Download This is a test - DNALC Lab Center

Dolan
DNA Learning Center
DNA Fingerprint
__________________________________________________________________________________________
Background
This experiment examines PV92, a human-specific Alu insertion on chromosome 16. The PV92
genetic system has only two alleles indicating the presence (+) or absence (-) of the Alu
transposable element on each of the paired chromosomes. This results in three PV92 genotypes
(++, +-, or --). The + and - alleles can be separated by size using gel electrophoresis.
Alu elements are classified as SINEs, or Short INterspersed Elements. All Alus are
approximately 300 bp in length and derive their name from a single recognition site for the
restriction enzyme AluI located near the middle of the Alu element. Human chromosomes
contain about 1,000,000 Alu copies, which equal 10% of the total genome. Alu elements
probably arose from a gene that encodes the RNA component of the signal recognition particle,
which labels proteins for export from the cell.
Alu is an example of a so-called "jumping gene" – a transposable DNA sequence that
"reproduces" by copying itself and inserting into new chromosome locations. Alu is classified as
a retroposon, because it is thought to require the retrovirus enzyme reverse transcriptase (rt)
enzyme to make a mobile copy of itself. Here is a simple scheme to explain how an Alu element
transposes:
First, the inserted Alu is transcribed into messenger RNA by the cellular RNA
polymerase.
Then, the mRNA is converted to a double-stranded DNA molecule by reverse
transcriptase.
Finally, the DNA copy of Alu is integrated into a new chromosomal locus at the
site of a single- or double-stranded break.
Each Alu element has an internal promoter for RNA polymerase III needed to independently
initiate transcription of itself. However, Alu is a "defective" transposon, in that it lacks the
enzyme functions to produce a DNA copy of itself and to integrate into a new chromosome
position. However, Alu can obtain these functions from another transposon, called L1, a Long
INterspersed Element (LINE). LINEs are essentially defective retroviruses that retain a
functional rt gene. Interestingly, in addition to reverse transcribing RNA to DNA, the L1 rt also
produces single-stranded nicks in DNA. In the current model, the rt enzyme produces a nick at a
chromosomal locus containing the sequence AATTTT. The polyadenylated "tail" of the Alu
transcript (-AAAA) then hydrogen bonds to the TTTT sequence at the nick site, creating a
__________________________________________________________________________________________
Developed at the Dolan DNA Learning Center. Copyright © Cold Spring Harbor Laboratory.
Dolan
DNA Learning Center
DNA Fingerprint
__________________________________________________________________________________________
primer for reverse transcription. The L1 rt makes a staggered nick in the opposite DNA strand
of the host chromosome, allowing the DNA copy to integrate. This method of insertion also
accounts for the identical sequences (direct repeats) found at the ends of all Alu elements. So it
appears that LI can provide the necessary functions for Alu transposition. In this sense, Alu is a
parasite of L1, which, in turn, is a relic of a retrovirus ancestor.
Some scientists regard Alu as an example of "selfish DNA" – it encodes no protein and appears
to exist only for its own replication. If one reduces the definition of life to "the perpetuation and
amplification of a DNA sequence through time," then Alu is an extremely successful life form.
However, other scientists believe that transposable elements have played an important role in
evolution by creating new mutations and gene combinations. Nobel laureate Barbara
McClintock hypothesized that transposable elements provide a mechanism to rapidly reorganize
the genome in response to environmental stress. Like Alu, the Ds transposable element
discovered in corn by McClintock is a defective transposon and requires the help of a second
element called Ac (activator).
Alu elements are found only in primates – the "monkey" branch of the evolutionary tree, which
includes humans. So, all of the hundreds of thousands of Alu copies have accumulated in
primates since their separation from other vertebrate groups about 65 million years ago. Once
an Alu integrates into a new site, it accumulates new mutations at the same rate as surrounding
DNA loci. Alu elements can be sorted into distinct lineages, or families, according to inherited
patterns of new mutations. These studies suggest that the rate of Alu transposition has changed
over time – from about one new jump in every live birth, early in primate evolution, to about
one in every 200 newborns today. Taken together, this pattern suggests that, at any point in
time, only one or several Alu "masters" are capable of transposing.
Once an Alu inserts at a chromosome locus, it can copy itself for transposition, but there is no
evidence that it is ever excised or lost from a chromosome locus. So, each Alu insertion is stable
through evolutionary time. Each is the "fossil" of a unique transposition event that occurred
only once in primate evolution. Like genes, Alu insertions are inherited in a Mendelian fashion
from parents to children. Thus, all primates showing an Alu insertion at a particular locus have
inherited it from a common ancestor. This is called identity by descent.
