* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download plasmid to transform
Epigenetics wikipedia , lookup
DNA methylation wikipedia , lookup
Human genome wikipedia , lookup
DNA barcoding wikipedia , lookup
Nutriepigenomics wikipedia , lookup
DNA sequencing wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Designer baby wikipedia , lookup
Metagenomics wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
Genetic engineering wikipedia , lookup
Point mutation wikipedia , lookup
Cancer epigenetics wikipedia , lookup
DNA profiling wikipedia , lookup
Microevolution wikipedia , lookup
Primary transcript wikipedia , lookup
DNA polymerase wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
SNP genotyping wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Non-coding DNA wikipedia , lookup
Microsatellite wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
DNA vaccination wikipedia , lookup
Genome editing wikipedia , lookup
Genomic library wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Epigenomics wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
DNA supercoil wikipedia , lookup
Helitron (biology) wikipedia , lookup
Molecular cloning wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Fall 2008 • Electrophoresis is a molecular technique that separates nucleic acids and proteins based on Size and +-+Charge+-+ DNA is a negatively charged molecule and therefore is attracted to positive charges. Agarose provides a matrix through which DNA molecules migrate. • Size – larger molecules move through the matrix slower than small molecules • Concentration – the higher the concentration of agarose, the better the separation of small fragments How to make an agarose gel…. • • • • • Weigh out a specified amount of agarose powder. Add the correct amount of buffer. Dissolve the agarose by boiling the solution. Pour the gel in a casting tray. Wait for the gel to polymerize. • Vector – DNA source which can replicate and is used to carry foreign genes or DNA fragments. Plasmid Lambda phage Recombinant DNA – A vector that has taken up a foreign piece of DNA. Restriction enzyme – an enzyme which binds to DNA at a specific base sequence and then cuts the DNA. • Restriction enzymes are named after the bacteria from which they were isolated. a. Bacteria use restriction enzymes to “chop up” foreign viral DNA. Recognition site – specific base sequence on DNA where a restriction enzyme binds. a. All recognition sites are palindromes, which means they read the same way forward and backward. (example: RACECAR or GAATTC CTTAAG b. Each restriction enzyme has its own unique recognition site. • After cutting up a long piece of DNA, you can run the samples on an agarose gel. a. The smaller fragments migrate further than the longer fragments. b. The bands are compared to standard DNA of known sizes. This is often called a DNA marker, or a DNA ladder. http://207.207.4.198/pub/flash/4/4.html After analyzing your results, you draw a restriction map of the cut sites. a. A restriction map is a diagram of DNA showing the cut sites of a series of restriction enzymes. Restriction enzymes cut in the middle of the recognition site. a. When restriction enzymes cut down the middle of the sequence, blunt ends are generated. Example: GATC CTAG GA + TC CT AG b. When restriction enzymes cut in a zig zag pattern, sticky ends are generated. Example: GAATTC CTTAAG G + CTTAAG AATTC G i. ii. Sticky ends are very useful because if two different pieces of DNA are cut with the same restriction enzyme, the overhanging sticky ends will complementarily base pair, creating a recombinant DNA molecule. DNA ligase will seal the nick in the phosphodiester backbone. Bacterial Transformation – bacteria take up and express foreign DNA, usually a plasmid. •Plasmid – circular piece of DNA Steps of Bacterial Transformation 1. Choose a bacterial host. a. E.coli is a model organism. i. Well studied ii. No nuclear membranes iii.Has enzymes necessary for replication DNA/ Chrom. Steps of Bacterial Transformation 2. Choose a plasmid to transform. a. Characteristics of a useful plasmid. i. Single recognition site • Plasmid only