Download DNA REVIEW SHEET

DNA REVIEW SHEET
1. Who discovered the structure of DNA?
2. Who did much of the research?
3. What is the shape of DNA?
4. What does DNA stand for?
5. What does RNA stand for?
6. Name the DNA nitrogen bases.
7. Name the RNA nitrogen bases.
8. What is the name of the process where RNA is made from DNA?
9. List 6 amino acids.
10. How many nitrogen bases make up a codon?
11. What does ligase do in DNA replication?
12. How many nitrogen bases bond to make the DNA sides connect?
13. How many amino acids exist?
14. What are the three kinds of RNA?
15. Where is an anticodon located?
16. A codon that has no anticodon match would be called a ___________________.
17. What does DNA polymerase do?
18. Anything ending in –ase would be classified as an ____________________>
19. What 3 things make up DNA?
20. DNA is compared in structure to what?
21. What does DNA stand for?
22. How many codons exist?
23. How many do not code for an amino acid?
24. What does helicase do?
25. Name 2 differences between DNA & RNA.
26. Which molecule is single-stranded?
27. What is the end result in DNA replication?
28. Explain the fact that there are 3 times more codons than amino acids.
29. Name the 3 stop codons. Which RNA are they located on? Where did they get
the name “stop” codon?
30. What is the name of the sugar in RNA?
31. What is the name of the sugar in DNA?
32. What is a nucleotide?
33. What is the energy source in DNA replication?
34. Since DNA keeps the original copy of DNA, it is considered to be what type of
replication?
35. What is a template? What acts as the template in DNA replication?
36. What is translation?
37. What 3 things make up RNA?
38. What are 2 differences between tRNA & mRNA?
39. What thing is tRNA compared to in shape?
40. Where does translation occur? Transcription? Where is DNA located?
41. Draw & explain the steps of replication….label ALL parts.
AGTCTGTACTGACTCAGTGTACAAGACGTGAGCGA
42. Replicate the above DNA strand.
43. Show the steps of transcription for the original strand.
44. Give the protein fragment for the original strand.
45. Change the 5th nucleotide to “A” and give the protein fragment.
46. Delete the 8th nucleotide & give the protein fragment.
47. Label the following: