Download 11-GeneTech

Biol 131
Question Bank
Biotechnology
1. For each of the following sentences, fill in the blanks with the best word or phrase selected from
the list below.
A nuclease hydrolyzes the __________________ bonds in a nucleic acid, and nucleases that
cut DNA only at specific sequences are called __________________.
Often, DNA
fragments are cloned by placing them in a ______________ in which the DNA can be
replicated within bacteria. Alternatively, the DNA sequence can be replicated entirely in
vitro using the __________________ technique. A population of bacteria possessing
plasmids with DNA fragments spanning the entire genome of another organism is called a
__________________. A _____________ consists of short DNA molecules of a specific
sequence that are used to identify which bacteria contain recombinant DNA for a specific
gene.
DNA sequencing
phosphodiester
endonucleases
polymerase chain reaction
exonucleases
recombinant DNA
genomic library
restriction nucleases
probe
plasmid
↓
2. The restriction endonuclease BamHI has a restriction site of GGATCC.
A. How many fragments would BamHI generate from a segment of DNA with the following
sequence? _________
B. Mark the boundaries between fragments that would be produced.
TTGCGCGATTTGGATCCTAGCGTAAACGGATCCTTAACGCGGATCCCGATATAT
AACGCGCTAAACCTAGGATCGCATTTGCCTAGGAATTGCGCCTAGGGCTATATA
3.
Place the following steps of the gene cloning in their correct order (number from 1 to 7).
____ Bacteria are plated and grown as isolated colonies
____ DNA is cut into fragments with endonuclease
____ Plasmids containing a specific DNA fragment are identified
____ DNA is isolated from original source
____ DNA is ligated into plasmids
____ Bacteria containing plasmids with DNA insert are identified
____ Bacteria are allowed to take up DNA
Biol 131
Question Bank
Biotechnology
Page 1
4. A. What charge does DNA normally have? ( negative / neutral / positive )
B. On the diagram to the right, indicate where the “+” and “-“ would need to be
for the DNA to migrate down the page.
C. Circle the band that would correspond to the smallest pieces of DNA.
5. The single-stranded ends of DNA fragments created by restriction
endonucleases are said to be ‘sticky’ because they:
A. bind to restriction endonuclease-type enzymes.
B. stick to the outside of bacteria and then are taken up into the cells.
C. have a short stick-like appearance when viewed with an electron microscope.
D. can form hydrogen bonds to sequences with a complementary sequence.
6. In the movie Jurassic Park, small amounts of dinosaur DNA were purified from blood cells in
preserved mosquitoes. Which specific technique would be best suited to amplify the small
amounts of dinosaur DNA from this source?
A. probing with complementary DNA
B. virus mediated cloning
C. PCR
D. plasmid mediated cloning
7. Suppose that you performed a typical gene cloning experiment, but inserted the DNA fragments
into the middle of the ampicillin gene instead of the LacZ’ gene. After allowing the cells to take
up the plasmids, they were then plated on the usual media containing ampicillin and X-gal. Which
one of the following statements correctly describes the expected result of this mistake?
A. None of the colonies would take on a blue coloration.
B. Bacteria that received a plasmid with a DNA fragment would not grow.
C. All of the bacteria would grow on the media and form colonies.
D. Bacteria that took up a plasmid with a DNA fragment would form a blue colony.
8. The LacZ’ gene is included in plasmids used for cloning of DNA fragments for which one of the
following reasons?
A. It provides a means to identify which bacteria have taken up a recombinant plasmid.
B. It allows the bacteria to grow on the selective media on which they will be plated.
C. It allows the bacteria to use X-gal as a nutritional source.
D. Bacteria can only take up plasmids that have a functional LacZ’ gene.
Biol 131
Question Bank
Biotechnology
Page 2
9. You are trying to clone a piece of human DNA into a plasmid using the LacZ gene system. It is
important to understand what happened if something doesn’t occur as expected. What results
would you expect in the following situations:
A. What types of colonies would you expect if the restriction enzyme that you used to cut the
plasmid and the insert DNA didn’t work?
