* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Name
Nutriepigenomics wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Protein moonlighting wikipedia , lookup
Transfer RNA wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Genealogical DNA test wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
History of RNA biology wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Designer baby wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Non-coding RNA wikipedia , lookup
Messenger RNA wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Molecular cloning wikipedia , lookup
Epigenomics wikipedia , lookup
Microevolution wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Non-coding DNA wikipedia , lookup
DNA supercoil wikipedia , lookup
Genome editing wikipedia , lookup
DNA vaccination wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Expanded genetic code wikipedia , lookup
History of genetic engineering wikipedia , lookup
Epitranscriptome wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Point mutation wikipedia , lookup
Genetic code wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Primary transcript wikipedia , lookup
Helitron (biology) wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Name __________________________ Biology Pd _____ Date ______________________ Mr. Thompson DNA Webquest I. What is DNA? 1.Go to http://gslc.genetics.utah.edu/units/basics/tour/ and click on What is DNA?, and answer the questions that follow. a. All the instruction needed for growth and other functions are found in the ______________ of the ear cell. b. What is the shape of the following: 1. Chromosomes : 2. DNA molecule : c. What are the white lightning-bolt structures between the bases? d. What are the sides of the DNA called? e. Write down the following: 1. 24 letters (shown in yellow) that make up the DNA strand. 2. the words formed from the letters you just wrote. 3. the sentence formed from the words you just wrote. f. The sentences made of three letter words produce _ _ _ _ _ _ _ _, which allow cells to perform specific _ _ _ _ _ _ _ _ _. 2. At this point, click on What is a Gene? (located above the T.V. screen). Use the information to answer the following questions. a. Genes are instruction manuals for building _ _ _ _ _ _ _ _. b. A protein called _______________ is found in red blood cells and transports ______________. c. Draw a red blood cell that has been mutated and explain why itπs bad. d. Specialized proteins are found in the _____ cells of an ear. e. DNA is made of many _________, which are needed for instructions. 3. At this point, click on What is a Chromosome? (located above the T.V. screen). Use this information to answer the questions that follow. a. DNA is packaged into units called ______________. b. DNA wrapped around _____________. c. Do the 46 chromosomes shown belong to a male or female? Explain. d. How many chromosomes does a carp have? 4. At this point click on What is heredity? and use the information to answer the questions that follow. a. Why don’t we look exactly like our parents? b. How many different combinations of genes can each child get? 5. At this point click on What is a Protein and answer the questions that follow. a. Proteins are tiny _______________ that help cells run. b. What role do proteins play in pain? c. What other role do proteins play in nerve cells? d. Where do we get our proteins? e. What is the blueprint for a particular protein? f. What molecule is produced from DNA when a protein is needed? g. What cellular structure reads the message and makes a protein according to it’s directions? h. What happens to a protein after it has been made? 6. Type: http://www.pbs.org/wgbh/aso/tryit/dna/,click on DNA workshop and then protein synthesis to answer the questions that follow. a. What is the first thing that happens to the DNA? b. What did you do next with the RNA bases? c. What happened to the RNA after it was finished? d. What are the blue words that get moved around? e. The order of the bases on the mRNA determines the order of the ___________________. http://learn.genetics.utah.edu/content/begin/dna/transcribe/ 7. Are you ready to transcribe a DNA sequence and translate into a protein? The DNA that makes up the human genome can be subdivided into information bytes called ______________. Each gene encodes a unique ____________ that performs a specialized function in the cell. The human genome contains more than __________________ genes. Cells use the two-step process of ___________________ and ______________________ to read each gene and produce the string of amino acids that makes up a protein. The basic rules for translating a gene into a protein are laid out in the ________________________________. Basic Steps of Protein Synthesis 1. DNA molecule is unzipped by special enzymes that allow ___________ to be made from the DNA template. 2. The process of creating RNA from DNA is called ________________________. 3. Using the small DNA sequence (gene) below, transcribe (rewrite the code) for a RNA molecule DNA Strand: ATTACGATCTGCACAAGATCCT RNA Strand: ______________________________ Hint: Uracil replaces Thymine in RNA! 4. The mRNA strand produced will deliver the __________________ or recipe needed to make a specific protein. 5. Information is stored on the RNA molecule in a triplet code called a ________________. 6. Codons are a sequence of __________ nitrogen bases that code for a specific amino acid. 7. The mRNA strand will leave the nucleus and attach itself to a __________________, the site of protein synthesis. 8. When attached to a ribosome, the process of ____________________ will occur which is the process of translating the mRNA codons into specific proteins. 9. Translation always begins when tRNA bonds will the universal start codon __________. 10. ________________________ is always the first amino acid that begins the formation of proteins. 11. tRNA’s main job is to translate mRNA’s code and ________________/place the specific amino acid in the correct sequence based on the code. 12. After the AUG start codon is translated, the next three nucleotides (codon) are _____________ and another amino acid is added to the growing polypeptide. 13. Each sequence of three nucleotides corresponds with a ________________ amino acid. 14. Amino acids will continue to be added to the growing polypeptide (protein) until one the 3 _____________ codons are reached. 15. Continue Translating the mRNA strand produced in question #3, complete amino acid sequence below: Methionine - _________-___________-___________- ____________-___________ - STOP 16. Codons are found on mRNA and anitcodons are found on ____________. EX. If the mRNA codon is AUG, then the tRNA anticodon would be UAC 17. What would the anticodon be for AUG? 18. What would the anticodon be for UUU? 19. What would the anticodon be for AAG? 20. What would the anticodon be for CCG? If time is available, try transcribing and translating the virtual gene again!!!