An estimated 500-2,000 Alu elements are restricted to the human genome. The vast majority of
Alu insertions occur in non-coding regions and are thought to be evolutionarily neutral.
However, an Alu insertion in the NF-1 gene is responsible for neurofibromatosis I, Alu
insertions in introns of genes for tissue plasminogen activator (TPA) and angiotensin converter
enzyme (ACE) are associated with heart disease. Alu insertions are analogous to the insertion of
a provirus in viral diseases and certain cancers.
Most Alu mutations are "fixed," meaning that both of the paired chromosomes have an insertion
at the same locus (position). However, a number of human-specific Alus are dimorphic – an
insertion may be present or absent on each of the paired chromosomes of different people.
These dimorphic Alus inserted within the last million years, during the evolution and dispersion
of modern humans. These dimorphisms show differences in allele and genotype frequencies
between modern populations and are tools for reconstructing human prehistory.
__________________________________________________________________________________________
Developed at the Dolan DNA Learning Center. Copyright © Cold Spring Harbor Laboratory.
Dolan
DNA Fingerprint
DNA Learning Center
__________________________________________________________________________________________
Description of Activity
Materials and Equipment
This two-hour laboratory provides children in grades
7-8 with the opportunity to look at their own DNA. No two
individuals, except identical twins, have the same genetic
makeup. Although DNA from different individuals is more
alike that different, there are regions of human chromosomes
that vary greatly. The variations that exist can provide insight
into genetic disease and can be used for forensic identification.
Learning Outcomes
Students will:
• Learn the difference between coding and non coding
regions of DNA.
• discuss the numerous applications of DNA
Fingerprinting.
• appreciate the ability of sections of DNA to move
throughout the genome.
• understand mechanisms and relevance of Polymerase
Chain Reaction (PCR).
• use gel electrophoresis to separate DNA fragments
and analyze results.
15 racks
15 permanent markers
30 plastic cups
30 15 mL snap cap tubes with 10 mL of saline solution
30 1.5 mL tubes
15 large micropipettors*
15 medium micropipettors*
15 large micropipettor tip boxes*
15 medium micropipettor tip boxes*
15 empty beakers for garbage
30 tubes of 100 μL of chelex beads in clear PCR tubes
30 Ready-To-Go Beans
6 grams agarose
2 liters of TBE buffer
3 gel electrophoresis boxes
1 role of tape
30 aliquots of 25 μL alu primer mix
1-3 mini centrifuges
1 fluorescent tap light or other flat light
*If micropipettors are unavailable, plastic droppers may be
used instead.
Assumptions of Prior Knowledge
Recipes
Students should have a basic understanding of the
structure and function of DNA. They should understand the
relationship between DNA, genes, and proteins. In addition,
students should be familiar with the concepts of heredity.
10% Chelex
Makes 10 ml. Store at room temperature (3 months).
Misconceptions
Many students assume that each section of DNA
codes for a trait or function. It is important to discuss the
difference between coding and noncoding regions. In
addition, students may be unaware of the flexibility of the
genome and unfamiliar with the idea of transposable elements,
or “jumping genes”.
Lesson
Become familiar with the DNA Interactive (DNAi) website
(www.dnai.org) and how to navigate through it. Take time to
explore the chapter titled Manipulation for background
information on techniques for amplification of DNA. The
chapter on Applications can also provide interesting facts to
enhance the lesson.
Weigh out 1 g of Chelex 100 (100-200 mesh, sodium form
from BioRad).
Add 50 mM Tris to dry Chelex to make 10 ml of solution.
Adjust pH to 11 using 4 N NaOH.
Saline Solution, 0.9% Sodium Chloride
Makes 1000 ml. Store at room temperature (indefinitely).
Note: This solution will be used for a mouthwash, so insure
that all glassware/plasticware is clean and free of chemical
residue.
Dissolve 9 g NaCl (mw 58.44) in 700 ml deionized or distilled
water in clean container.
Add water to bring total solution volume to 1000 ml.
Make 10 ml aliquots in sterile 15 ml culture tubes.
Note: If solution is to be used immediately, it need not be
sterile. However, for long-term storage, we recommend
sterilizing by autoclaving for 15 minutes at 121°C or passage
through a .45 or .22 micron sterile filter.
__________________________________________________________________________________________
Developed at the Dolan DNA Learning Center. Copyright © Cold Spring Harbor Laboratory.
