* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Identification of Mga1, a G‐protein α‐subunit gene involved in
Molecular cloning wikipedia , lookup
Copy-number variation wikipedia , lookup
Epigenetics in learning and memory wikipedia , lookup
Metagenomics wikipedia , lookup
Epigenetics of neurodegenerative diseases wikipedia , lookup
Gene therapy of the human retina wikipedia , lookup
Non-coding DNA wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Epigenetics of diabetes Type 2 wikipedia , lookup
Neuronal ceroid lipofuscinosis wikipedia , lookup
Saethre–Chotzen syndrome wikipedia , lookup
SNP genotyping wikipedia , lookup
Genetically modified food wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Genome (book) wikipedia , lookup
Gene expression programming wikipedia , lookup
Gene therapy wikipedia , lookup
Genome evolution wikipedia , lookup
Pathogenomics wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Gene desert wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Genetic engineering wikipedia , lookup
Genome editing wikipedia , lookup
Gene expression profiling wikipedia , lookup
Gene nomenclature wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Point mutation wikipedia , lookup
Microsatellite wikipedia , lookup
History of genetic engineering wikipedia , lookup
Microevolution wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Helitron (biology) wikipedia , lookup
Designer baby wikipedia , lookup
RESEARCH LETTER Identi¢cation of Mga1, a G-protein a-subunit gene involved in regulating citrinin and pigment production in Monascus ruber M7 Li Li1, Yanchun Shao1,2, Qi Li1, Sha Yang1 & Fusheng Chen1,2,3 1 College of Food Science and Technology, Huazhong Agricultural University, Hubei Province, China; 2National Key Laboratory of Agro-Microbiology, Huazhong Agricultural University, Hubei Province, China; and 3Key Laboratory of Food Safety Evaluation of Ministry of Agriculture, Huazhong Agricultural University, Hubei Province, China Correspondence: Fusheng Chen, College of Food Science and Technology, Huazhong Agricultural University, Wuhan 430070, Hubei Province, China. Tel./fax: 186 27 8728 2927; e-mail: [email protected] Received 28 February 2010; revised 13 April 2010; accepted 13 April 2010. Final version published online 25 May 2010. DOI:10.1111/j.1574-6968.2010.01992.x Editor: Richard Staples MICROBIOLOGY LETTERS Keywords Monascus ruber; citrinin; pigment; G-protein a-subunit. Abstract The filamentous fungi Monascus spp., which have been used in traditional fermented food in Asia for centuries, are well-known producers of a group of bioactive metabolites that are widely used as food additives and nutraceutical supplements worldwide. However, its potential to produce the mycotoxin citrinin poses a threat to food safety. Here, a G-protein a-subunit-encoding gene, Mga1 (Monascus G-protein alpha-subunit 1), which encodes a protein showing a high degree of identity to Group I a-subunits of fungal heterotrimeric G-proteins, was cloned from Monascus ruber M7. An Mga1-disrupted strain was obtained by homologous recombination. The disruptant produced approximately nine times more citrinin and 71% more pigments than the wild-type strain M7, indicating that the G-protein a-subunit encoded by Mga1 is involved in a signal transduction pathway regulating citrinin and pigment biosynthesis in M. ruber M7. Introduction Monascus spp. are mainly used for the production of red fermented rice (RFR), which has been used extensively for more than 1000 years as a food colorant and food preservative for meat and fish, as a folk medicine to promote cardiovascular health, as well as fermentation starters to brew rice wine and vinegar in Asia (Chen & Hu, 2005; Lin et al., 2008). Nowadays, Monascus-related products are being diversified and distributed worldwide due to the identification of abundant economic metabolites produced by Monascus