0 end. The location of each primer is indicated
by a vertical arrow. (b) Analysis of PCR products by agarose gel electrophoresis. The arrows show the fragments that were cloned and sequenced. DPPCR, degenerate primer PCR; lane 1, first-round SON-PCR products; lane 2, second-round SON-PCR products. (c) Southern blot analysis of the copy
number of Mga1 in the genome of Monascus ruber M7. Genomic DNA was digested with the restriction enzymes indicated above: S, StuI; K, KpnI; P,
PstI; X, XbaI. The blot was hybridized with a DIG-labelled DNA fragment amplified from the ORF of Mga1. The sizes of standards are indicated beside
each figure. The nucleotide sequences of Mga1 were deposited in the NCBI database with accession number FJ640858.
Table 1. Primers used in this study
Names
Sequences (5 0 ! 3 0 )
Descriptions
GAF
GAR
A51
A52
A31
A32
mgaK5f
mgaK5r
mgaK3f
mgaK3r
hphF
hphR
ATGAARCTBATCCAYGAGGG
AADCGRTCGATCTTGTT
TGGTATTCGTTGCGGCTATCT
CTTGAAGGACTCCCGTTCGTC
TGTTCGATGTCGGCGGTCAGC
GCCATCTCGGAATATGACCAA
GCTCTAGATTCCTCGCCGGCCTACCTTTC
CTCCTTCAATATCATCTTCTGTCGACGCCGGTGTTTCGAGAATCAG
GTTTAGAGGTAATCCTTCTTTCTAGCTGCGTGAAGGCGACTAATATC
CCGCTCGAGCTACCGTCTCTTCCTTGTTGTC
GTCGACAGAAGATGATATTG
CTAGAAAGAAGGATTACCTC
Degenerate primers used to amplify a Ga-subunit gene
Outer SON-PCR primer to amplify the 5 0 end
Inner SON-PCR primers to amplify the 5 0 end
Outer SON-PCR primer to amplify 3 0 end
Inner SON-PCR primers to amplify the 3 0 end
For amplification of the 648 bp 5 0 flanking regions of Mga1 ORF
For amplification of the 884 bp 3 0 flanking regions of Mga1 ORF
For amplification of the 2134 bp hph cassette from plasmid pSKH
The underlined sequences are matched with the primer sequences of either hphF or hphR; the sequences in italics are restricted enzyme sites.
C18 (5 mm, 250 4.60 mm) column. The mobile phase was
a mixture of acetonitrile and water (H2O) (75 : 25, v/v),
which was acidified to pH 2.5 with orthophosphoric acid.
The flow rate was maintained at 1.0 mL min1 throughout
the run. Fluorescence detection was performed using the 474
Scanning Fluorescence Detector (Waters) at 331 nm excitation wavelength and 500 nm emission wavelength. A citrinin
2010 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
standard compound (Sigma) was used to confirm the HPLC
analysis.
To estimate extracellular pigment concentrations in liquid culture, the filtered broth was diluted with distilled
H2O without organic extraction. Solution absorbance was
measured on a Shimadzu UV-Visible Spectrophotometer
UV-1700 (Shimadzu, Japan). The results were expressed as
FEMS Microbiol Lett 308 (2010) 108–114
111
Mga1 related to safety of Monascus products
Fig. 2. Deletion of Mga1 in Monascus ruber M7. (a) Schematic representation of the homologous gene recombination strategy yielding Mga1-deletion
strains. XbaI, XbaI restriction site; hph, the hph marker cassette amplified from plasmid pSKH; Mga1, the ORF of Mga1. 1, 2, 3, 4, 5, 6, PCR primers used
for confirmation of the homologous recombination events. (b) PCR amplification showing differences in bands of different strains, wild type (lane 1),
Mga1 target deletion (lane 2) and T-DNA random insertion (lane 3). The amplification was performed with the primer pair 1/2, located in the Mga1 ORF;
primer pair 3/4, located in the hph marker cassette; and primer pair 5/6, located in two homologous arms. (c) Southern blot analysis of transformants
using the Mga1 probe (probe 1) or the hph probe (probe 2). Genomic DNA was digested with XbaI, and the blot was hybridized with the DIG-labelled
fragments amplified from the wild-type genomic DNA (for probe 1) or the transformation vector (for probe 2). Lane 1, wild-type strain M7; lane 2,
T-DNA random-insertion mutant; lanes 3–5, Mga1 target deletion mutants. Size markers are from a HindIII-digested l DNA.