Dolan
DNA Fingerprint
DNA Learning Center
__________________________________________________________________________________________
1% Cresol Red Dye
Makes 50 ml. Store at room temperature.
Notes:
i.
Add 500 mg to 50 ml of distilled water in a 50-ml tube.
Shake tube to dissolve.
ii.
Cresol Red Loading Dye
Makes 50 ml. Store at 4° C.
Add 17 g of sucrose to 49 ml of distilled water in a 50-ml
tube.
Shake tube to dissolve
Add 1 ml of 1% cresol red dye.
Shake tube to mix.
PV-92 Primer/Loading Dye Mix
Makes for 50 PCR reactions. Store in freezer for 1 year.
640 µl of distilled water
460 µl of Cresol Red Loading Dye
19 µl of 5' primer [15 pm/µl]
19 µl of 3' primer [15 pm/µl]
Vortex to mix.
iii.
Samples of agarose powder can be preweighed
and stored in capped test tubes until ready for
use.
Solidified agarose can be stored at room
temperature and then remelted over a boilingwater bath (15-20 minutes) or in a microwave
oven (3-5 minutes per beaker) prior to use.
Always loosen cap when remelting agarose in a
bottle.
iii. When remelting agarose evaporation will
cause the concentration to increase. If necessary,
compensate by adding back a small volume of
water.
1 µg/ml Ethidium Bromide Staining Solution
Makes 500 ml. Store in dark at room temperature
(indefinitely).
CAUTION: Ethidium bromide is a mutagen by the Ames
microsome assay and a suspected carcinogen. Wear rubber
gloves when preparing and using ethidium bromide solutions.
Add 100 µl of 5 mg/ml ethidium bromide to 500 ml deionized
or distilled water.
PV-92 Primer Sequences
Forward primer:
5' GGATCTCAGGGTGGGTGGCAATGCT 3'
Reverse primer:
5' GAAAGGCAAGCTACCAGAAGCCCCAA 3'
Store in unbreakable bottles (preferably opaque). Label bottles
Note: Ethidium bromide is light sensitive; store in dark
container or wrap container in aluminum foil.
Loading Dye
Makes 100 ml. Store at room temperature (indefinitely).
2.0% Agarose
Makes 200 ml. Use fresh or store jelled at room temperature
(several weeks).
Add 4.0 g agarose (electrophoresis grade) to 200 ml 1X TBE
electrophoresis buffer in a 600 ml beaker or Erlenmeyer flask.
Stir to suspend agarose.
Cover beaker with aluminum foil, and heat in boiling-water
bath (double boiler) or on hot plate until all agarose is
dissolved (approximately 10 minutes).
or
Heat uncovered in a microwave oven at high setting until all
agarose is dissolved (3-5 minutes per beaker).
Swirl solution and check bottom of beaker to insure that all
agarose has dissolved. (Just prior to complete dissolution,
particles of agarose appear as translucent grains.) Reheat for
several minutes if necessary.
Cover with aluminum foil, and hold in a hot-water bath (at
about 60°C) until ready for use. Remove any "skin" of
solidified agarose from surface prior to pouring.
0.25 g bromophenol blue (m.w. 669.96)
0.25 g xylene cyanol (m.w. 538.60)
50.00 g sucrose (m.w. 342.30) (or 50 ml of glycerol)
1.00 ml 1M Tris (pH 8.0)
If using sucrose:
Dissolve bromophenol blue, xylene cyanol, sucrose and Tris
in 60 ml deionized or distilled water.
Add deionized or distilled water to make 100 ml total solution.
If using glycerol:
Dissolve xylene cyanol, bromophenol blue, and Tris in 49 ml
of deionized or distilled water.
Stir in 50 ml of glycerol to make 100 ml total solution.
0.2% Methylene Blue Stock Solution
Makes 100 ml. Store at room temperature (indefinitely).
Weigh out 0.2 g methylene blue-trihydrate (m.w. 373.9) and
add to 100 ml of distilled water.
Stir until completely dissolved.
__________________________________________________________________________________________
Developed at the Dolan DNA Learning Center. Copyright © Cold Spring Harbor Laboratory.
Dolan
DNA Fingerprint
DNA Learning Center
__________________________________________________________________________________________
0.025% Methylene Blue Staining Solution
Makes 500 ml. Store at room temperature (indefinitely).
Add 62.5 ml of 0.2% methelyene blue stock solution to 437.5
ml of distilled water.
Stir to mix.