spp., including cholesterol-lowering agents (monacolins), an antihypertensive substance (g-aminobutyric acid) and an antioxidant (dimerumic acid) (Aniya et al., 2000; Lin et al., 2008; Pattanagul et al., 2008). However, the problem of safety emerged in 1995 when Blanc et al. (1995a) identified monascidin A, an antibacterial compound in RFR, as a nephrotoxic metabolite, citrinin. Thus, control of the production of citrinin is essential to increase the safety of Monascus-related products and extend their applications. In the past decade, researchers have made considerable progress towards improving Monascus-related products using a process of optimization and traditional 2010 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved c mutation breeding methods (Wang et al., 2004; Chen & Hu, 2005; Sayyad et al., 2007). Recently, some biosynthetic gene clusters involved in the biosynthesis of secondary metabolites of Monascus spp., such as citrinin and monacolin K, have been identified (Shimizu et al., 2007; Chen et al., 2008b). Based on the genetic information, a genetic modification method has also been proposed (Fu et al., 2007; Jia et al., 2010). Secondary metabolite production is controlled at an upper hierarchical level by many global mechanisms, in which many proteins encoded by genes not linked to the biosynthetic gene clusters are also involved in modulating fungal secondary metabolism, such as transcription factor, histone deacetylase, DNA methyltransferase, signalling proteins such as MAP kinases and cAMPdependent protein kinase (Fox & Howlett, 2008). Heterotrimeric G-proteins, acting within G-protein signalling pathways to regulate multiple physiological processes and that generally respond to environmental cues such as pH, temperature and nutrition, are also found to be involved in the regulation of secondary metabolite production in some toxigenic fungi (Hicks et al., 1997; Seo & Yu, 2006; Yu et al., 2008). FEMS Microbiol Lett 308 (2010) 108–114 109 Mga1 related to safety of Monascus products Heterotrimeric G-proteins consist of three subunits: Ga, Gb and Gg. They function as ‘molecular switches’ in G-protein signalling pathways to regulate the duration and intensity of the signal, eventually going on to regulate downstream cell processes. Most characterized filamentous fungi possess three Ga proteins belonging to three distinct groups, Groups I, II and III, of which Group I is the most extensively studied (Li et al., 2007). Accumulating evidence has suggested that individual Group I Ga protein regulates multiple pathways. For example, dominant activating mutations in fadA in Aspergillus nidulans blocked both sterigmatocystin production and asexual sporulation, and the deletion of GzGPA1 in Gibberella zeae resulted in female sterility and enhanced deoxynivalenol and zearalenone production (Hicks et al., 1997; Yu et al., 2008). While substantial basic knowledge regarding the functional role of G-proteins has been gained from other fungi, especially model filamentous fungi and pathogenic fungi, our understanding of the biological significance of these components in fermentation fungi is very limited (GarciaRico et al., 2007; Shao et al., 2009). A close phylogenetic relationship, in the same class of secondary metabolites belonging to polyketides, such as pigments, monacolins and citrinin, was found between Monascus spp. and other filamentous fungi, for example Penicillium and Aspergillus spp.; therefore, we could anticipate similar, but more diverse functions in the aspects of growth, development and production of secondary metabolites for G-proteins in Monascus spp., which might have implications for the handling and control of this group of beneficial microorganisms in fermentation. Materials and methods Fungal strains and growth conditions Monascus ruber wild-type strain M7 (Chen & Hu, 2005) was used to clone the Ga-subunit gene