OD units per milliliter of liquid culture multiplied by the
dilution factor.
Results
Cloning of the Ga-subunit gene Mga1
PCR with degenerate primers yielded a product of 728 bp,
corresponding to the Ga-subunit based on amino acid
sequences deduced from the sequenced PCR fragments.
SON-PCR was performed to amplify the flanking sequences,
generating a 3874-bp DNA fragment containing the complete ORF of the Ga-subunit gene (1242 bp) (Fig. 1a and b),
which was named Mga1 (Monascus G-protein alpha-subunit
1) and deposited in GenBank with accession number
FJ640858.
The deduced 353 amino acid residues of Mga1 shared
96% identity to FadA, the Group I Ga-subunit of
A. nidulans (Garcia-Rico et al., 2007). Mga1, like other
members of Group I, possessed all the conserved motifs of
a typical Ga protein, including G1G5 box, a consensus
myristylation site at the N-terminus and a pertussis toxinlabelling site at the C-terminus (Garcia-Rico et al., 2007).
Southern blot analysis of restriction enzyme-digested
M. ruber M7 genomic DNA confirmed that Mga1 was
present as a single copy in the M. ruber M7 genome (Fig. 1c).
FEMS Microbiol Lett 308 (2010) 108–114
Targeted deletion of Mga1 in M. ruber M7
Agrobacterium tumefaciens-mediated transformation of
M. ruber M7 yielded nine putative disruptants, which
exhibited a similar set of morphological changes as described in Cryphonectria parasitica Ga-null mutants (Gao
& Nuss, 1996), including reduced vegetative growth and
conidiation, and that abolished sexual reproduction (Fig. 3).
The putative disruptants were further characterized by PCR
and Southern blot analyses, which confirmed the homologous recombination events. As shown in Fig. 2b, a primer
pair (primers 1/2) designed to amplify a fragment internal
to the Mga1 coding region yielded no products when DNA
from the homologous recombinants was used as a template,
whereas a fragment of the hph gene could be amplified from
the same sample (primers 3/4). Meanwhile, amplicons
of wild type (2.9 kb) and deletion (3.7 kb) alleles of Mga1
differed in size when primers contained in homologous
arms (primers 5/6) were used. For T-DNA randominsertion mutagenesis, amplicons both in wild-type strains
and in disruptants were amplified. A probe corresponding
to the Mga1 coding region and the 3 0 homologous arm
(probe 1) yielded a single hybridizing band in a Southern
blot of XbaI-digested genomic DNA of Mga1 deletion
mutants, compared with two bands in the wild-type strain
and three bands in the T-DNA random-insertion mutant
2010 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
112
L. Li et al.
Fig. 3. Colony morphology of the wild type (M7)
and Mga1 deletion (GKmga1) strains. (a) Colony
growth on PDA at 28 1C for 10 days. (b) Cleistothecia formation (at 10 days) on PDA at 28 1C.
(c) Conidia formation (at 10 days) on G25N at
28 1C.
(Fig. 2c). A single hybridizing band detected with the hph
marker cassette (probe 2) in the mutants, but none in the
wild type, revealed that the deletion mutants carried a single
integrated copy of the Mga1 disruption construct (Fig. 2c).
Analysis of citrinin and pigment production
As shown in Fig. 4, the Mga1 target deletion mutant
GKmga1 produced significantly more citrinin and pigments
than the wild-type strain M7 in YES media. After 14 days of
cultivation, the wild-type strain M7 produced 53.19 14.58 mg mL1 citrinin and 9.21 0.05 U mL1 pigments
(OD485 nm), whereas the GKmga1 produced 540.90 121.62 mg mL1 citrinin (approximately ninefold higher)
and 15.78 0.33 U mL1 pigments (OD485 nm) (approximately 71% higher).
