Download Chapter 12

Chapter 12 - DNA Technology and the Human Genome
Genetically modify organisms and transgenic organisms
Genetically modified organisms (GMO’s):
-Organisms whose genes have been altered using genetic
engineering techniques.
Transgenic organisms
- Most GMO’s are transgenic organisms… they have
received genes from a different organism.
Ex. A mouse is given a gene from a human. The mouse is
a transgenic GMO.
Chapter 12 - DNA Technology and the Human Genome
Genetically modify organisms (GMO’s) and transgenic organisms
GMO’s at home:
Zebra danio
GloFish
1. Zebra danio was genetically engineered with a gene from
sea coral that causes the fish to glow in the presence of
environmental toxins.
2. Gene was inserted into the embryo of the fish.
3. First GMO available as a pet.
Chapter 12 - DNA Technology and the Human Genome
Genetically modify organisms (GMO’s) and transgenic organisms
GMO’s in research:
GFP (green fluorescent prote
GFP Mice
1. Gene from a jellyfish (Aequorea
victoria) that codes for GFP was
inserted into the embryos of mice.
Aequorea victoria
(jellyfish, phylum cnidaria)
Chapter 12 - DNA Technology and the Human Genome
Genetically modify organisms (GMO’s) and transgenic organisms
GMO’s in research:
GFP (green fluorescent protein)
1. GFP is used in cellular and molecular biology.
2. You can attach this protein to any other protein you want
making it a reporter protein.
- It “reports” to you where the protein is going (similar to
radioactivity in that sense)
Chapter 12 - DNA Technology and the Human Genome
Genetically modify organisms (GMO’s) and transgenic organisms
GMO’s in research:
Ex.
- GFP has been attached to a protein called MFD, which is
found in peroxisomes.
- Those little green dots are peroxisomes…
- You can track any protein you want…in a single cell or an entire
Chapter 12 - DNA Technology and the Human Genome
Genetically modify organisms and transgenic organisms
GMO food:
Bt Corn
European Corn Borer Larv
1. Corn plants containing Cry genes from a bacterium – Bacillus
thurengensis.
2. The genes code for enzymes that produce a toxin
(insecticide), Bt toxin, which will kill European corn borer
larvae – most damaging insect to corn in US and canada.
Chapter 12 - DNA Technology and the Human Genome
Genetically modify organisms (GMO’s) and transgenic organisms
GMO food:
Ordinary rice“Golden” rice
- “Golden” rice is genetically engineered with genes that
code for enzymes that make beta-carotene, a precursor to
Vitamin A for countries deficient in foods with Vit. A…
- This rice has never been used because of environmental
Chapter 12 - DNA Technology and the Human Genome
Genetically modify organisms and transgenic organisms
GMO medicine:
AAT Sheep
Genetically engineered sheep with the human gene for alpha-1antitrypsin (AAT).
AAT is extracted from their milk and used to treat humans deficient in
AAT, which is one cause of emphysema (a breathing disorder) in
approximately 100,000 people in the western world.
Chapter 12 - DNA Technology and the Human Genome
Genetically modify organisms and transgenic organisms
GMO medicine:
E. Coli with the human insulin gen
- Insulin is made using the bacterium E. coli.
- The human gene coding for insulin is inserted into E. coli, which will
then make insulin for us (we will see how this is done shortly)…
Chapter 12 - DNA Technology and the Human Genome
Genetically modify organisms and transgenic organisms
Conclusion
- We can basically move any gene(s)
between members of a species or between
any species.
- We can also alter the genes to our liking
(GFP tagged proteins) before inserting them
into embryos.
Is all of this genetic engineering positive,
negative?
Chapter 12 - DNA Technology and the Human Genome
Genetically modify organisms and transgenic organisms
Let’s look at some of the ways we genetically
engineer organisms starting with how we can
take a human insulin gene and put it into E.
coli…
Chapter 12 - DNA Technology and the Human Genome
How can we use bacteria to manipulate DNA and protein?
First we must
understand bacteria
and how they take up
DNA…
(it is more than mutation that give
them their genetic diversity)
Chapter 12 - DNA Technology and the Human Genome
How can we use bacteria to manipulate DNA and protein?