____________________________________________________________
B. What type of colonies would you expect if the restriction enzyme worked, but the ligase was
not able to connect the sugar phosphate backbone? (The sugar-phosphate backbone must be
complete for the plasmid to be replicated in the bacterium)
____________________________________________________________
10. Isolating genes often begins by purifying the mRNA for a protein, and than converting it from
from RNA to DNA using an enzyme called _____________________. The resulting DNA
molecule is called ___________, and can be used as a probe to find the original gene in a genomic
library.
A. Why would it not be possible to instead purify the protein, determine its amino acid
sequence, and from this deduce the base sequences of the mRNA and gene?
___________________________________________________________________
B. A cDNA is often much shorter than the original gene when the mRNA is from a eukaryotic
source, but they are essentially the same in length when the mRNA is a prokaryote. Why?
___________________________________________________________________
11. Southern Blotting is a process used to find DNA fragments separated by gel electrophoresis that
contain a particular sequence.
A. Why is it first necessary to transfer the DNA fragments from the agarose gel to nitrocellulose?
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
B. “Probing” of the nitrocellulose refers to incubation with short DNA molecules that are labeled
with ________, and that have a sequence that is ___________________ (complementary to /
same as) the sequence being sought.
Biol 131
Question Bank
Biotechnology
Page 3
PCR
12. PCR would be the method of choice to:
A. Determine the base sequence of a DNA fragment
B. Clone a gene isolated from bacteria
C. Insert a DNA fragment into a plasmid
D. Clone a DNA sequence from a small DNA sample
13. Polymerase Chain Reactions involve three steps. The correct order of those steps is
A. denaturation, annealing of primers, primer extension
B. annealing of primers, denaturation, primer extension
C. primer extension, annealing of primers, denaturation
14. Suppose that you wished to copy the region of DNA between the two points indicated below using
PCR.
↓
3’ TTGCGCGATTTGGATCCTAGCGTAAACCGATCCTTAACGCGGATCCCGATATAT
5’ AACGCGCTAAACCTAGGATCGCATTTGGCTAGGAATTGCGCCTAGGGCTATATA

5’
3’
A. Should the primers lie within or outside of the region to be copied? _____________________
B. If you used primers that were 6 bases in length, what would be the sequence of the primers
(remember that DNA polymerase replicates by moving from the 3’ to the 5’ end of the
template.
5’ __ __ __ __ __ __ 3’
5’ __ __ __ __ __ __ 3’
C. How many cycles would it take to generate 128 copies of the sequence?
15. Most commonly Taq DNA polymerase is used for PCR. This form of DNA polymerase was
originally isolated from the bacteria Thermus aquaticus, found in hydrothermal pools of
Yellowstone National Park.
A. What property of Taq polymerase makes it particularly useful for PCR? _______________
_________________________________________________________________________
B. During which stage of the PCR is this property important? _________________________
C. What would happen to a normal form of DNA polymerase under these conditions?
____________________________________________________________________
Biol 131
Question Bank
Biotechnology
Page 4
DNA sequencing
16. A. In the Sanger method of DNA sequencing, DNA polymerase is used to create a new DNA
strand complementary to the one being sequenced. In order to determine the relative position
of each base type, this process must be performed _____ times, and each reaction is performed
by adding a ______ (low / high) concentration of a modified “dideoxy-“ nucleotide.
B. In your own words, explain the principles of the Sanger method of DNA sequencing. i.e.,
explain why the dideoxy-nucleotides are added to the DNA polymerase reaction mixtures, and
why these lead to formation different length fragments:
17. For the diagram to the right:
A. Label the ends of the gel that have the smaller and
larger fragments.
B. Label the ends of the gel that would represent the 3’
and 5’ ends of the DNA fragments.
C. Determine the DNA sequence in the 5’ to 3’ direction
5’ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ 3’
Biol 131
Question Bank
Biotechnology
Page 5