* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download 7a MicrobialGenetics-DNARNA
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Genetic code wikipedia , lookup
Messenger RNA wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Polyadenylation wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Genealogical DNA test wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Genetic engineering wikipedia , lookup
Epigenetics of human development wikipedia , lookup
DNA polymerase wikipedia , lookup
Designer baby wikipedia , lookup
RNA silencing wikipedia , lookup
Molecular cloning wikipedia , lookup
DNA vaccination wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Epigenomics wikipedia , lookup
Nucleic acid tertiary structure wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
DNA supercoil wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Non-coding DNA wikipedia , lookup
Microevolution wikipedia , lookup
Epitranscriptome wikipedia , lookup
Point mutation wikipedia , lookup
History of RNA biology wikipedia , lookup
History of genetic engineering wikipedia , lookup
Helitron (biology) wikipedia , lookup
Non-coding RNA wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Microbial Genetics: DNA and RNA What chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used inside the cell to direct the production of new molecules? • • The Need for Protein Making Instructions • Phenotype = genotype (+ environment) • 1 chromosome gene ---> 1 protein • DNA-->RNA (copy)-->protein production Structure of DNA, The Genetic Material • Two polynucleotide strands with H bonds • • • • RNA is single stranded, difft sugar, uracil How DNA copies itself when a cell divides • DNA replication by unzipping • DNA polymerase enzyme synthesizes new complementary strands --> 2 new helices Transcription: Making a short DNA copy • • • DNA + protein make up a chromosome RNA polymerase makes RNA from DNA • Only one set of instructions (gene) is copied • Copy is complementary to the DNA gene • In eukaryotes, the RNA copy is edited The Three Kinds of RNA • mRNA: carries instructions for 1 protein • rRNA: structural support in ribosomes • tRNA: amino acid trucks with anticodons Steps of Translation (Protein Synthesis) DNA, the genetic material, replicates by semiconservative replication. It is further copied in transcription for use in building proteins for the cell. Flow of Genetic Information Figure 8.2 DNA is a Double-Stranded Chain of Nucleotides DNA Figure 8.4 Microbial Genetics: DNA and RNA What chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used inside the cell to direct the production of new molecules? • • The Need for Protein Making Instructions • Phenotype = genotype (+ environment) • 1 chromosome gene ---> 1 protein • DNA-->RNA (copy)-->protein production Structure of DNA, The Genetic Material • Two polynucleotide strands with H bonds • DNA + protein make up a chromosome • • • RNA is single stranded, difft sugar, uracil How DNA copies itself when a cell divides • DNA replication by unzipping • DNA polymerase enzyme synthesizes new complementary strands --> 2 new helices Transcription: Making a short DNA copy • RNA polymerase makes RNA from DNA • Only one set of instructions (gene) is copied • Copy is complementary to the DNA gene • In eukaryotes, the RNA copy is edited • The Three Kinds of RNA • mRNA: carries instructions for 1 protein • rRNA: structural support in ribosomes • tRNA: amino acid trucks with anticodons DNA, the genetic material, replicates by semiconservative replication. It is further copied in transcription for use in building proteins for the cell. DNA Replication is Semiconservative Figure 8.3 DNA • DNA replication is semiconservative Figure 8.7 DNA Replication Involves Several Enzymes Figure 8.6 Central Dogma are of Biology: How Shape Form Are Dictated By DNA Genes DNA Genes Instructions for and Making Specific Polypeptides Genotype: The genes carried in a cell for a particular trait Phenotype: The physical expression of genes for a particular trait QuickTime™ and a decompressor are needed to see this picture. A segment of DNA (gene) carries specific coded instructions for the making of a single proteins. Microbial Genetics: DNA and RNA What chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used inside the cell to direct the production of new molecules? • • The Need for Protein Making Instructions • Phenotype = genotype (+ environment) • 1 chromosome gene ---> 1 protein • DNA-->RNA (copy)-->protein production Structure of DNA, The Genetic Material • Two polynucleotide strands with H bonds • DNA + protein make up a chromosome • • • RNA is single stranded, difft sugar, uracil How DNA copies itself when a cell divides • DNA replication by unzipping • DNA polymerase enzyme synthesizes new complementary strands --> 2 new helices Transcription: Making a short DNA copy • RNA polymerase makes RNA from DNA • Only one set of instructions (gene) is copied • Copy is complementary to the DNA gene • In eukaryotes, the RNA copy is edited • The Three Kinds of RNA • mRNA: carries instructions for 1 protein • rRNA: structural support in ribosomes • tRNA: amino acid trucks with anticodons DNA, the genetic material, replicates by semiconservative replication. It is further copied in transcription for use in building proteins for the cell. Transcription is Performed by RNA Polymerase Translation or Protein Synthesis Figure 8.2 Anatomy ofaaChain Messenger RNA mRNA is of Nucleotides Trailer Leader Figure 10.17 Microbial Genetics: DNA and RNA What chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used inside the cell to direct the production of new molecules? • • The Need for Protein Making Instructions • Phenotype = genotype (+ environment) • 1 chromosome gene ---> 1 protein • DNA-->RNA (copy)-->protein production Structure of DNA, The Genetic Material • Two polynucleotide strands with H bonds • DNA + protein make up a chromosome • • • RNA is single stranded, difft sugar, uracil How DNA copies itself when a cell divides • DNA replication by unzipping • DNA polymerase enzyme synthesizes new complementary strands --> 2 new helices Transcription: Making a short DNA copy • RNA polymerase makes RNA from DNA • Only one set of instructions (gene) is copied • Copy is complementary to the DNA gene • In eukaryotes, the RNA copy is edited • The Three Kinds of RNA • mRNA: carries instructions for 1 protein • rRNA: structural support in ribosomes • tRNA: amino acid trucks with anticodons DNA, the genetic material, replicates by semiconservative replication. It is further copied in transcription for use in building proteins for the cell. 3 Types of RNA – Each With a Different Job Messenger RNA (mRNA) Carries copy of gene information to the ribosome to make protein anticodon Transfer RNA (tRNA) CUG = CUG Carries amino acids to the ribosome for linking; identified by anticodon “sign” Ribosomal RNA (rRNA) Part of the structure of the ribosome; key component in amino acid linking machinery How Gene Instructions are Communicated mRNA Codon Dictionary of the Genetic Code Central Dogma: DNARNAProtein DNA template strand: CGTTTACGACCGGCCTTAGATCCTGACG Transcription mRNA: GCAAAUGCUGGCCGGAAUCUAGGACUGC Translation Protein: by RNA polymerase by ribosome Met - Leu - Ala - Gly - Ile Translation in Prokaryotes Can Occur Simultaneously With Transcription Figure 8.11 A Ribosome Has Two Subunits and Three tRNA Binding Sites Translation: Initiation, Elongation, Termination Initiation Elongation (3-4 steps) Termination Steps of Translation Protein Synthesis Movie