There are three methods by which bacteria take up DNA in n
1. Transformation
Bacteria can take up a free piece of
bacterial DNA
Fig. 12.1A-C
Chapter 12 - DNA Technology and the Human Genome
How can we use bacteria to manipulate DNA and protein?
There are three methods by which bacteria take up DNA in n
2. Transduction
Bacteriophage is mistakenly packaged
with bacterial DNA. Injects this DNA
into another bacteria.
Fig. 12.1A-C
Chapter 12 - DNA Technology and the Human Genome
How can we use bacteria to manipulate DNA and protein?
There are three methods by which bacteria take up DNA in n
3. Conjugation
“Male” (F+) bacteria extend sex pili
(long tube) to “female” (F-) bacteria.
Part of chromosome is replicated and
transferred.
Fig. 12.1A-C
Chapter 12 - DNA Technology and the Human Genome
How can we use bacteria to manipulate DNA and protein?
Once the DNA is transferred, integration must occur:
Fig. 12.1D
Crossing over occurs (where do you think we got it from?) and
the new DNA is integrated in place of the original DNA, which is
degraded.
Chapter 12 - DNA Technology and the Human Genome
How can we use bacteria to manipulate DNA and protein?
1. Transformation 2. Transduction
3. Conjugation
Where have we observed transformation before in this class?
The Griffith experiment when he mixed the R strain with
the heat-killed S strain…
Chapter 12 - DNA Technology and the Human Genome
How can we use bacteria to manipulate DNA and protein?
1. Transformation 2. Transduction
3. Conjugation
We will focus mostly on transformation when we look at genetic
Chapter 12 - DNA Technology and the Human Genome
How can we use bacteria to manipulate DNA and protein?
Transformation in the lab:
Heat Shock Method
1. Take bacteria in a tube (in solution)
2. Add the DNA you want it to take up
into the tube.
3. Let the tube chill on ice for a few
1. Transformation
minutes
4. Then quickly heat the tube to 42°C (107°F) for 90
seconds.
- This will open up “holes” in the bacterial membrane for the
DNA to slip in.
5. Cool on ice for 10 minutes…done
The bacterium now has the DNA…simple.
Chapter 12 - DNA Technology and the Human Genome
How can we use bacteria to manipulate DNA and protein?
Bacteria can have more than just a
single circular chromosome…
(They may have little circular extra-chromosomal DNA called
Plasmids)
extra-chromosomal = outside of the chromosome like extraterrestrial means coming from outside Earth (E. T.)
Chapter 12 - DNA Technology and the Human Genome
How can we use bacteria to manipulate DNA and protein?
The majority of the DNA above is chromosomal, but you can see
the small circular pieces not part of the chromosome…plasmids.
Fig. 12.2C
Chapter 12 - DNA Technology and the Human Genome
How can we use bacteria to manipulate DNA and protein?
Plasmid
- Small, circular piece of DNA distinct from bacterial
chromosome
- has own origin of replication (ori)
- carries genes/insert genes at the polylinker region
- called vectors when used in genetic engineering…
Chapter 12 - DNA Technology and the Human Genome
How can we use bacteria to manipulate DNA and protein?
Recall how a bacterium defends itself when a
bacteriophage injects its DNA into a bacterium…
The bacterium has enzymes called restriction
enzymes that attempt to cut up the bacteriophage
DNA before it can take over the cell. Different
species have different restriction enzymes…
Aside: Why do these enzymes not cut the bacterial chromosome?
The bacterial chromosome is methylated (modified by adding –
CH3 groups so the enzymes can’t bind to it)
Chapter 12 - DNA Technology and the Human Genome
How can we use bacteria to manipulate DNA and protein?
Restriction enzymes
1. molecular DNA scissors (enzymes that cut DNA)
2. Different restriction enzymes cut different sequences.
3. Scientists have isolated hundreds of different restriction
enzymes from many different bacteria – EcoRI, BamHI, NcoI,
etc…
Chapter 12 - DNA Technology and the Human Genome
How can we use bacteria to manipulate DNA and protein?
Restriction enzymes
Ex. EcoRI
Notice anything interesting about this sequence?
- It is palindromic, read the same way forward and backward.
- Majority of restriction sites are palindromic…
Fig. 12.4
Chapter 12 - DNA Technology and the Human Genome
How can we use bacteria to manipulate DNA and protein?