and generate the Mga1 knockout strains. All strains were maintained on potato dextrose agar (PDA) media at 28 1C. If required, hygromycin B was added to a concentration of 30 mg mL1. For phenotypic characterization, conidial suspensions were prepared on G25N agar medium and used as an inoculum, due to the lack of sporulation of Mga1 deletion strains on PDA. For liquid fermentation, a 1% spore suspension (105 spores mL1) was inoculated in yeast extract sucrose (YES) medium and incubated at 28 1C without agitation (Blanc et al., 1995b). DNA extraction and Southern hybridization Fungal genomic DNA was isolated from mycelium grown on cellophane membranes covering PDA plates using the cetyltrimethylammonium bromide method (Shao et al., FEMS Microbiol Lett 308 (2010) 108–114 2009). Southern blot assays were performed using the DIGHigh Prime DNA Labeling & Detection Starter kit I (Roche, Germany). Cloning of the Mga1 gene The procedure for amplifying the Ga-subunit gene is shown in Fig. 1a. The degenerate primer set GAF/GAR (Table 1) was designed based on conserved regions of various known fungal homologues. The optimal annealing temperature was determined by gradient PCR. PCR products of the predicted size were cloned into pMD18-T (Takara, Japan) and sequenced. The sequences thus obtained were compared with the GenBank database using the BLAST program (http://blast. ncbi.nlm.nih.gov/Blast.cgi). The 5 0 and 3 0 flanking regions of the corresponding Gasubunit gene fragment were amplified by single oligonucleotide nested (SON)-PCR (Antal et al., 2004). The inner and outer primers of nested PCR for SON-PCR are listed in Table 1. Deletion of the Mga1 gene For target gene deletion, a gene disruption construct, carrying a hygromycin B resistance gene (hph) flanked by DNA sequences homologous to the sequences located at the 5 0 and 3 0 ends of Mga1 ORF, was amplified using the double-joint PCR method (Fig. 2a) (Yu et al., 2004). Briefly, the 5 0 and 3 0 flanking regions (648 and 884 bp, respectively) of Mga1 ORF were amplified with the primer pairs mgaK5f/mgaK5r and mgaK3f/mgaK3r, respectively (Table 1). The 2.1 kb hph marker cassette was amplified from the vector pSKH with the primer pair hphF/hphR, containing XbaI- and XhoIrestricted sites, respectively (Table 1). The three amplicons (the 5 0 and 3 0 regions, and the hph cassette) were mixed at a 1 : 1 : 2 molar ratio for the fusion reaction, and used as a template for a second round of PCR with the primers mgaK5f and mgaK3r. The fused disruption construct products were restricted with XbaI and XhoI and cloned into the XbaI/XhoI sites of the binary Ti vector pCAMBIA3300 to generate plasmid pCMGA1. The plasmid pCMGA1 was transformed to Agrobacterium tumefaciens EHA105 using the freeze–thaw method. The transformed A. tumefaciens was then used to carry out A. tumefaciens-mediated transformation of M. ruber M7 as described by Shao et al. (2009). Citrinin and pigment analysis The fermented broth was filtered using a filter paper. The filtrate was extracted with an equal volume of toluene-ethyl acetate-formic acid (7 : 3 : 1 by volume). After centrifuging at 9724 g for 10 min, the organic phase was collected to analyze the citrinin concentration by HPLC. HPLC was performed on a Waters system fitted with a Phenomenex 2010 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved c 110 L. Li et al. Fig. 1. Cloning of Ga-subunit gene Mga1. (a) Scheme for amplifying the Ga-subunit gene. The ORF of Mga1, as well as its transcription direction, is indicated by a gray arrow. GAF and GAR are degenerate primers designed to amplify the conserved region of the Ga-subunit gene; A51 and A52 are nested SON-PCR primers to amplify the 5 0 end; A31 and A32 are nested SON-PCR primers to amplify the 3 0 end. The location of each primer is indicated by a vertical arrow. (b) Analysis of PCR products by agarose gel electrophoresis. The