•
•
10X Tris/Borate/EDTA (TBE) Electrophoresis Buffer
Makes 1 liter. Store at room temperature (indefinitely).
Weigh out:
1 g NaOH (m.w. 40.00)
108 g Tris base (m.w. 121.10)
55 g boric acid (m.w. 61.83)
7.4 g ethylene diamine tetraacetic acid (EDTA, disodium salt,
m.w. 372.24)
Add all dry ingredients to 700 ml deionized or distilled water
in a 2 l flask.
Stir to dissolve, preferably using a magnetic stir bar.
Add deionized water to bring total solution to 1 liter.
1X TBE Electrophoresis Buffer
Makes 10 liters. Store at room temperature (indefinitely).
Into a spigoted carboy, add 9 liters deionized or distilled water
to 1 liter of 10X TBE electrophoresis buffer.
Stir to mix.
Meanwhile, discuss gel electrophoresis and the
expected results. It is helpful to show examples of
previous gels so students can appreciate and
understand what they will see.
When the cycles for amplification are completed,
removed the comb carefully and add the buffer . load
them in the precast gels and add TBE buffer just until
the wells are covered . It is important that the
samples are loaded in communal gels so that the
results are easy to determine. You may also choose
to load a ladder marker in the first lane of each gel.
Set the voltage box up with the electrophoresis box
and run the gels at
Analysis and Discussion
Ask the students to explain why there may be a difference in
the size fragments that they may see on the gels. Any
abnormal results can be discussed to determine possible
causes of error. The DNA Science textbook lists the
electrophoresis effects that may result on p.373-373. Also
mention that it is common to see an additional band lower on
the gel. This diffuse (fuzzy) band is "primer dimer," an artifact
of the PCR reaction that results from the primers overlapping
one another and amplifying themselves.
Further Explorations
During Class
•
•
•
•
•
Recount the historical significance of discovery of
transposable elements. See www.DNAi.org >
Timeline > Barbara McClintock.
A description of the Alu family of repeat sequences
in primate genomes is important. Students should
understand that the insertion we are looking for in
this lab is not fixed within the human population,
meaning not everyone has it. It is also essential that
the teacher clearly express that this is simply a
segment of DNA that demonstrates human evolution.
It does relate to a known trait or function and is
considered a region of “junk” DNA.
Discuss the possible genotypes and describe the
effect of an insersion of a 300 base pair element on
the size of the DNA fragment.
Describe the steps associated with PCR and the
importance of this technique in the laboratory as well
as real life situations. Utilize the resources available
on http://www.dnai.org/b/index.html >manipulation
>techniques>amplifying.
After reviewing the basics of alu insersions and PCR,
begin the protocol and get the tubes into the
thermocyler. (Please see attached handout for the
protocol instructions.)
Students can work in assigned groups and research the various
uses of PCR and how this affects our lives. These can include
embryonic testing, detection for various genetic diseases, or
crimes scene investigation. The students can then be asked to
share their work to their classmates through a group
presentation. Teachers may also ask the students to prepare
handouts relating to their subject to pass out to the other
students.
Resources
Books:
DNA Science . Micklos, David A., Freyer, Greg A., and
Crotty, David A. , Cold Spring Harbor Press, New York.
Internet Sites:
http://www.dnai.org/index.htm
A DNA Learning Center website
http://www.ygyh.org/
A DNA Learning Center website
__________________________________________________________________________________________
Developed at the Dolan DNA Learning Center. Copyright © Cold Spring Harbor Laboratory.
Dolan
DNA Learning Center
DNA Fingerprint
__________________________________________________________________________________________
Correlations
New York State
NYS Standard 4: Science
The Living Environment
• Living things are both similar to and
different from each other and nonliving
things.
• Organisms inherit genetic information in a
variety of ways that result in continuity of
structure and function between parents and
offspring.
• The continuity of life is sustained through
reproduction and development.
National
Content Standard A: Abilities necessary to do scientific
inquiry
Understandings about Scientific Inquiry
• Scientists usually inquire about how
physical, living, or designed systems
function. Conceptual principles and
knowledge guide scientific inquires.
Historical and current scientific knowledge
influence the design and interpretation of
investigations and the evaluation of
proposed explanations made by other
scientists.
• Scientists conduct investigations for a wide
variety of reasons. For example, they may
wish to discover new aspects of the natural
world, explain recently observed
phenomena, or test the conclusions of prior
investigations or the predictions of current
theories.