Restriction enzymes
Ex. EcoRI
EcoRI
Notice that is doesn’t cut straight through like paper scissors. The enzyme cuts
each strand after the G nucleotide generating single-strand regions called sticky
Chapter 12 - DNA Technology and the Human Genome
How can we use bacteria to manipulate DNA and protein?
Restriction enzymes
Ex. EcoRI
EcoRI
Why do you think we call them sticky ends?
Because they can base pair to a complementary strand…they are “sticky”. If it
cut straight through then it could no base pair.
Chapter 12 - DNA Technology and the Human Genome
How can we use bacteria to manipulate DNA and protein?
Restriction enzymes
More examples of
restriction enzymes
Chapter 12 - DNA Technology and the Human Genome
How can we use bacteria to manipulate DNA and protein?
Subcloning
Now that we understand transformation, plasmids and
restriction enzymes, we are ready to take the next step and
learn how to take a gene from an organism of choice (ex.
Human insulin) and put it into a bacterium so that the
bacterium can make the polypeptide (insulin) for us. This
process is called subcloning.
Chapter 12 - DNA Technology and the Human Genome
How can we use bacteria to manipulate DNA and protein?
Subcloning
Ex. EcoRI
plasmid (vector)
Now imagine this restriction site was in a plasmid (vector).
Chapter 12 - DNA Technology and the Human Genome
How can we use bacteria to manipulate DNA and protein?
Subcloning
Ex. EcoRI
BamHI
What happens if you treat it with the restriction enzyme BamHI?
Nothing, BamHI does not cut that sequence.
Chapter 12 - DNA Technology and the Human Genome
How can we use bacteria to manipulate DNA and protein?
Subcloning
Ex. EcoRI
EcoRI
What happens if you treat it with the restriction enzyme EcoRI?
Chapter 12 - DNA Technology and the Human Genome
How can we use bacteria to manipulate DNA and protein?
Subcloning
Ex. EcoRI
EcoRI
EcoRI cuts the vector leaving two sticky ends…
Now what?
We need to insert our gene of choice into the plasmid.
Chapter 12 - DNA Technology and the Human Genome
How can we use bacteria to manipulate DNA and protein?
Subcloning
1. You can isolate the DNA from the organism of interest, which
has the gene you want to put into the vector.
Fig. 12.3
Chapter 12 - DNA Technology and the Human Genome
How can we use bacteria to manipulate DNA and protein?
Subcloning
Zoom in
…CGATTAGAATCCCGCC Insulin gene
…GCTAATCTTAGGGCGG
CGGATTGAATCCCGAA…
GCCTAACTTAGGGCTT…
What do we need to do?
Chapter 12 - DNA Technology and the Human Genome
How can we use bacteria to manipulate DNA and protein?
Subcloning
Zoom in
…CGATTAGAATTCCGCC Insulin gene
…GCTAATCTTAAGGCGG
CGGATTGAATTCCGAA…
GCCTAACTTAAGGCTT…
2. Cut the gene out with the same restriction enzyme that you
cut the plasmid/vector with.
Fig. 12.3
Chapter 12 - DNA Technology and the Human Genome
How can we use bacteria to manipulate DNA and protein?
Subcloning
Zoom in
…CGATTAG
AATTCCGAA…
…GCTAATCTTAA
What now?
AATTCCGCCInsulin gene
GGCGG
CGGATTG
GCCTAACTTAA
Chapter 12 - DNA Technology and the Human Genome
How can we use bacteria to manipulate DNA and protein?
Subcloning
+
AATTCCGCC Insulin gene
GGCGG
CGG
GCC
3. Mix the cut vector with the cut gene…what should happen?
Chapter 12 - DNA Technology and the Human Genome
How can we use bacteria to manipulate DNA and protein?
Subcloning
The sticky ends should base pair (the two pieces anneal).
However, you still have gaps between the nucleotides in each
strand…what should we do?
Chapter 12 - DNA Technology and the Human Genome
How can we use bacteria to manipulate DNA and protein?
Subcloning
DNA ligase
Use DNA ligase to ligate the strands together
Every enzyme/protein we discover is a new tool for scientists to use in the
lab to manipulate DNA. DNA ligase was discovered when investigating
DNA replication, but now we use it as a “glue” when subcloning genes into
vectors.
