Download Name

Name __________________________
Biology
Pd _____
Date ______________________
Mr. Thompson
DNA Webquest
I. What is DNA?
1.Go to
http://gslc.genetics.utah.edu/units/basics/tour/
and click on What is DNA?, and answer the questions that follow.
a. All the instruction needed for growth and other functions are found in the
______________ of the ear cell.
b. What is the shape of the following:
1. Chromosomes :
2. DNA molecule :
c. What are the white lightning-bolt structures between the bases?
d. What are the sides of the DNA called?
e. Write down the following:
1. 24 letters (shown in yellow) that make up the DNA strand.
2. the words formed from the letters you just wrote.
3. the sentence formed from the words you just wrote.
f. The sentences made of three letter words produce _ _ _ _ _ _ _ _, which allow cells to perform
specific _ _ _ _ _ _ _ _ _.
2. At this point, click on What is a Gene? (located above the T.V. screen). Use the information
to answer the following questions.
a. Genes are instruction manuals for building _ _ _ _ _ _ _ _.
b. A protein called _______________ is found in red blood cells and transports
______________.
c. Draw a red blood cell that has been mutated and explain why itπs bad.
d. Specialized proteins are found in the _____ cells of an ear.
e. DNA is made of many _________, which are needed for instructions.
3. At this point, click on What is a Chromosome? (located above the T.V. screen). Use this
information to answer the questions that follow.
a. DNA is packaged into units called ______________.
b. DNA wrapped around _____________.
c. Do the 46 chromosomes shown belong to a male or female? Explain.
d. How many chromosomes does a carp have?
4. At this point click on What is heredity? and use the information to answer the questions
that follow.
a. Why don’t we look exactly like our parents?
b. How many different combinations of genes can each child get?
5. At this point click on What is a Protein and answer the questions that follow.
a. Proteins are tiny _______________ that help cells run.
b. What role do proteins play in pain?
c. What other role do proteins play in nerve cells?
d. Where do we get our proteins?
e. What is the blueprint for a particular protein?
f. What molecule is produced from DNA when a protein is needed?
g. What cellular structure reads the message and makes a protein according to it’s
directions?
h. What happens to a protein after it has been made?
6. Type: http://www.pbs.org/wgbh/aso/tryit/dna/,click on DNA workshop and then protein
synthesis to answer the questions that follow.
a. What is the first thing that happens to the DNA?
b. What did you do next with the RNA bases?
c. What happened to the RNA after it was finished?
d. What are the blue words that get moved around?
e. The order of the bases on the mRNA determines the order of the ___________________.
http://learn.genetics.utah.edu/content/begin/dna/transcribe/
7. Are you ready to transcribe a DNA sequence and translate into a protein?
The DNA that makes up the human genome can be subdivided into information bytes called
______________. Each gene encodes a unique ____________ that performs a specialized
function in the cell. The human genome contains more than __________________ genes.
Cells use the two-step process of ___________________ and ______________________ to read
each gene and produce the string of amino acids that makes up a protein. The basic rules for
translating a gene into a protein are laid out in the ________________________________.
Basic Steps of Protein Synthesis
1. DNA molecule is unzipped by special enzymes that allow ___________ to be made from
the DNA template.
2. The process of creating RNA from DNA is called ________________________.
3. Using the small DNA sequence (gene) below, transcribe (rewrite the code) for a RNA
molecule
DNA Strand: ATTACGATCTGCACAAGATCCT
RNA Strand: ______________________________
Hint: Uracil replaces Thymine in RNA!
4. The mRNA strand produced will deliver the __________________ or recipe needed to
make a specific protein.
5. Information is stored on the RNA molecule in a triplet code called a ________________.
6. Codons are a sequence of __________ nitrogen bases that code for a specific amino acid.
7. The mRNA strand will leave the nucleus and attach itself to a __________________, the
site of protein synthesis.
8. When attached to a ribosome, the process of ____________________ will occur which
is the process of translating the mRNA codons into specific proteins.
9. Translation always begins when tRNA bonds will the universal start codon __________.
10. ________________________ is always the first amino acid that begins the formation of
proteins.
11. tRNA’s main job is to translate mRNA’s code and ________________/place the specific
amino acid in the correct sequence based on the code.
12. After the AUG start codon is translated, the next three nucleotides (codon) are
_____________ and another amino acid is added to the growing polypeptide.
13. Each sequence of three nucleotides corresponds with a ________________ amino acid.
14. Amino acids will continue to be added to the growing polypeptide (protein) until one the
3 _____________ codons are reached.
15. Continue Translating the mRNA strand produced in question #3, complete amino acid
sequence below:
Methionine - _________-___________-___________- ____________-___________ - STOP
16. Codons are found on mRNA and anitcodons are found on ____________.
EX. If the mRNA codon is AUG, then the tRNA anticodon would be
UAC
17. What would the anticodon be for AUG?
18. What would the anticodon be for UUU?
19. What would the anticodon be for AAG?
20. What would the anticodon be for CCG?
If time is available, try transcribing and translating the virtual gene again!!!