arrows show the fragments that were cloned and sequenced. DPPCR, degenerate primer PCR; lane 1, first-round SON-PCR products; lane 2, second-round SON-PCR products. (c) Southern blot analysis of the copy number of Mga1 in the genome of Monascus ruber M7. Genomic DNA was digested with the restriction enzymes indicated above: S, StuI; K, KpnI; P, PstI; X, XbaI. The blot was hybridized with a DIG-labelled DNA fragment amplified from the ORF of Mga1. The sizes of standards are indicated beside each figure. The nucleotide sequences of Mga1 were deposited in the NCBI database with accession number FJ640858. Table 1. Primers used in this study Names Sequences (5 0 ! 3 0 ) Descriptions GAF GAR A51 A52 A31 A32 mgaK5f mgaK5r mgaK3f mgaK3r hphF hphR ATGAARCTBATCCAYGAGGG AADCGRTCGATCTTGTT TGGTATTCGTTGCGGCTATCT CTTGAAGGACTCCCGTTCGTC TGTTCGATGTCGGCGGTCAGC GCCATCTCGGAATATGACCAA GCTCTAGATTCCTCGCCGGCCTACCTTTC CTCCTTCAATATCATCTTCTGTCGACGCCGGTGTTTCGAGAATCAG GTTTAGAGGTAATCCTTCTTTCTAGCTGCGTGAAGGCGACTAATATC CCGCTCGAGCTACCGTCTCTTCCTTGTTGTC GTCGACAGAAGATGATATTG CTAGAAAGAAGGATTACCTC Degenerate primers used to amplify a Ga-subunit gene Outer SON-PCR primer to amplify the 5 0 end Inner SON-PCR primers to amplify the 5 0 end Outer SON-PCR primer to amplify 3 0 end Inner SON-PCR primers to amplify the 3 0 end For amplification of the 648 bp 5 0 flanking regions of Mga1 ORF For amplification of the 884 bp 3 0 flanking regions of Mga1 ORF For amplification of the 2134 bp hph cassette from plasmid pSKH The underlined sequences are matched with the primer sequences of either hphF or hphR; the sequences in italics are restricted enzyme sites. C18 (5 mm, 250 4.60 mm) column. The mobile phase was a mixture of acetonitrile and water (H2O) (75 : 25, v/v), which was acidified to pH 2.5 with orthophosphoric acid. The flow rate was maintained at 1.0 mL min1 throughout the run. Fluorescence detection was performed using the 474 Scanning Fluorescence Detector (Waters) at 331 nm excitation wavelength and 500 nm emission wavelength. A citrinin 2010 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved c standard compound (Sigma) was used to confirm the HPLC analysis. To estimate extracellular pigment concentrations in liquid culture, the filtered broth was diluted with distilled H2O without organic extraction. Solution absorbance was measured on a Shimadzu UV-Visible Spectrophotometer UV-1700 (Shimadzu, Japan). The results were expressed as FEMS Microbiol Lett 308 (2010) 108–114 111 Mga1 related to safety of Monascus products Fig. 2. Deletion of Mga1 in Monascus ruber M7. (a) Schematic representation of the homologous gene recombination strategy yielding Mga1-deletion strains. XbaI, XbaI restriction site; hph, the hph marker cassette amplified from plasmid pSKH; Mga1, the ORF of Mga1. 1, 2, 3, 4, 5, 6, PCR primers used for confirmation of the homologous recombination events. (b) PCR amplification showing differences in bands of different strains, wild type (lane 1), Mga1 target deletion (lane 2) and T-DNA random insertion (lane 3). The amplification was performed with the primer pair 1/2, located in the Mga1 ORF; primer pair 3/4, located in the hph marker cassette; and primer pair 5/6, located in two homologous arms. (c) Southern blot analysis of transformants using the Mga1 probe (probe 1) or the hph probe (probe 2). Genomic DNA was digested with XbaI, and the blot was hybridized with the DIG-labelled fragments amplified from the wild-type genomic DNA (for probe 1) or the transformation vector (for probe 2). Lane 1, wild-type strain M7; lane 2, T-DNA random-insertion mutant; lanes 3–5, Mga1 target deletion mutants. Size markers are from a HindIII-digested l DNA. OD units per milliliter of liquid culture multiplied by the dilution factor. Results Cloning of the Ga-subunit gene Mga1 PCR with degenerate primers yielded a product of 728 bp, corresponding to the Ga-subunit based