Now
what should we do with this vector containing our gene or inte
Chapter 12 - DNA Technology and the Human Genome
How can we use bacteria to manipulate DNA and protein?
Subcloning
Put it into bacteria like E. coli by
transformation using the heatshock method.
Since the vector has an origin of replication, it will be replicated by DNA
polymerase inside the bacterium when the chromosome is replicated during
binary fission.
Now our gene is inside the bacteria. How does this help us?
Chapter 12 - DNA Technology and the Human Genome
How can we use bacteria to manipulate DNA and protein?
Subcloning
1. We can take the bacteria after many round of binary fission and isolate the
plasmid/vector, and take back the gene. In essence, the bacteria replicated it
for us…
2. Or we can have the bacterium make the protein for us and then we can
take the protein and use it.
Chapter 12 - DNA Technology and the Human Genome
How can we use bacteria to manipulate DNA and protein?
Review Slide
Fig. 12.3
Chapter 12 - DNA Technology and
the Human Genome
How can we use bacteria to
manipulate DNA and protein?
Review Slide
What is the problem with this if
we were subcloning a eukaryotic
gene?
INTRONS!! If you take a
eukaryotic gene and insert it
straight into a vector, the introns
are still there and bacteria cannot
splice
out
How do
weintrons.
fix this?
Fig. 12.5
Chapter 12 - DNA Technology and the Human Genome
How can we use bacteria to manipulate DNA and protein?
Let the eukaryotic cell take out
the introns for you…
Instead of taking the gene from
the eukaryotic cell, take the
processed mRNA.
But this leads to another problem, we can’t put RNA into a DNA
plasmid…
Fig. 12.7
Chapter 12 - DNA Technology and the Human Genome
How can we use bacteria to manipulate DNA and protein?
Make cDNA
(complementary DNA)
from the mRNA:
1. Isolate mRNA from gene of
interest
2. use reverse transcriptase to make
a dsDNA copy
3. cut with restriction enzyme
and ligate into a vector
Advantages to cDNA
1. No introns
2. No junk DNA
Fig. 12.7
Chapter 12 - DNA Technology and the Human Genome
How can we use bacteria to manipulate DNA and protein?
Summary
1. Isolate plasmid
2. Isolate gene of interest (straight from
genome if bacterial or via mRNA if eukaryotic)
3. Cut both with same restriction enzyme
4. Mix together to allow sticky ends to ANNEAL
forming recombinant DNA
5. Ligate using DNA ligase
6. Transform bacteria with vector (plasmid)
7. Bacteria will express (make) the protein and
divide making more copies of the gene (gene
Chapter 12 - DNA Technology and the Human Genome
How can we use bacteria to manipulate DNA and protein?
Conclusion
We can make any protein we want or more
of any gene (gene cloning) by putting it into
a plasmid and transforming a bacterium.
Chapter 12 - DNA Technology and the Human Genome
AIM: What are some other tools of DNA technology?
There is another, more efficient way
of making more of any gene or DNA
segment we want…using a method
called:
PCR (Polymerase Chain Reaction)
Technique used to amplify (make more of) a specific piece
of DNA. Can be a gene or any other segment. It is
essentially DNA replication in a test tube…
http://www.maxanim.com/genetics/PCR/PCR.htm
Chapter 12 - DNA Technology and the Human Genome
AIM: What are some other tools of DNA technology?
http://www.youtube.com/watch?v=x5yPkxCLads
Chapter 12 - DNA Technology and the Human Genome
AIM: What are some other tools of DNA technology?
A crime has been committed and
you have a suspect as well as a tiny
bit of DNA sample from the scene
of the crime. What do you do?
The first thing you do is PCR the DNA to make more copies
of it…
Chapter 12 - DNA Technology and the Human Genome
AIM: What are some other tools of DNA technology?
Fig. 12.11A
**Everyone’s DNA (genes) have a
slightly different sequence, so we all
have different restriction sites.
The allele of this person has two
restriction sites.
How many restriction fragments
(DNA pieces) would there be after
three
cutting with the restriction
enzyme?
Amplified section of the
DNA from the crime scene
Chapter 12 - DNA Technology and the Human Genome
AIM: What are some other tools of DNA technology?
You have a suspect. What should
you do?
Use PCR to amplify the same segment of the subjects DNA
and cut it with the same restriction enzyme.
