* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download 8.4 Transcription
Cancer epigenetics wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Designer baby wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Long non-coding RNA wikipedia , lookup
DNA vaccination wikipedia , lookup
Epigenetics in learning and memory wikipedia , lookup
Short interspersed nuclear elements (SINEs) wikipedia , lookup
DNA polymerase wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Molecular cloning wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Polyadenylation wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Messenger RNA wikipedia , lookup
Epigenomics wikipedia , lookup
Microevolution wikipedia , lookup
History of genetic engineering wikipedia , lookup
Epigenetics of human development wikipedia , lookup
RNA silencing wikipedia , lookup
Nucleic acid tertiary structure wikipedia , lookup
DNA supercoil wikipedia , lookup
Point mutation wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Transcription factor wikipedia , lookup
History of RNA biology wikipedia , lookup
Non-coding DNA wikipedia , lookup
Epitranscriptome wikipedia , lookup
Helitron (biology) wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Non-coding RNA wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Deoxyribozyme wikipedia , lookup
8.4 Transcription KEY CONCEPT – DNA directs the synthesis of proteins through three steps (Replication, Transcription, & Translation) Transcription is step 2 of Protein Synthesis and converts a gene into a single-stranded RNA molecule. 8.4 Transcription DNA directs the synthesis of proteins through three steps (Replication, Transcription, & Translation) What was step ONE of protein synthesis? 8.4 Transcription • Yuuuuuhhhp,… Replication of new copies of DNA for new daughter cells. 8.4 Transcription RNA carries DNA’s instructions. • RNA copies the DNA’s info (in a gene) from the nucleus and takes it to the cytoplasm. • The central dogma states that information flows in one direction from DNA to RNA to proteins. 8.4 Transcription • The central dogma includes three processes. – Replication – Transcription replication – Translation transcription • RNA is a link between DNA and proteins. translation 8.4 Transcription • RNA differs from DNA in three major ways. – RNA has a ribose sugar (DNA has a deoxy ribose sugar.) – RNA has uracil (U), (DNA has thymine - T, instead.) – RNA is a single-stranded structure, (DNA is ?). RNA 8.4 Transcription • Transcription is catalyzed (started) by RNA polymerase. – RNA polymerase and other proteins form a transcription complex. Step 1. The transcription complex recognizes the start of a gene and unwinds a segment of it. start site transcription complex nucleotides 8.4 Transcription Step 2. Nucleotides pair with one strand of the DNA. – RNA polymerase bonds the nucleotides together. – The DNA helix winds again as the gene is transcribed. DNA RNA polymerase moves along the DNA 8.4 Transcription 3. The RNA strand detaches from the DNA once the gene is transcribed. RNA 8.4 Transcription • Transcription makes three types of RNA. – Messenger RNA (mRNA) carries the message that will be translated to form a protein. – Ribosomal RNA (rRNA) forms part of ribosomes where proteins are made. – Transfer RNA (tRNA) brings amino acids from the cytoplasm to a ribosome (to assemble a protein). 8.4 Transcription TESTIFY! • What mRNA strand will be transcribed from the following DNA sequence (gene)? Gene (DNA) Sequence: ATTAGATTACAATTTGATTACCA 8.4 Transcription An-swer: Gene: A T T A G A T T A C A A T T T G A T T A C C A (only 1 of the 2 DNA strands Is copied) mRNA: U A A U C U A A U G U U A A A C U A A U G G U 8.4 Transcription Summary: The transcription process is similar to replication. • Transcription and replication both involve complex enzymes and complementary base pairing. • The two processes have different end results. – Replication copies all the DNA; one gene growing RNA strands transcription copies a gene. – Replication makes DNA one copy; transcription can make many copies. 8.4 Transcription How is DNA used by your cells? DNA stores an organism’s genetic information in sections called “genes”, the info to make one protein, in a three step process: Replication, Transcription, and Translation. There are two categories of proteins: 1)enzymes (proteins that catalyze reactions) 2)structural proteins that form parts – structures – of your cells and body.