on amino acid sequences deduced from the sequenced PCR fragments. SON-PCR was performed to amplify the flanking sequences, generating a 3874-bp DNA fragment containing the complete ORF of the Ga-subunit gene (1242 bp) (Fig. 1a and b), which was named Mga1 (Monascus G-protein alpha-subunit 1) and deposited in GenBank with accession number FJ640858. The deduced 353 amino acid residues of Mga1 shared 96% identity to FadA, the Group I Ga-subunit of A. nidulans (Garcia-Rico et al., 2007). Mga1, like other members of Group I, possessed all the conserved motifs of a typical Ga protein, including G1G5 box, a consensus myristylation site at the N-terminus and a pertussis toxinlabelling site at the C-terminus (Garcia-Rico et al., 2007). Southern blot analysis of restriction enzyme-digested M. ruber M7 genomic DNA confirmed that Mga1 was present as a single copy in the M. ruber M7 genome (Fig. 1c). FEMS Microbiol Lett 308 (2010) 108–114 Targeted deletion of Mga1 in M. ruber M7 Agrobacterium tumefaciens-mediated transformation of M. ruber M7 yielded nine putative disruptants, which exhibited a similar set of morphological changes as described in Cryphonectria parasitica Ga-null mutants (Gao & Nuss, 1996), including reduced vegetative growth and conidiation, and that abolished sexual reproduction (Fig. 3). The putative disruptants were further characterized by PCR and Southern blot analyses, which confirmed the homologous recombination events. As shown in Fig. 2b, a primer pair (primers 1/2) designed to amplify a fragment internal to the Mga1 coding region yielded no products when DNA from the homologous recombinants was used as a template, whereas a fragment of the hph gene could be amplified from the same sample (primers 3/4). Meanwhile, amplicons of wild type (2.9 kb) and deletion (3.7 kb) alleles of Mga1 differed in size when primers contained in homologous arms (primers 5/6) were used. For T-DNA randominsertion mutagenesis, amplicons both in wild-type strains and in disruptants were amplified. A probe corresponding to the Mga1 coding region and the 3 0 homologous arm (probe 1) yielded a single hybridizing band in a Southern blot of XbaI-digested genomic DNA of Mga1 deletion mutants, compared with two bands in the wild-type strain and three bands in the T-DNA random-insertion mutant 2010 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved c 112 L. Li et al. Fig. 3. Colony morphology of the wild type (M7) and Mga1 deletion (GKmga1) strains. (a) Colony growth on PDA at 28 1C for 10 days. (b) Cleistothecia formation (at 10 days) on PDA at 28 1C. (c) Conidia formation (at 10 days) on G25N at 28 1C. (Fig. 2c). A single hybridizing band detected with the hph marker cassette (probe 2) in the mutants, but none in the wild type, revealed that the deletion mutants carried a single integrated copy of the Mga1 disruption construct (Fig. 2c). Analysis of citrinin and pigment production As shown in Fig. 4, the Mga1 target deletion mutant GKmga1 produced significantly more citrinin and pigments than the wild-type strain M7 in YES media. After 14 days of cultivation, the wild-type strain M7 produced 53.19 14.58 mg mL1 citrinin and 9.21 0.05 U mL1 pigments (OD485 nm), whereas the GKmga1 produced 540.90 121.62 mg mL1 citrinin (approximately ninefold higher) and 15.78 0.33 U mL1 pigments (OD485 nm) (approximately 71% higher). Discussion Intensive investigation of heterotrimeric G-protein signalling pathways in model filamentous fungi and pathogenic fungi revealed that, despite considerable sequence similarity among Group I Ga-subunits, their functions, in some cases, show distinct variations between species. In general, deletion of Group I Ga-subunits in different fungi results in similar defects in vegetative growth as well as sexual and asexual sporulation (Gao & Nuss, 1996; Ivey et al., 1996; Yu et al., 2008; Mehrabi et al., 2009), which were also observed