Chapter 12 - DNA Technology and the Human Genome
AIM: What are some other tools of DNA technology?
Fig. 12.11A
How many restriction fragments will
two
the suspects DNA yield?
The suspect has a different allele
with a mutation in the first restriction
site. The restriction enzyme will not
cut this sequence.
Conclusion:
The suspect did not commit the
crime.
Amplified section of the
Amplified section of the
DNA from the crime scene same DNA segment from the
Chapter 12 - DNA Technology and the Human Genome
AIM: What are some other tools of DNA technology?
Fig. 12.11A
This is great, but you can’t see DNA
like this…
How can we OBSERVE the
DNA and count the number of
fragments?
Amplified section of the
Amplified section of the
DNA from the crime scene same DNA segment from the
Chapter 12 - DNA Technology and the Human Genome
AIM: What are some other tools of DNA technology?
Gel Electrophoresis
This technique allows one to not only indirectly view the DNA,
but also to separate and view the DNA fragments.
Fig. 12.10
Chapter 12 - DNA Technology and the Human Genome
AIM: What are some other tools of DNA technology?
Gel Electrophoresis
Gel (like jell-o)
The gel is made of either agarose or polyacrylamide. It has
tiny, microscopic pores that DNA can fit through.
Fig. 12.10
Chapter 12 - DNA Technology and the Human Genome
AIM: What are some other tools of DNA technology?
Gel Electrophoresis
Gel (like jell-o)
The DNA sample is loaded in the wells at the top of the gel.
One sample per well.
Fig. 12.10
Chapter 12 - DNA Technology and the Human Genome
AIM: What are some other tools of DNA technology?
Gel Electrophoresis
Electricity (electrons
flow from top of gel by the
samples to the bottom of
the gel)
Electricity is then run through the gel. Why do you think the
negative end is on the sample side and the positive end is on
the other end
gel?because the phosphates are negative. The
DNAofis the
negative
Fig. 12.10 negative electrons moving down push the DNA down with them.
Chapter 12 - DNA Technology and the Human Genome
AIM: What are some other tools of DNA technology?
Gel Electrophoresis
Which will move faster through the micro-porous gel, the
longer DNA fragments or the shorter DNA fragments?
The small fragments (fewer nucleotides) will move more easily through the gel and
hence go faster than the large ones.
Chapter 12 - DNA Technology and the Human Genome
AIM: What are some other tools of DNA technology?
Gel Electrophoresis
The gel is soaked with a a compound called ethidium bromide,
which sticks to DNA and lights up when you hit the gel with UV
light…
Fig. 12.10
Chapter 12 - DNA Technology and the Human Genome
AIM: What are some other tools of DNA technology?
Gel Electrophoresis
You are not observing the DNA move. You are seeing a blue dye added to
the sample move through the gel. You cannot see the DNA until you put
the gel under a UV lamp.
http://www.youtube.com/watch?v=Wwgs-FjvWlw&feature=related
Chapter 12 - DNA Technology and the Human Genome
AIM: What are some other tools of DNA technology?
Gel Electrophoresis
AIM: What are some of the
other tools of DNA technology?
Virtual Lab
(http://www.vivo.colostate.edu/hbooks/genetics/biotech/gels/virgel.html)
Chapter 12 - DNA Technology and the Human Genome
AIM: What are some other tools of DNA technology?
Draw what the gel would
look like for the
restriction digest of the
criminal and the suspect.
Amplified section of the
Amplified section of the
DNA from the crime scene same DNA segment from the
Chapter 12 - DNA Technology and the Human Genome
AIM: What are some other tools of DNA technology?
Criminal’s
DNA fingerprint
criminal
suspect
Suspect’s
DNA fingerprint
Fig. 12.11A
Chapter 12 - DNA Technology and the Human Genome
AIM: What are some other tools of DNA technology?
Can also be used to detect
disease or determine
paternity.
Chapter 12 - DNA Technology and the Human Genome
AIM: What are some other tools of DNA technology?
Review:
1. Use PCR to get more of the desired
2. Digest DNA with restriction enzymes
DNA
3. Run restriction fragments on a gel
(gel electrophoresis)
4. Compare fragments
Chapter 12 - DNA Technology and the Human Genome
AIM: What are some other tools of DNA technology?
