Download Manipulating DNA

Manipulating DNA
In recent years, new varieties of farm plants
and animals have been engineered by
manipulating their genetic instructions to
produce new characteristics.
DNA extraction activity
 In the past, variation was limited to
the variations already in nature or
random variations that resulted from
mutations.
 Now, scientists can change DNA and
swap genes from one organism to
another, designing new living things.
Molecular Biology Tools
 Remember: Genetic engineering is making
changes to DNA
 The steps include:




DNA extraction (removal)
Cutting DNA
Separating DNA
Making copies of DNA
DNA Extraction
 Using a simple
chemical procedure,
cells are opened and
DNA is separated
and removed from
the other cell parts.
 Have you ever had to cut something very small at a precise
spot? How did you determine where and how to cut it? What do
you end up with?
 1. Look at the series of DNA nucleotides on your sheet of paper.
GTACTAGGTTAACTGTACTATCGTTAACGTAAGCTACGTTAACCTA
 2. Look carefully at the series, and find this sequence of letters:
GTTAAC. It may appear more than once. How many
occurrences of the sequence GTTAAC can you find?
 3. When you find it, divide the sequence in half with a mark of
your pencil. You will divide it between the T and the A. This
produces short segments of DNA. How many times would you
cut the DNA? How many fragments have 6, 10, & 15 bases?
Cutting DNA
 DNA is too large to be analyzed, so it is
precisely cut into smaller fragments
using restriction enzymes
 Each restriction enzyme cuts DNA at a
specific sequence of nucleotides
Restriction Enzymes
Section 13-2
Recognition sequences
DNA sequence
Restriction enzyme
EcoRI cuts the DNA
into fragments.
Go to
Section:
Sticky end
Restriction Enzymes
Section 13-2
Recognition sequences
DNA sequence
Restriction enzyme
EcoRI cuts the DNA
into fragments.
Go to
Section:
Sticky end
Separating DNA
 DNA fragments are separated and
analyzed using gel electrophoresis.
 DNA is placed at one end of a gel and an
electric current pulls negatively charged DNA
molecule toward the positive end of the gel
 Smaller DNA fragments move faster and
farther across the gel
 Gel electrophoresis is used to compare DNA
of different organisms or identifying one
particular gene
http://www.dnalc.org/ddnalc/resources/electrophoresis.html
Figure 13-6 Gel Electrophoresis
Section 13-2
Power
source
DNA plus restriction
enzyme
Longer
fragments
Shorter
fragments
Mixture of DNA
fragments
Go to
Section:
Gel
DNA Sequencing
 Now that the DNA is in manageable form,
the DNA sequence can be read, studied or
changed to study specific genes, compare
genes of different organisms, and try to
identify the function of different genes.
Reading the DNA sequence:
 Obtain a single stranded piece of an organism’s
DNA.
 As it replicates with bases labeled with color
coded fluorescent dyes, the replication stops
forming a fragment.
 After all of the DNA has replicated, tiny labeled
fragments are left.
 The fragments are separated by gel
electrophoresis and the pattern of the color
coded fragments is read, telling scientists the
exact DNA sequence.
Figure 13-7 DNA Sequencing
Section 13-2
Fluorescent
dye
Single strand
of DNA
Strand broken
after A
Power
source
Strand broken
after C
Strand broken
after G
Strand broken
after T
Go to
Section:
Gel
Cutting and Pasting
 Now that the DNA
sequence is known,
it can be changed.
 Scientists can take a
gene (piece of DNA)
from one organism
and attach it to the
DNA of another
organism =
Recombinant DNA
(combined DNA)
Making Copies
 Scientists need many copies of a gene to
study it, so they use a polymerase chain
reaction (PCR):
 Scientists add primers (short complementary
pieces of DNA) to both ends of the gene, the
double stranded DNA is separated into single
strands, then DNA polymerase makes copies
of the DNA between the primers, and each
copy serves as another template.
Figure 13-8 PCR
Section 13-2
DNA polymerase adds
complementary strand
DNA heated to
separate strands
DNA fragment
to be copied
Go to
Section:
PCR
cycles 1
2
3
4
5 etc.
DNA
copies 1
2
4
8
16 etc.