• Scientists rely on technology to enhance the
gathering and manipulations of data. New
techniques and tools provide new evidence
to guide inquiry and new methods to gather
data, thereby contributing to the advance of
science. The accuracy and precision of the
data, and therefore the quality of the
explorations, depends on the technology
used.
• Scientists explanations must adhere to
criteria such as: a proposed explanation must
be logically consistent; it must abide by the
rules of evidence; it must be open to
questions and possible modifications; and it
must be based on historical and current
scientific knowledge.
Content Standard C: Life Science
Reproduction and Heredity
• Hereditary information is contained in
genes, located in the chromosomes of each
cell. Each gene carries a single unit of
information. An inherited trait of an
individual can be determined by one or by
many genes, and a single gene can influence
more than one trait. A human cell contains
many thousands of different genes.
• The characteristics of an organism can be
described in terms of a combination of traits.
Some traits are inherited and others result
from interactions with the environment.
Diversity and Adaptations of Organisms
• Extinction of a species occurs when the
environment changes and the adaptive
characteristics of a species are insufficient to
allow its survival. Fossils indicate that
many organisms that lived long ago are
extinct. Extinction of species is common;
most of the species that have lived on the
earth no longer exist.
AAAS Benchmarks
Content Standard B: Heredity
• There is variation among individuals of one
kind within a population
• For offspring to resemble their parents, there
must be a reliable way to transfer
information from one generation to the next.
• New varieties of cultivated plants and
domestic animals have resulted from
selective breeding for particular traits.
Content Standard F: Evolution of Life
• Individuals of the same kind differ in their
characteristics, and sometimes the
differences give individuals an advantage in
surviving and reproducing.
• Fossils can be compared to one another and
to living organisms according to their
similarities and differences. Some organisms
that lived long ago are similar to existing
organisms, but some are quite different.
• Small differences between parents and
offspring can accumulate (through selective
breeding) in successive generations so that
descendants are very different from their
ancestors.
Individual organisms with certain traits are
more likely than others to survive and have
offspring. Changes in environmental
conditions can affect the survival of
individual organisms and entire species.
__________________________________________________________________________________________
Developed at the Dolan DNA Learning Center. Copyright © Cold Spring Harbor Laboratory.
Human DNA Fingerprint by PCR
(Polymerase Chain Reaction)
Although human DNA is more alike than different, there are many regions of human
chromosomes which vary between individuals. These regions form the basis for
genetic disease diagnosis, forensic identification and paternity testing. In this
experiment, the Polymerase Chain Reaction (PCR) is used to amplify a region of DNA
from chromosome 16. Chromosome 16 may contain an insertion of extra DNA called
an Alu insertion. The presence or absence of this insertion plays no role in the
health or well-being of a human because it is located in “junk” DNA. Individuals can
inherit one insertion (from one parent), two insertions (from both parents) or no
insertions at all. These differences can be observed using gel electrophoresis.
I.
Collection of DNA
1.
Pour all of the saline solution into your mouth and swish vigorously in your
mouth for 10 seconds. Save the empty tube for later.
2.
Expel the saline solution into a paper cup.
3.
Remove 1 ml of cells and solution and place in a 1.5ml tube.
Label cap of tube with assigned number. Write this number down!
ASSIGNED NUMBER:___________
4.
Spin the sample in a microfuge on high speed for 1 minute.
5.
Carefully pour off the supernatant (liquid on top) into the paper cup.
6.
Use a sterile toothpick to resuspend the cell pellet in the remaining saline
solution in the bottom of the tube.
7.
Transfer 30ul of the resuspended cells into 100ul of chelex. Close tube and
shake.
8.
Label top and side of tube with assigned number and boil for 10 minutes.
9.
After incubation, shake tube and spin in microfuge for 1 minute.
II. Amplification of DNA by PCR
10.
Use a fresh tip to add 2.5ul of the supernatant (contains DNA) to a small
PCR reaction tube (contains polymerase, primers and nucleotides) and tap to
mix.
11.
Place tube in thermal cycler for amplification. This will take about 1 hour
and 15 minutes.
III. Analysis of Amplified DNA by Gel Electrophoresis
12.
Pour agarose gels for electrophoresis.
13.
Use a fresh tip to add 20 ul of the PCR sample/loading dye mixture into your
assigned well in the gel.
14.
Electrophorese at 130 volts for 15 minutes.
15.
Stain gel with ethidium bromide (0.01%) for 10 minutes.
16.
View gels in UV box - are you heterozygous or homozygous?
Heterozygous
(+,-)
Homozygous
(-,-)
Homozygous
(+,+)
Heterozygous
(+,-)