in this study. However, the influences of the same mutation of the genes on secondary metabolites vary substantially within and across fungal genera. For instance, a dominant activating fadA allele inhibited sterigmatocystin and aflatoxin biosynthesis in Aspergillus spp., but stimulated T-2 toxin biosynthesis in Fusarium sporotrichioides (Hicks et al., 1997; Tag et al., 2000). Furthermore, in A. nidulans, FadA has opposite roles in regulating the biosynthesis of a potent antibiotic (penicillin) and a lethal mycotoxin (sterigmatocystin), suggesting that targeting Ga-subunits as a means of 2010 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved c controlling or preventing the production of a single mycotoxin could have serious undesirable consequences with regard to the production of other secondary metabolites (Tag et al., 2000). In this study, deletion of the orthologous gene Mga1 in fermentation fungus M. ruber M7 enhanced both citrinin and pigment production. Although the role of Mga1 in regulating mycotoxin in M. ruber M7 is consistent with that in Aspergillus spp., the regulation role in pigment production is different from cpg-1 in C. parasitica, as disruption of cpg-1 leads to significant reductions in pigmentation (Gao & Nuss, 1996; Hicks et al., 1997; Tag et al., 2000). The production of secondary metabolites of the food fermentation fungi Monascus spp. was found to be influenced by different chemical and physical signals, such as nutrients, osmolarity, pH and light (Miyake et al., 2005; Lee et al., 2006; Babitha et al., 2007). It is widely accepted that heterotrimeric G-protein signalling pathways play a pivotal role in perceiving and transmitting many of the external signals to elicit specific responses in cells, including regulating the production of metabolites (Calvo et al., 2002; Yu, 2006). The deletion of Mga1 in M. ruber M7 resulted in an increase in the production of citrinin and pigments, providing genetic evidence that the signalling pathway mediated by the Ga-subunit encoded by Mga1 is involved in the regulation of production of secondary metabolites in Monascus spp. Monascus metabolites, for example red pigments and monacolins, are widely used as natural food colorants or antihypercholesterolemic agents, but citrinin is nephrotoxic in mammalian systems. To prevent the negative effects of citrinin, scientific work has been carried out to identify lowor non-citrinin-producing Monascus strains (Chen & Hu, 2005; Wang et al., 2005; Chen et al., 2008a; Pattanagul et al., 2008). Some results have shown that citrinin was detectable in strains of M. ruber (Wang et al., 2005; Pattanagul et al., 2008), whereas other results revealed that M. ruber was not a FEMS Microbiol Lett 308 (2010) 108–114 113 Mga1 related to safety of Monascus products that function in G-protein signalling pathways (Lafon et al., 2006; Yu, 2006). A proposed model of the roles of these signalling proteins in controlling A. nidulans growth, development and secondary metabolism has been described (Yu, 2006). As signal perception and signal processing via the Gprotein signalling pathway are complex processes, identification of one component of this pathway is not enough to shed light on a possible regulation mechanism. Fortunately, some other genes, including other two Ga genes, a Gb gene, a Gg gene, an adenylyl cyclase gene and a catalytic subunit of cAMP-dependent protein kinase gene, have been cloned from M. ruber M7 in our laboratory (unpublished data), and we hope that further investigation of these genes will improve our understanding of the regulation mechanism of the G-protein signalling pathway in Monascus spp. Acknowledgements We thank Dr Youxiang Zhou from the Food Quality Inspection and Testing Center of Agricultural Ministry of China in Hubei for his aid in citrinin HPLC analysis, and Dr Daohong Jiang from Plant Pathology, College of Plant