Discussion
Intensive investigation of heterotrimeric G-protein signalling pathways in model filamentous fungi and pathogenic
fungi revealed that, despite considerable sequence similarity
among Group I Ga-subunits, their functions, in some cases,
show distinct variations between species. In general, deletion
of Group I Ga-subunits in different fungi results in similar
defects in vegetative growth as well as sexual and asexual
sporulation (Gao & Nuss, 1996; Ivey et al., 1996; Yu et al.,
2008; Mehrabi et al., 2009), which were also observed in this
study. However, the influences of the same mutation of the
genes on secondary metabolites vary substantially within
and across fungal genera. For instance, a dominant activating fadA allele inhibited sterigmatocystin and aflatoxin
biosynthesis in Aspergillus spp., but stimulated T-2 toxin
biosynthesis in Fusarium sporotrichioides (Hicks et al., 1997;
Tag et al., 2000). Furthermore, in A. nidulans, FadA has
opposite roles in regulating the biosynthesis of a potent
antibiotic (penicillin) and a lethal mycotoxin (sterigmatocystin), suggesting that targeting Ga-subunits as a means of
2010 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
controlling or preventing the production of a single mycotoxin could have serious undesirable consequences with
regard to the production of other secondary metabolites
(Tag et al., 2000). In this study, deletion of the orthologous
gene Mga1 in fermentation fungus M. ruber M7 enhanced
both citrinin and pigment production. Although the role of
Mga1 in regulating mycotoxin in M. ruber M7 is consistent
with that in Aspergillus spp., the regulation role in pigment
production is different from cpg-1 in C. parasitica, as
disruption of cpg-1 leads to significant reductions in pigmentation (Gao & Nuss, 1996; Hicks et al., 1997; Tag et al.,
2000).
The production of secondary metabolites of the food
fermentation fungi Monascus spp. was found to be influenced by different chemical and physical signals, such as
nutrients, osmolarity, pH and light (Miyake et al., 2005; Lee
et al., 2006; Babitha et al., 2007). It is widely accepted that
heterotrimeric G-protein signalling pathways play a pivotal
role in perceiving and transmitting many of the external
signals to elicit specific responses in cells, including regulating the production of metabolites (Calvo et al., 2002; Yu,
2006). The deletion of Mga1 in M. ruber M7 resulted in an
increase in the production of citrinin and pigments, providing genetic evidence that the signalling pathway mediated by
the Ga-subunit encoded by Mga1 is involved in the regulation of production of secondary metabolites in Monascus
spp.
Monascus metabolites, for example red pigments and
monacolins, are widely used as natural food colorants or
antihypercholesterolemic agents, but citrinin is nephrotoxic
in mammalian systems. To prevent the negative effects of
citrinin, scientific work has been carried out to identify lowor non-citrinin-producing Monascus strains (Chen & Hu,
2005; Wang et al., 2005; Chen et al., 2008a; Pattanagul et al.,
2008). Some results have shown that citrinin was detectable
in strains of M. ruber (Wang et al., 2005; Pattanagul et al.,
2008), whereas other results revealed that M. ruber was not a
FEMS Microbiol Lett 308 (2010) 108–114
113
Mga1 related to safety of Monascus products
that function in G-protein signalling pathways (Lafon et al.,
2006; Yu, 2006). A proposed model of the roles of these
signalling proteins in controlling A. nidulans growth, development and secondary metabolism has been described (Yu,
2006). As signal perception and signal processing via the Gprotein signalling pathway are complex processes, identification of one component of this pathway is not enough to
shed light on a possible regulation mechanism. Fortunately,
some other genes, including other two Ga genes, a Gb gene,
a Gg gene, an adenylyl cyclase gene and a catalytic subunit of
cAMP-dependent protein kinase gene, have been cloned
from M. ruber M7 in our laboratory (unpublished data),
and we hope that further investigation of these genes will
improve our understanding of the regulation mechanism of
the G-protein signalling pathway in Monascus spp.
Acknowledgements
We thank Dr Youxiang Zhou from the Food Quality Inspection and Testing Center of Agricultural Ministry of China
in Hubei for his aid in citrinin HPLC analysis, and Dr
Daohong Jiang from Plant Pathology, College of Plant
Science and Technology, Huazhong Agricultural University,
for providing vectors pCAMBIA3300 and pSKH. This
research work was financially supported by the National
High Technology Research and Development Program
of the People’s Republic of China (863 Program:
2006AA10Z1A3) and Program for New Century Excellent
Talents in University of the Ministry of Education of the
People’s Republic of China (NCET-05-0667).
