* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download I = -[1/3*log 2 (1/3)+ 1/3*log 2 (1/3)+ 1/3*log 2 (1/3)] + 4.32 = 2.73
Epigenetics of diabetes Type 2 wikipedia , lookup
Gene nomenclature wikipedia , lookup
Genomic imprinting wikipedia , lookup
Gene therapy wikipedia , lookup
Short interspersed nuclear elements (SINEs) wikipedia , lookup
Gene expression programming wikipedia , lookup
Segmental Duplication on the Human Y Chromosome wikipedia , lookup
Gene expression profiling wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Human genetic variation wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
Adeno-associated virus wikipedia , lookup
Oncogenomics wikipedia , lookup
Genetic engineering wikipedia , lookup
Microevolution wikipedia , lookup
Gene desert wikipedia , lookup
Copy-number variation wikipedia , lookup
Metagenomics wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
History of genetic engineering wikipedia , lookup
Genome (book) wikipedia , lookup
Transposable element wikipedia , lookup
Designer baby wikipedia , lookup
Public health genomics wikipedia , lookup
Non-coding DNA wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Pathogenomics wikipedia , lookup
Minimal genome wikipedia , lookup
Helitron (biology) wikipedia , lookup
Whole genome sequencing wikipedia , lookup
Human genome wikipedia , lookup
Genomic library wikipedia , lookup
Human Genome Project wikipedia , lookup
Genome browsers Visualization of genomic data survey • How many have used a genome browser ? • UCSC browser ? • Ensembl browser ? • Others ? Genome browsers Visualization of genomic data Genome browsers Visualization of a gene Flat files / tab files >sequence ATGAAGTTATGGGATGTCGTGGCTGTCTGCCTGGTGCTGCTCCACACCGC GTCCGCCTTCCCGCTGCCCGCCGGTAAGAGGCCTCCCGAGGCGCCCGCCG AAGACCGCTCCCTCGGCCGCCGCCGCGCGCCCTTCGCGCTGAGCAGTGAC TGTAAGAACCGTTCCCTCCCCGCGGGGGGGCCGCCGGCGGACCCCCTCGC ACCCCCACCCGCAGCCAGCCCCGCACGTACCCCAAGCCAGCCTGATGGCT GTGTGGCCTACCGACCCGTGGGCAAGGGGTGCGGGTGCTGAAGCCCCCAG GGGTGCCTGGCTGCCCACTGCTGCCCGCACGCCTGGCCTGAAAGTGACAC GCGCTGGTTTGCCCAGCACAGAGGGGATGGAATTTTTATGCTGCTCCTTT AGCATTCTGATGAACAAATATCCTCCCCACCAGCACCACCACCTCAGAAA Chr5 123.004.678 123.404.678 124.987.012 125.345.112 Genome browsers Why graphic Display ? Why is a graphic display better than Flat files / tab files • A graphic display is compact • Meta data available i.e. Support information about a gene • Experimental evidence like EST • Predicted gene structures • SNP information • Links to many databases In short much data about a gene is gathered is one place and can be viewed easily. Genome browsers Visualization of a gene (Ensembl) Genome browsers Visualization of a gene (UCSC) Exon Intron UTR Genome browsers Genome browsers Genome browsers • UCSC genome browser • http://genome.ucsc.edu/ • Easy to use • Often updates, but not as often as Ensembl • upload of personal tracks • Ensembl browser • http://www.ensembl.org/index.html • Less easy to use • Maintained/updated by several people • Gbrowser • http://www.gmod.org/GBrowse UCSC genome browser Basic functionalities • Finding a gene • by name • by sequence • Gene structure • Sequence orthologues • Single Nucleotide Polymorphisms • Gene Sorter - sort according to expression, homology ... • Custom tracks BLAT genome Browser http://genome.ucsc.edu// BLAT genome Browser Using a search term or position eg Chr1:10,234-11,567 BLAT genome Browser http://genome.ucsc.edu/ BLAT genome Browser Using a protein or DNA sequence BLAT Blast Like Alignment Tool • BLAT (2002) • Very fast searches (MySQL database) • Handle introns in RNA/DNA alignments • Data for more that 30 genomes (human, mouse, rat…) Splice sites Exon Intron Exon Blat genome Browser BLAT genome Browser ”Details” Correct splice site ? Logo Plot Information Content IC = -H(p) + log2(4) = a palog2pa + 2 The Information content is calculated from a multiple sequence alignment. Result is a graphical visualization of sequence conservation where: • Total height at a position is the Information Content • Height of single letter is proportional to the frequency of that letter Mutiple alignment of 3 protein sequences: Seq1: A L R K P Q R T Seq2: A V R H I L L I Seq3: A I K V H N N T Pos1: I = -[1*log2(1)]+ 4.32 = log2(20) = 4.32 Pos2: I = -[1/3*log2(1/3)+ 1/3*log2(1/3)+ 1/3*log2(1/3)] + 4.32 = 2.73 Pos3: I = -[2/3*log2(2/3)+ 1/3*log2(1/3) + 4.32 = 3.38 Logo Plot Exon BLAT genome Browser ”Details” Correct splice site ? BLAT genome Browser ”Details” Donor site | Acceptor site exon... . G | GT ...intron ...AG | exon... Blat genome Browser BLAT genome Browser ”Browser” Known genes Predictions RNA EST Expression Conservation Base, Center & Zoom BLAT genome Browser Center & zoom BLAT genome Browser Center & zoom Selected number of tracks Forward/reverse direction BLAT genome Browser Sequence Orthologs BLAT genome Browser Sequence Orthologs “klick” BLAT genome Browser Sequence Orthologs BLAT genome Browser Sequence Orthologs BLAT genome Browser Sequence Orthologs SNPs SNPs Chromosomal locus • A locus is a physical location on a chromosome • p the ‘short arm’ • q the ‘long arm’ • A locus range may describe a location of a gene • 22q11.21-q11.23 QuickTi me™ and a decompressor are needed to see thi s pi ctur e. 22q12.2 Chromosome Arm Band Sub-band 22 q 12 2 Chromosomal locus Searching with gene name Chromosomal locus Searching with locus range Custom tracks • Upload your personal data • Share data with colleagues • Data need to be related to a reference organism Custom tracks Custom tracks Exercise 1. 2. 3. 4. Basic understanding of the graphics Effect of Single Nucleotide Polymorphisms (SNPs) Finding Orthologue genes Identify chromosomal locus for a gene