Download Chromosomes Key - Iowa State University

DNA & Chromosomes
Supplemental Instruction
Iowa State University
Leader:
Course:
Instructor:
Date:
Lilli Howard
BIOL/GEN 313
Dr. Myers
01/23/14
1. If a specie's genome consists of 6,300,000 base pairs, how many genes does it contain?
a) 6,300,000
b) < 6,300,000
c) > 6,300,000
d) 0
2. About how many base pairs does a human genome contain?
a) 3.1 billion
b) 3.1 million
c) 3.1 trillion
d) 3.1 thousand
3. When relaxed DNA (10.4 bp/turn) becomes either under or over-coiled it is called what?
a) mega-coiled
b) coiled-coils
c) super-coiled
d) ultra-coiled
The coiling in question 3 is caused by what type of protein? _topoisomerase___
4. Prokaryotic chromosomes are different than Eukaryotic chromosomes because:
a) they are single stranded
b) they are located in the nucleus
c) they are circular
5. Explain the difference between a nucleosome and a chromatosome.
a) What are three other orders of condensation in chromatin?
Nucleosome: DNA + 8 core histones (two each of H2A, H2B, H3 & H4)
Chromatosome: DNA + 8 core histones + H1 histone
-30 nm fiber, 250 nm fiber, chromosome
6. During cell division spindle fibers attach to the chromosome at the _centromere__.
__kinetochore__ proteins also assemble at this point.
7. The DNA sequence at the end of chromosomes that consists of -CCC(A/T)- repeats is
called what? Why are these important?
Telomere – stabilize chromosome; play role in aging
8. Single copy sequences HFD
9. Gene families HB
10. Moderately repetitive GA
11. Highly repetitive EC
a) 100 – several thousand copies
b) 2 – 4 copies
c) 10,000 – 1,000,000 copies
d) present only once
e) < 10 bp
f) 1,000 – 10,000 bp
g) 150 – 350 bp
h) < 5% of genome
12. In epigenetic modification, alteration of the chromosome structure effects
(genotype/phenotype) and the DNA base sequence (is/is not) changed.
13. What is the meaning of the phrase, “chromatin structure is dynamic”?
-must dissociate for gene activity
-bases must be accessible
-different genes are active at different times and tissues
-DNase sensitivity
1060 Hixson-Lied Student Success Center  515-294-6624  [email protected]  http://www.si.iastate.edu
Assigned Problems p. 318-320
3. Describe the composition and structure of the nucleosome. How do core particles differ
from chromatosomes?
-Core particle + ~145 bp
-Chromatosome + H1 + ~145 bp
4. Describe in steps how the double helix of DNA, which is 2 nm in width, gives rise to a
chromosome that is 700 nm in width.
1.
2.
3.
4.
linear DNA
Nucleosomes
Chromatosomes
30 nm fiber
5. 250 nm Fiber
6. 700 nm Fiber
7. Chromosome
26. Suppose you examined polytene chromosomes from the salivary glands of fruit fly larvae
and counted the number of chromosomal puffs observed in different regions of DNA.
1. Would you expect to observe more puffs from euchromatin or from
heterochromatin?Why?
Euchromatin is less condensed and capable of being transcribed
Heterochromatin is highly condensed and rarely transcribed
Chromosomal puffs are sites of active transcription
2. Would you expect to observe more puffs in unique-sequence DNA, moderately
repetitive DNA, or in repetitive DNA? Why?
Highly repetitive DNA is simple tandem repeats and is rarely transcribed
Moderately repetitive DNA is transposons and also rarely transcribed
Most actively transcribed genes occur in single unique-sequence DNA
31. Which of the following two molecules of DNA has the lower melting temperature. Why?
AGTTACTAAAGCAATACATC
TCAATGAT TTCGTTATGTAG
because more AT bonds
AGGCGGGTAGGCACCCTTA
TCCGCCC ATCCG TGGGAAT
1060 Hixson-Lied Student Success Center  515-294-6624  [email protected]  http://www.si.iastate.edu