Science and Technology, Huazhong Agricultural University, for providing vectors pCAMBIA3300 and pSKH. This research work was financially supported by the National High Technology Research and Development Program of the People’s Republic of China (863 Program: 2006AA10Z1A3) and Program for New Century Excellent Talents in University of the Ministry of Education of the People’s Republic of China (NCET-05-0667). References Fig. 4. Production of citrinin and pigments by wild type (M7) and deletion (GKmga1) strains. (a) Profile of citrinin production of strains M7 () and GKmga1 () during cultivation for 19 days. (b) Pigment concentration in the fermented broth by M7 (upper) and GKmga1 (lower) during cultivation was measured on a scanning spectrophotometer from 300 to 600 nm, and the results are expressed as OD units per milliliter of liquid culture multiplied by the dilution factor. YES, YES media. To calculate Monascus red pigment production (OD485 nm), the absorbance value of YES media at 485 nm was deducted. Error bars indicate SDs. citrinin producer, as functional citrinin biosynthesis genes, such as polyketide synthase gene pksCT, were absent in M. ruber (Chen et al., 2008a). However, the strain used in our study, M. ruber M7, produced citrinin both in YES (this study) and in steamed rice media (Chen & Hu, 2005). The most extensively studied G-protein signalling model in filamentous fungi is A. nidulans. Intensive analysis of the A. nidulans genome has been carried out, and more than 40 genes/putative genes were predicted to encode components FEMS Microbiol Lett 308 (2010) 108–114 Aniya Y, Ohtani II, Higa T, Miyagi C, Gibo H, Shimabukuro M, Nakanishi H & Taira J (2000) Dimerumic acid as an antioxidant of the mold, Monascus anka. Free Radical Bio Med 28: 999–1004. Antal Z, Rascle C, Fevre M & Bruel C (2004) Single oligonucleotide nested PCR: a rapid method for the isolation of genes and their flanking regions from expressed sequence tags. Curr Genet 46: 240–246. Babitha S, Soccol CR & Pandey A (2007) Effect of stress on growth, pigment production and morphology of Monascus sp. in solid cultures. J Basic Microb 47: 118–126. Blanc PJ, Laussac JP, Le Bars J, Le Bars P, Loret MO, Pareilleux A, Prome D, Prome JC, Santerre AL & Goma G (1995a) Characterization of monascidin A from Monascus as citrinin. Int J Food Microbiol 27: 201–213. Blanc PJ, Loret MO & Goma G (1995b) Production of citrinin by various species of Monascus. Biotechnol Lett 17: 291–294. Calvo AM, Wilson RA, Bok JW & Keller NP (2002) Relationship between secondary metabolism and fungal development. Microbiol Mol Biol R 66: 447–459. 2010 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved c 114 Chen F & Hu X (2005) Study on red fermented rice with high concentration of monacolin K and low concentration of citrinin. Int J Food Microbiol 103: 331–337. Chen YP, Tseng CP, Chien IL, Wang WY, Liaw LL & Yuan GF (2008a) Exploring the distribution of citrinin biosynthesis related genes among Monascus species. J Agr Food Chem 56: 11767–11772. Chen YP, Tseng CP, Liaw LL, Wang CL, Chen IC, Wu WJ, Wu MD & Yuan GF (2008b) Cloning and characterization of monacolin K biosynthetic gene cluster from Monascus pilosus. J Agr Food Chem 56: 5639–5646. Fox EM & Howlett BJ (2008) Secondary metabolism: regulation and role in fungal biology. Curr Opin Microbiol 11: 481–487. Fu G, Xu Y, Li Y & Tan W (2007) Construction of a replacement vector to disrupt pksCT gene for the mycotoxin citrinin biosynthesis in Monascus aurantiacus and maintain food red pigment production. Asia Pac J Clin Nutr 16 (suppl 1): 137–142. Gao S & Nuss DL (1996) Distinct roles for two G protein alpha subunits in fungal virulence, morphology, and reproduction revealed by targeted gene disruption. P Natl Acad Sci USA 93: 14122–14127. Garcia-Rico RO, Martin JF & Fierro F (2007) The pga1 gene of Penicillium chrysogenum NRRL 1951 encodes a