Question: You have been given two DNA samples
that have gone through PCR. Both samples are of the
same DNA segment with a size of 1kb (1 kilobase =
1000bp). Sample 1 has four restriction sites at 100bp,
300bp, 350bp, and 700bp. The second piece has the
same sites in addition to a fifth site at 725bp. Draw
how the gel should look for these two pieces.
Chapter 12 - DNA Technology and the Human Genome
AIM: What are some other tools of DNA technology?
100bp
300bp350bp
700bp
Sample 1
Segments of DNA:
Five segments in total 50bp, 100bp, 200bp, 300bp, 350bp
100bp
300bp350bp
700bp
Sample 2
725bp
Six segments in total 25bp, 50bp, 100bp, 200bp, 275bp, 350bp
Chapter 12 - DNA Technology and the Human Genome
AIM: What are some other tools of DNA technology?
-
Sample
1
350bp
Sample
2
350bp
300bp
e
275bp
200bp
200bp
100bp
100bp
50bp
50bp
25bp
+
Do not forget
to label the
charges on the
gel and show
the flow of
electrons (the
current).
Chapter 12 - DNA Technology and the Human Genome
AIM: What are some other tools of DNA technology?
Gel electrophoresis can be done using proteins as
well. In this case the gel is made of polyacrylamide
and the proteins are coated with negatively charged
molecules since they are not always negative like
DNA. It is a little more complicated, but not much…
Chapter 12 - DNA Technology and the Human Genome
NEW AIM: Understanding the human genome.
Humans - 3 billion nucleotides in a haploid set of chromosomes
(775 of your textbooks)
1000X more DNA than E. coli
E. coli
H. sapiens
~2000 genes ~35000 genes
Protein coding genes
tRNA coding genes
rRNA coding genes
97% of our genome is non-coding (typical of eukaryotes)
-gene control seqeunces (promoters, enhancers, etc…)
-mostly “junk DNA” (unknown function)
-includes introns (which can be 10X the length of the
neighboring exon and DNA between genes
Chapter 12 - DNA Technology and the Human Genome
NEW AIM: Understanding the human genome.
DNA between genes
-much is repetitive DNA (2 types)
1. Short repeats (few nucleotides repeated over and over)
- Ex) …CATGCATGCATGCATGCATGCATG…
- Found at centromeres and telomeres (ends
of chromosomes)
Chapter 12 - DNA Technology and the Human Genome
NEW AIM: Understanding the human genome.
2. Long repeats
- Repeats are hundreds of nucleotide pairs long
- Blocks of repeats are scattered around the genome
- Function unknown
- Associated with “jumping genes” known as Transposons
Chapter 12 - DNA Technology and the Human Genome
AIM: Understanding the human genome.
Chapter 12 - DNA Technology and the Human Genome
AIM: Understanding the human genome.
Fig. 12.13B
Chapter 12 - DNA Technology and the Human Genome
AIM: Understanding the human genome.
Fig. 12.14
Chapter 12 - DNA Technology and the Human Genome
NEW AIM: Making transgenic organisms.
“Pharm” animals
Fig. 12.16
Chapter 12 - DNA Technology and the Human Genome
AIM: Making transgenic organisms.
Fig. 12.18AB
Chapter 12 - DNA Technology and the Human Genome
AIM: Making transgenic organisms.
Chapter 12 - DNA Technology
and the Human Genome
AIM: Making transgenic
organisms.
Gene Therapy
- Replacing a defective gene
with a normal gene.
Fig. 12.19
Fig. 12.20AB
Fig. 12.21ABC
AIM: How can bacteria be used as tools to manipulate DNA?
Fig. 12.2AB
Chapter 12 - DNA Technology and the Human Genome
AIM: What are some other tools of DNA technology?
1. We need more of the DNA
Fig. 12.12
Chapter 12 - DNA Technology and the Human Genome
AIM: What are some other tools of DNA technology?
PCR - Polymerase Chain Reaction
-DNA polymerase
-nucleotides (A,T,C,G)
-Primers
-PCR machine (Heat Cycler)
Fig. 12.12
AIM: What are some of the other tools of DNA technology?
Fig. 12.12
AIM: What are some of the other tools of DNA technology?
Fig. 12.12
AIM: What are some of the other tools of DNA technology?
Fig. 12.12