References
Fig. 4. Production of citrinin and pigments by wild type (M7) and
deletion (GKmga1) strains. (a) Profile of citrinin production of strains
M7 () and GKmga1 () during cultivation for 19 days. (b) Pigment
concentration in the fermented broth by M7 (upper) and GKmga1
(lower) during cultivation was measured on a scanning spectrophotometer from 300 to 600 nm, and the results are expressed as OD units
per milliliter of liquid culture multiplied by the dilution factor. YES, YES
media. To calculate Monascus red pigment production (OD485 nm), the
absorbance value of YES media at 485 nm was deducted. Error bars
indicate SDs.
citrinin producer, as functional citrinin biosynthesis genes,
such as polyketide synthase gene pksCT, were absent in M.
ruber (Chen et al., 2008a). However, the strain used in our
study, M. ruber M7, produced citrinin both in YES (this
study) and in steamed rice media (Chen & Hu, 2005).
The most extensively studied G-protein signalling model
in filamentous fungi is A. nidulans. Intensive analysis of the
A. nidulans genome has been carried out, and more than 40
genes/putative genes were predicted to encode components
FEMS Microbiol Lett 308 (2010) 108–114
Aniya Y, Ohtani II, Higa T, Miyagi C, Gibo H, Shimabukuro M,
Nakanishi H & Taira J (2000) Dimerumic acid as an
antioxidant of the mold, Monascus anka. Free Radical Bio Med
28: 999–1004.
Antal Z, Rascle C, Fevre M & Bruel C (2004) Single
oligonucleotide nested PCR: a rapid method for the isolation
of genes and their flanking regions from expressed sequence
tags. Curr Genet 46: 240–246.
Babitha S, Soccol CR & Pandey A (2007) Effect of stress on
growth, pigment production and morphology of Monascus sp.
in solid cultures. J Basic Microb 47: 118–126.
Blanc PJ, Laussac JP, Le Bars J, Le Bars P, Loret MO, Pareilleux A,
Prome D, Prome JC, Santerre AL & Goma G (1995a)
Characterization of monascidin A from Monascus as citrinin.
Int J Food Microbiol 27: 201–213.
Blanc PJ, Loret MO & Goma G (1995b) Production of citrinin by
various species of Monascus. Biotechnol Lett 17: 291–294.
Calvo AM, Wilson RA, Bok JW & Keller NP (2002) Relationship
between secondary metabolism and fungal development.
Microbiol Mol Biol R 66: 447–459.
2010 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
114
Chen F & Hu X (2005) Study on red fermented rice with high
concentration of monacolin K and low concentration of
citrinin. Int J Food Microbiol 103: 331–337.
Chen YP, Tseng CP, Chien IL, Wang WY, Liaw LL & Yuan GF
(2008a) Exploring the distribution of citrinin biosynthesis
related genes among Monascus species. J Agr Food Chem 56:
11767–11772.
Chen YP, Tseng CP, Liaw LL, Wang CL, Chen IC, Wu WJ, Wu MD
& Yuan GF (2008b) Cloning and characterization of
monacolin K biosynthetic gene cluster from Monascus pilosus.
J Agr Food Chem 56: 5639–5646.
Fox EM & Howlett BJ (2008) Secondary metabolism: regulation
and role in fungal biology. Curr Opin Microbiol 11: 481–487.
Fu G, Xu Y, Li Y & Tan W (2007) Construction of a replacement
vector to disrupt pksCT gene for the mycotoxin citrinin
biosynthesis in Monascus aurantiacus and maintain food red
pigment production. Asia Pac J Clin Nutr 16 (suppl 1): 137–142.
Gao S & Nuss DL (1996) Distinct roles for two G protein alpha
subunits in fungal virulence, morphology, and reproduction
revealed by targeted gene disruption. P Natl Acad Sci USA 93:
14122–14127.
Garcia-Rico RO, Martin JF & Fierro F (2007) The pga1 gene of
Penicillium chrysogenum NRRL 1951 encodes a heterotrimeric
G protein alpha subunit that controls growth and
development. Res Microbiol 158: 437–446.
Hicks JK, Yu JH, Keller NP & Adams TH (1997) Aspergillus
sporulation and mycotoxin production both require
inactivation of the FadA G alpha protein-dependent signalling
pathway. EMBO J 16: 4916–4923.