cuts in one place, so this ensures that the plasmid is reformed in the correct order. ii. Origin of replication • Allows plasmid to replicate and make copies for new cells. iii. Marker genes • Identifies cells that have been transformed. gene for antibiotic resistance – bacteria is plated on media with an antibiotic, and only bacteria that have taken up a plasmid will grow gene that expresses color – bacteria that have taken up a recombinant plasmid are a different color than bacteria that have taken up a NONrecombinat vector. Steps of Bacterial Transformation 3. Prepare bacterial cells for transformation of plasmid. a. Treat with calcium chloride, which allows plasmid to pass through bacterial cell walls. This is the most common method. b. Electroporation - brief electric pulse c. Directly inject plasmid into bacterial cell. Steps of Bacterial Transformation 4. Plate transformation solution on appropriate media. a. Contains nutrients for bacteria. b. Contains antibiotic to distinguish transformed bacteria from NONtransformed bacteria. 5. Incubate plates overnight. a. E.coli grows in the human body, and is therefore incubated at body temperature (37°C) 6. Analyze plates. http://www.sumanasinc.com/webcontent/animations/content/plasmidcloning.html http://www.sumanasinc.com/webcontent/animations/content/dnalibrary.html Chromosome Walking POLYMERASE CHAIN REACTION "PCR has transformed molecular biology through vastly extending the capacity to identify, manipulate and reproduce DNA. It makes abundant what was once scarce -- the genetic material required for experimentations." • The purpose of PCR is to amplify small amounts of DNA to produce enough for analysis. Reaction Requirements • Template – starting amount of DNA • Target – segment of DNA you wish to amplify Reaction Requirements • Primers – short pieces of single stranded DNA that binds to the template DNA. Allows DNA polymerase to to attach and begin replication. 3’-TACGACCCGGTGTCAAAGTTAGCTTAGTCA-5’ 5’-ATGCT-3’ 3’-AGTCA-5’ 5’-ATGCTGGGCCACAGTTTCAATCGAATCAGT-3’ Reaction Requirements • Polymerase – attaches nucleotides to the template. • Taq polymerase is extracted from bacteria that live in hot springs, so they remain active at temperatures up to 90°C. 3’-TACGACCCGGTGTCAAAGTTAGCTTAGTCA-5’ 5’-ATGCTGGGCCACAGTTT-3’ 3’- AAGTTAGCTTAGTCA-5’ 5’-ATGCTGGGCCACAGTTTCAATCGAATCAGT-3’ Reaction Requirements • Magnesium – required for DNA polymerase to work • Nucleotides – needed to make new DNA segments • Buffer – maintain constant pH • Thermocycler – machine that cycles through required temperatures STEPS: 1. Heat samples to 90°C for a minute or so to separate double stranded template DNA. STEPS: 2. Drop temperature to around 50 or 60°C to allow primers to anneal. STEPS: 3. Maintain temperature at 70°C for a minute or two to allow the polymerase to elongate the new DNA strands. 4. Repeat denaturation, annealing, and synthesis steps over and over and over. http://www.sumanasinc.com/webcontent/animations/content/pcr.html * PCR amplification is logarithmic, meaning the number of copies is doubled with every cycle. 2n Human Genome Project Francis Collins Craig Venter Who owns your DNA? Automated Sequencing G labeled with blue dye A labeled with red dye T labeled with green dye C labeled with black dye Medicine Evolutionary Biology The Genome is mapped…. Now what?????? <> Southern Blotting • Developed by Edward Southern. • Hybridization technique in which a DNA probe binds to DNA. • Used to determine if a specific DNA sequence is present in a sample or where a band containing a specific sequence is located on a gel. Procedure for Southern Blotting 1. Cut genomic DNA with restriction enzymes and run on an agarose gel. Procedure for Southern Blotting 2. Transfer DNA to a nylon membrane. Procedure for Southern Blotting 3. Hybridize a DNA probe to specific sequences on the membrane. • The probe will only bind if it is complementary to the DNA sequence. GATCCGCTATGTGGGCTGAC GGCGATACAC Procedure for Southern Blotting 4. You will only visualize bands where the probe has hybridized to the DNA. http://learn.genetics.utah.edu/units/biotech/microarray/