heterotrimeric G protein alpha subunit that controls growth and development. Res Microbiol 158: 437–446. Hicks JK, Yu JH, Keller NP & Adams TH (1997) Aspergillus sporulation and mycotoxin production both require inactivation of the FadA G alpha protein-dependent signalling pathway. EMBO J 16: 4916–4923. Ivey FD, Hodge PN, Turner GE & Borkovich KA (1996) The Gai homologue gna-1 controls multiple differentiation pathways in Neurospora crassa. Mol Biol Cell 7: 1283–1297. Jia XQ, Xu ZN, Zhou LP & Sung CK (2010) Elimination of the mycotoxin citrinin production in the industrial important strain Monascus purpureus SM001. Metab Eng 12: 1–7. Lafon A, Han KH, Seo JA, Yu JH & d’Enfert C (2006) G-protein and cAMP-mediated signalling in aspergilli: a genomic perspective. Fungal Genet Biol 43: 490–502. Lee CL, Wang JJ, Kuo SL & Pan TM (2006) Monascus fermentation of dioscorea for increasing the production of cholesterol-lowering agent – monacolin K and antiinflammation agent – monascin. Appl Microbiol Biot 72: 1254–1262. Li L, Wright SJ, Krystofova S, Park G & Borkovich KA (2007) Heterotrimeric G protein signalling in filamentous fungi. Annu Rev Microbiol 61: 423–452. Lin YL, Wang TH, Lee MH & Su NW (2008) Biologically active components and nutraceuticals in the Monascus-fermented rice: a review. Appl Microbiol Biot 77: 965–973. 2010 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved c L. Li et al. Mehrabi R, Ben M’Barek S, van der Lee T, Waalwijk C, de Wit PJ & Kema GH (2009) Ga and Gb proteins regulate the cyclic AMP pathway that is required for development and pathogenicity of the phytopathogen Mycosphaerella graminicola. Eukaryot Cell 8: 1001–1013. Miyake T, Mori A, Kii T, Okuno T, Usui Y, Sato F, Sammoto H, Watanabe A & Kariyama M (2005) Light effects on cell development and secondary metabolism in Monascus. J Ind Microbiol Biot 32: 103–108. Pattanagul P, Pinthong R, Phianmongkhol A & Tharatha S (2008) Mevinolin, citrinin and pigments of adlay angkak fermented by Monascus sp. Int J Food Microbiol 126: 20–23. Sayyad SA, Panda BP, Javed S & Ali M (2007) Optimization of nutrient parameters for lovastatin production by Monascus purpureus MTCC 369 under submerged fermentation using response surface methodology. Appl Microbiol Biot 73: 1054–1058. Seo JA & Yu JH (2006) The phosducin-like protein PhnA is required for Gbg-mediated signalling for vegetative growth, developmental control, and toxin biosynthesis in Aspergillus nidulans. Eukaryot Cell 5: 400–410. Shao Y, Ding Y, Zhao Y, Yang S, Xie B & Chen F (2009) Characteristic analysis of transformants in T-DNA mutation library of Monascus ruber. World J Microb Biot 25: 989–995. Shimizu T, Kinoshita H & Nihira T (2007) Identification and in vivo functional analysis by gene disruption of ctnA, an activator gene involved in citrinin biosynthesis in Monascus purpureus. Appl Environ Microb 73: 5097–5103. Tag A, Hicks J, Garifullina G, Ake CJ, Phillips TD, Beremand M & Keller N (2000) G-protein signalling mediates differential production of toxic secondary metabolites. Mol Microbiol 38: 658–665. Wang JJ, Lee CL & Pan TM (2004) Modified mutation method for screening low citrinin-producing strains of Monascus purpureus on rice culture. J Agr Food Chem 52: 6977–6982. Wang YZ, Ju XL & Zhou YG (2005) The variability of citrinin production in Monascus type cultures. Food Microbiol 22: 145–148. Yu HY, Seo JA, Kim JE, Han KH, Shim WB, Yun SH & Lee YW (2008) Functional analyses of heterotrimeric G protein G alpha and G beta subunits in Gibberella zeae. Microbiology 154: 392–401. Yu JH (2006) Heterotrimeric G protein signalling and RGSs in Aspergillus nidulans. J Microbiol 44: 145–154. Yu JH, Hamari Z, Han KH, Seo JA, Reyes-Dominguez Y & Scazzocchio C (2004) Double-joint PCR: a PCR-based molecular tool for gene manipulations in filamentous fungi. Fungal Genet Biol 41: 973–981. FEMS Microbiol Lett 308 (2010) 108–114