Ivey FD, Hodge PN, Turner GE & Borkovich KA (1996) The Gai
homologue gna-1 controls multiple differentiation pathways
in Neurospora crassa. Mol Biol Cell 7: 1283–1297.
Jia XQ, Xu ZN, Zhou LP & Sung CK (2010) Elimination of the
mycotoxin citrinin production in the industrial important
strain Monascus purpureus SM001. Metab Eng 12: 1–7.
Lafon A, Han KH, Seo JA, Yu JH & d’Enfert C (2006) G-protein
and cAMP-mediated signalling in aspergilli: a genomic
perspective. Fungal Genet Biol 43: 490–502.
Lee CL, Wang JJ, Kuo SL & Pan TM (2006) Monascus
fermentation of dioscorea for increasing the production of
cholesterol-lowering agent – monacolin K and
antiinflammation agent – monascin. Appl Microbiol Biot 72:
1254–1262.
Li L, Wright SJ, Krystofova S, Park G & Borkovich KA (2007)
Heterotrimeric G protein signalling in filamentous fungi.
Annu Rev Microbiol 61: 423–452.
Lin YL, Wang TH, Lee MH & Su NW (2008) Biologically active
components and nutraceuticals in the Monascus-fermented
rice: a review. Appl Microbiol Biot 77: 965–973.
2010 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
L. Li et al.
Mehrabi R, Ben M’Barek S, van der Lee T, Waalwijk C, de Wit PJ
& Kema GH (2009) Ga and Gb proteins regulate the cyclic
AMP pathway that is required for development and
pathogenicity of the phytopathogen Mycosphaerella
graminicola. Eukaryot Cell 8: 1001–1013.
Miyake T, Mori A, Kii T, Okuno T, Usui Y, Sato F, Sammoto H,
Watanabe A & Kariyama M (2005) Light effects on cell
development and secondary metabolism in Monascus. J Ind
Microbiol Biot 32: 103–108.
Pattanagul P, Pinthong R, Phianmongkhol A & Tharatha S (2008)
Mevinolin, citrinin and pigments of adlay angkak fermented
by Monascus sp. Int J Food Microbiol 126: 20–23.
Sayyad SA, Panda BP, Javed S & Ali M (2007) Optimization of
nutrient parameters for lovastatin production by Monascus
purpureus MTCC 369 under submerged fermentation using
response surface methodology. Appl Microbiol Biot 73:
1054–1058.
Seo JA & Yu JH (2006) The phosducin-like protein PhnA is
required for Gbg-mediated signalling for vegetative growth,
developmental control, and toxin biosynthesis in Aspergillus
nidulans. Eukaryot Cell 5: 400–410.
Shao Y, Ding Y, Zhao Y, Yang S, Xie B & Chen F (2009)
Characteristic analysis of transformants in T-DNA mutation library of Monascus ruber. World J Microb Biot 25:
989–995.
Shimizu T, Kinoshita H & Nihira T (2007) Identification and in
vivo functional analysis by gene disruption of ctnA, an
activator gene involved in citrinin biosynthesis in Monascus
purpureus. Appl Environ Microb 73: 5097–5103.
Tag A, Hicks J, Garifullina G, Ake CJ, Phillips TD, Beremand M &
Keller N (2000) G-protein signalling mediates differential
production of toxic secondary metabolites. Mol Microbiol 38:
658–665.
Wang JJ, Lee CL & Pan TM (2004) Modified mutation method
for screening low citrinin-producing strains of Monascus
purpureus on rice culture. J Agr Food Chem 52: 6977–6982.
Wang YZ, Ju XL & Zhou YG (2005) The variability of citrinin
production in Monascus type cultures. Food Microbiol 22:
145–148.
Yu HY, Seo JA, Kim JE, Han KH, Shim WB, Yun SH & Lee YW
(2008) Functional analyses of heterotrimeric G protein G
alpha and G beta subunits in Gibberella zeae. Microbiology 154:
392–401.
Yu JH (2006) Heterotrimeric G protein signalling and RGSs in
Aspergillus nidulans. J Microbiol 44: 145–154.
Yu JH, Hamari Z, Han KH, Seo JA, Reyes-Dominguez Y &
Scazzocchio C (2004) Double-joint PCR: a PCR-based
molecular tool for gene manipulations in filamentous fungi.
Fungal Genet Biol 41: 973–981.
FEMS Microbiol Lett 308 (2010) 108–114